ID: 1141972477

View in Genome Browser
Species Human (GRCh38)
Location 16:87492825-87492847
Sequence CGCGCGGCGGGAGGCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972459_1141972477 30 Left 1141972459 16:87492772-87492794 CCTGGGGAGCGCTGGGGGCCGCG No data
Right 1141972477 16:87492825-87492847 CGCGCGGCGGGAGGCGCGGAGGG No data
1141972462_1141972477 12 Left 1141972462 16:87492790-87492812 CCGCGGCCGCGAAACGGACGCTG No data
Right 1141972477 16:87492825-87492847 CGCGCGGCGGGAGGCGCGGAGGG No data
1141972466_1141972477 6 Left 1141972466 16:87492796-87492818 CCGCGAAACGGACGCTGGAGGGG No data
Right 1141972477 16:87492825-87492847 CGCGCGGCGGGAGGCGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972477 Original CRISPR CGCGCGGCGGGAGGCGCGGA GGG Intergenic