ID: 1141972557

View in Genome Browser
Species Human (GRCh38)
Location 16:87493111-87493133
Sequence TTGGGGACCCGGCACAATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972557_1141972571 15 Left 1141972557 16:87493111-87493133 CCGTGATTGTGCCGGGTCCCCAA No data
Right 1141972571 16:87493149-87493171 CCGCGGCCACGCCTCCCTGGGGG No data
1141972557_1141972567 12 Left 1141972557 16:87493111-87493133 CCGTGATTGTGCCGGGTCCCCAA No data
Right 1141972567 16:87493146-87493168 GTTCCGCGGCCACGCCTCCCTGG No data
1141972557_1141972562 -2 Left 1141972557 16:87493111-87493133 CCGTGATTGTGCCGGGTCCCCAA No data
Right 1141972562 16:87493132-87493154 AATCCCATTCGCCCGTTCCGCGG No data
1141972557_1141972569 14 Left 1141972557 16:87493111-87493133 CCGTGATTGTGCCGGGTCCCCAA No data
Right 1141972569 16:87493148-87493170 TCCGCGGCCACGCCTCCCTGGGG No data
1141972557_1141972568 13 Left 1141972557 16:87493111-87493133 CCGTGATTGTGCCGGGTCCCCAA No data
Right 1141972568 16:87493147-87493169 TTCCGCGGCCACGCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972557 Original CRISPR TTGGGGACCCGGCACAATCA CGG (reversed) Intergenic
No off target data available for this crispr