ID: 1141973018

View in Genome Browser
Species Human (GRCh38)
Location 16:87495605-87495627
Sequence TACCAGAGGCTGCAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141973014_1141973018 -5 Left 1141973014 16:87495587-87495609 CCAAGGAGTGCCTGGGCCTACCA 0: 1
1: 3
2: 18
3: 79
4: 360
Right 1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141973018 Original CRISPR TACCAGAGGCTGCAAGAGAC AGG Intergenic
No off target data available for this crispr