ID: 1141973018 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:87495605-87495627 |
| Sequence | TACCAGAGGCTGCAAGAGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141973014_1141973018 | -5 | Left | 1141973014 | 16:87495587-87495609 | CCAAGGAGTGCCTGGGCCTACCA | 0: 1 1: 3 2: 18 3: 79 4: 360 |
||
| Right | 1141973018 | 16:87495605-87495627 | TACCAGAGGCTGCAAGAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141973018 | Original CRISPR | TACCAGAGGCTGCAAGAGAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||