ID: 1141980375

View in Genome Browser
Species Human (GRCh38)
Location 16:87546562-87546584
Sequence CAGTGGCAGCAGAAATGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141980375_1141980384 9 Left 1141980375 16:87546562-87546584 CCGGACCATTTCTGCTGCCACTG No data
Right 1141980384 16:87546594-87546616 GCCGGCCACTCACCTCTGTTGGG No data
1141980375_1141980379 -9 Left 1141980375 16:87546562-87546584 CCGGACCATTTCTGCTGCCACTG No data
Right 1141980379 16:87546576-87546598 CTGCCACTGGGTGCCCTAGCCGG No data
1141980375_1141980383 8 Left 1141980375 16:87546562-87546584 CCGGACCATTTCTGCTGCCACTG No data
Right 1141980383 16:87546593-87546615 AGCCGGCCACTCACCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141980375 Original CRISPR CAGTGGCAGCAGAAATGGTC CGG (reversed) Intergenic
No off target data available for this crispr