ID: 1141981036

View in Genome Browser
Species Human (GRCh38)
Location 16:87550687-87550709
Sequence CCCCATAAGCACGTGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141981036_1141981048 8 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981048 16:87550718-87550740 AGTTCTGGGGTTGGGAGCCATGG No data
1141981036_1141981044 -5 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981044 16:87550705-87550727 TGGGGCCTGGCTGAGTTCTGGGG No data
1141981036_1141981051 25 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981051 16:87550735-87550757 CCATGGTGAGCAGAACAGACGGG No data
1141981036_1141981045 -1 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981045 16:87550709-87550731 GCCTGGCTGAGTTCTGGGGTTGG No data
1141981036_1141981052 26 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981052 16:87550736-87550758 CATGGTGAGCAGAACAGACGGGG No data
1141981036_1141981049 24 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981049 16:87550734-87550756 GCCATGGTGAGCAGAACAGACGG No data
1141981036_1141981047 0 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981047 16:87550710-87550732 CCTGGCTGAGTTCTGGGGTTGGG No data
1141981036_1141981043 -6 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981043 16:87550704-87550726 ATGGGGCCTGGCTGAGTTCTGGG No data
1141981036_1141981042 -7 Left 1141981036 16:87550687-87550709 CCCCAGTCCACGTGCTTATGGGG No data
Right 1141981042 16:87550703-87550725 TATGGGGCCTGGCTGAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141981036 Original CRISPR CCCCATAAGCACGTGGACTG GGG (reversed) Intergenic
No off target data available for this crispr