ID: 1141983587

View in Genome Browser
Species Human (GRCh38)
Location 16:87565319-87565341
Sequence CTGGAGATGCCCCGCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983587_1141983593 -2 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983593 16:87565340-87565362 AGTTCCGGCCAGAATGCTGGTGG No data
1141983587_1141983596 7 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data
1141983587_1141983591 -5 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983587_1141983598 23 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983587 Original CRISPR CTGGAGATGCCCCGCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr