ID: 1141983591

View in Genome Browser
Species Human (GRCh38)
Location 16:87565337-87565359
Sequence TCCAGTTCCGGCCAGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983587_1141983591 -5 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983580_1141983591 21 Left 1141983580 16:87565293-87565315 CCCGCTGCTTCCGCACGCAGTCG No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983579_1141983591 25 Left 1141983579 16:87565289-87565311 CCTGCCCGCTGCTTCCGCACGCA No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983589_1141983591 -10 Left 1141983589 16:87565324-87565346 CCTGCGGGGCATCTCCAGTTCCG No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983581_1141983591 20 Left 1141983581 16:87565294-87565316 CCGCTGCTTCCGCACGCAGTCGT No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983586_1141983591 -4 Left 1141983586 16:87565318-87565340 CCCAGCCCTGCGGGGCATCTCCA No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983588_1141983591 -9 Left 1141983588 16:87565323-87565345 CCCTGCGGGGCATCTCCAGTTCC No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data
1141983582_1141983591 11 Left 1141983582 16:87565303-87565325 CCGCACGCAGTCGTGCCCAGCCC No data
Right 1141983591 16:87565337-87565359 TCCAGTTCCGGCCAGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983591 Original CRISPR TCCAGTTCCGGCCAGAATGC TGG Intergenic
No off target data available for this crispr