ID: 1141983596

View in Genome Browser
Species Human (GRCh38)
Location 16:87565349-87565371
Sequence CAGAATGCTGGTGGCCTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983588_1141983596 3 Left 1141983588 16:87565323-87565345 CCCTGCGGGGCATCTCCAGTTCC No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data
1141983587_1141983596 7 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data
1141983589_1141983596 2 Left 1141983589 16:87565324-87565346 CCTGCGGGGCATCTCCAGTTCCG No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data
1141983586_1141983596 8 Left 1141983586 16:87565318-87565340 CCCAGCCCTGCGGGGCATCTCCA No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data
1141983582_1141983596 23 Left 1141983582 16:87565303-87565325 CCGCACGCAGTCGTGCCCAGCCC No data
Right 1141983596 16:87565349-87565371 CAGAATGCTGGTGGCCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983596 Original CRISPR CAGAATGCTGGTGGCCTCTC CGG Intergenic
No off target data available for this crispr