ID: 1141983598

View in Genome Browser
Species Human (GRCh38)
Location 16:87565365-87565387
Sequence TCTCCGGAAGTGTGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983589_1141983598 18 Left 1141983589 16:87565324-87565346 CCTGCGGGGCATCTCCAGTTCCG No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983587_1141983598 23 Left 1141983587 16:87565319-87565341 CCAGCCCTGCGGGGCATCTCCAG No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983586_1141983598 24 Left 1141983586 16:87565318-87565340 CCCAGCCCTGCGGGGCATCTCCA No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983595_1141983598 -6 Left 1141983595 16:87565348-87565370 CCAGAATGCTGGTGGCCTCTCCG No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983588_1141983598 19 Left 1141983588 16:87565323-87565345 CCCTGCGGGGCATCTCCAGTTCC No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983594_1141983598 -2 Left 1141983594 16:87565344-87565366 CCGGCCAGAATGCTGGTGGCCTC No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data
1141983592_1141983598 4 Left 1141983592 16:87565338-87565360 CCAGTTCCGGCCAGAATGCTGGT No data
Right 1141983598 16:87565365-87565387 TCTCCGGAAGTGTGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983598 Original CRISPR TCTCCGGAAGTGTGCCAGCT TGG Intergenic
No off target data available for this crispr