ID: 1141983706

View in Genome Browser
Species Human (GRCh38)
Location 16:87565920-87565942
Sequence CACCAAAGCCTTCCCCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983706_1141983716 -1 Left 1141983706 16:87565920-87565942 CCCCTCAGGGGAAGGCTTTGGTG No data
Right 1141983716 16:87565942-87565964 GGGGAGGTGGTGTTCTGCCGGGG No data
1141983706_1141983717 0 Left 1141983706 16:87565920-87565942 CCCCTCAGGGGAAGGCTTTGGTG No data
Right 1141983717 16:87565943-87565965 GGGAGGTGGTGTTCTGCCGGGGG No data
1141983706_1141983714 -3 Left 1141983706 16:87565920-87565942 CCCCTCAGGGGAAGGCTTTGGTG No data
Right 1141983714 16:87565940-87565962 GTGGGGAGGTGGTGTTCTGCCGG No data
1141983706_1141983715 -2 Left 1141983706 16:87565920-87565942 CCCCTCAGGGGAAGGCTTTGGTG No data
Right 1141983715 16:87565941-87565963 TGGGGAGGTGGTGTTCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983706 Original CRISPR CACCAAAGCCTTCCCCTGAG GGG (reversed) Intergenic
No off target data available for this crispr