ID: 1141983926

View in Genome Browser
Species Human (GRCh38)
Location 16:87567297-87567319
Sequence CACAGGTAAAAGCCGACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983926_1141983933 27 Left 1141983926 16:87567297-87567319 CCCCTCGTCGGCTTTTACCTGTG No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data
1141983926_1141983932 -2 Left 1141983926 16:87567297-87567319 CCCCTCGTCGGCTTTTACCTGTG No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983926 Original CRISPR CACAGGTAAAAGCCGACGAG GGG (reversed) Intergenic
No off target data available for this crispr