ID: 1141983932

View in Genome Browser
Species Human (GRCh38)
Location 16:87567318-87567340
Sequence TGCTGGAGGTTTCGTGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983926_1141983932 -2 Left 1141983926 16:87567297-87567319 CCCCTCGTCGGCTTTTACCTGTG No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983919_1141983932 22 Left 1141983919 16:87567273-87567295 CCTGTCCCCTCGCTTCCTTGACC No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983922_1141983932 15 Left 1141983922 16:87567280-87567302 CCTCGCTTCCTTGACCACCCCTC No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983925_1141983932 1 Left 1141983925 16:87567294-87567316 CCACCCCTCGTCGGCTTTTACCT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983918_1141983932 23 Left 1141983918 16:87567272-87567294 CCCTGTCCCCTCGCTTCCTTGAC No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983921_1141983932 16 Left 1141983921 16:87567279-87567301 CCCTCGCTTCCTTGACCACCCCT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983927_1141983932 -3 Left 1141983927 16:87567298-87567320 CCCTCGTCGGCTTTTACCTGTGC No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983928_1141983932 -4 Left 1141983928 16:87567299-87567321 CCTCGTCGGCTTTTACCTGTGCT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983920_1141983932 17 Left 1141983920 16:87567278-87567300 CCCCTCGCTTCCTTGACCACCCC No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983917_1141983932 26 Left 1141983917 16:87567269-87567291 CCTCCCTGTCCCCTCGCTTCCTT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983916_1141983932 27 Left 1141983916 16:87567268-87567290 CCCTCCCTGTCCCCTCGCTTCCT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data
1141983924_1141983932 7 Left 1141983924 16:87567288-87567310 CCTTGACCACCCCTCGTCGGCTT No data
Right 1141983932 16:87567318-87567340 TGCTGGAGGTTTCGTGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983932 Original CRISPR TGCTGGAGGTTTCGTGTAAG TGG Intergenic
No off target data available for this crispr