ID: 1141983933

View in Genome Browser
Species Human (GRCh38)
Location 16:87567347-87567369
Sequence GCTGTGTGAGTTTGTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141983926_1141983933 27 Left 1141983926 16:87567297-87567319 CCCCTCGTCGGCTTTTACCTGTG No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data
1141983928_1141983933 25 Left 1141983928 16:87567299-87567321 CCTCGTCGGCTTTTACCTGTGCT No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data
1141983925_1141983933 30 Left 1141983925 16:87567294-87567316 CCACCCCTCGTCGGCTTTTACCT No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data
1141983931_1141983933 10 Left 1141983931 16:87567314-87567336 CCTGTGCTGGAGGTTTCGTGTAA No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data
1141983927_1141983933 26 Left 1141983927 16:87567298-87567320 CCCTCGTCGGCTTTTACCTGTGC No data
Right 1141983933 16:87567347-87567369 GCTGTGTGAGTTTGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141983933 Original CRISPR GCTGTGTGAGTTTGTGTGTG TGG Intergenic
No off target data available for this crispr