ID: 1141989654

View in Genome Browser
Species Human (GRCh38)
Location 16:87602699-87602721
Sequence GCCCGCAGCGCGGCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 241}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141989635_1141989654 22 Left 1141989635 16:87602654-87602676 CCGTGCCGCCGCCGCCGCCCGCG 0: 1
1: 10
2: 57
3: 408
4: 1410
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989640_1141989654 11 Left 1141989640 16:87602665-87602687 CCGCCGCCCGCGGGCCCCGCCGC 0: 1
1: 1
2: 22
3: 180
4: 1238
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989643_1141989654 4 Left 1141989643 16:87602672-87602694 CCGCGGGCCCCGCCGCCGCCCTC 0: 1
1: 2
2: 20
3: 217
4: 1556
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989638_1141989654 17 Left 1141989638 16:87602659-87602681 CCGCCGCCGCCGCCCGCGGGCCC 0: 2
1: 8
2: 69
3: 397
4: 1884
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989646_1141989654 -3 Left 1141989646 16:87602679-87602701 CCCCGCCGCCGCCCTCGGGCGCC 0: 1
1: 7
2: 8
3: 67
4: 590
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989647_1141989654 -4 Left 1141989647 16:87602680-87602702 CCCGCCGCCGCCCTCGGGCGCCC 0: 1
1: 0
2: 4
3: 57
4: 503
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989648_1141989654 -5 Left 1141989648 16:87602681-87602703 CCGCCGCCGCCCTCGGGCGCCCG 0: 1
1: 0
2: 5
3: 79
4: 523
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989634_1141989654 23 Left 1141989634 16:87602653-87602675 CCCGTGCCGCCGCCGCCGCCCGC 0: 2
1: 10
2: 93
3: 636
4: 3108
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989639_1141989654 14 Left 1141989639 16:87602662-87602684 CCGCCGCCGCCCGCGGGCCCCGC 0: 1
1: 3
2: 21
3: 259
4: 1339
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989633_1141989654 26 Left 1141989633 16:87602650-87602672 CCGCCCGTGCCGCCGCCGCCGCC 0: 4
1: 39
2: 190
3: 1780
4: 3273
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989632_1141989654 29 Left 1141989632 16:87602647-87602669 CCGCCGCCCGTGCCGCCGCCGCC 0: 2
1: 17
2: 113
3: 1602
4: 3255
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989641_1141989654 8 Left 1141989641 16:87602668-87602690 CCGCCCGCGGGCCCCGCCGCCGC 0: 1
1: 7
2: 23
3: 260
4: 1478
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989642_1141989654 5 Left 1141989642 16:87602671-87602693 CCCGCGGGCCCCGCCGCCGCCCT 0: 1
1: 0
2: 10
3: 116
4: 790
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241
1141989649_1141989654 -8 Left 1141989649 16:87602684-87602706 CCGCCGCCCTCGGGCGCCCGCAG 0: 1
1: 0
2: 2
3: 41
4: 425
Right 1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 29
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141989654 Original CRISPR GCCCGCAGCGCGGCAGCCGC AGG Intronic
900100645 1:960734-960756 GCCCGGAGCACGGCAGCCCGGGG + Exonic
900100659 1:960777-960799 GCCTCCACCGCCGCAGCCGCCGG + Exonic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903839117 1:26225653-26225675 GCCTGGAGCGCGGCGGCAGCTGG + Intergenic
904199783 1:28812262-28812284 GGCCGGGGCGCGGCAGCCGGCGG + Exonic
904236940 1:29122436-29122458 GCCCGCAGCGAAGCTGCAGCAGG + Exonic
904718201 1:32485166-32485188 GCCCGAAGCGCCGCAGCCCCTGG - Exonic
904847354 1:33430543-33430565 GCCCGCGCCGCGGCAGCCCGTGG - Intronic
905862628 1:41361446-41361468 GCGCTGAGCGCGGCAGGCGCGGG + Intergenic
905990674 1:42334924-42334946 CCCCGCAACGCGGCTGCGGCTGG + Exonic
907329868 1:53663808-53663830 GCCAGCGGCGGGGCAGCCCCAGG + Intronic
907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG + Intergenic
909232294 1:73105927-73105949 GGACGCAGCGAGGCAGCTGCAGG + Intergenic
910261259 1:85295836-85295858 AGCAGCAGCGCGGCAGCCCCTGG + Intergenic
910788131 1:91022147-91022169 GCCCGCAGCCCGGCAGAGGCGGG - Exonic
912381525 1:109250285-109250307 GCCCGCATCCCTGCAGCGGCTGG - Exonic
914813736 1:151048085-151048107 GCCAAGAGCTCGGCAGCCGCTGG - Exonic
915938631 1:160104180-160104202 GCCTGCAGCGCGGCAGGCATGGG - Intergenic
916717972 1:167461067-167461089 GTCCCCAGCGTGGCAGCTGCAGG - Intronic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
918015953 1:180632458-180632480 CCCCGCAGCCCCGCTGCCGCCGG + Intronic
919991033 1:202709007-202709029 CCCCGCAGGGCGGCAGCAGTAGG + Intronic
923462136 1:234216584-234216606 GCCCGTGGCGAGGCAGCTGCTGG - Intronic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
1063115572 10:3069117-3069139 GCCCGCAGCGCAGCCTCCCCAGG + Intronic
1065101608 10:22336581-22336603 GCGCGCAGCCCCGCAGCCCCTGG - Intergenic
1065861659 10:29877266-29877288 GCCAGCAGCGGGGAAGCCGGGGG + Intergenic
1066389080 10:34964362-34964384 GCAGGCAGAGCGGCAGCCGCAGG + Intergenic
1066464524 10:35640839-35640861 CCCCGCACCGCGGCGGCGGCAGG - Exonic
1068788401 10:61001589-61001611 CCCCGCAGGGCGGCGGCTGCCGG - Intergenic
1069564047 10:69451495-69451517 GCTGGTAGCCCGGCAGCCGCAGG + Exonic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1071966588 10:90858087-90858109 GGACGCGGCGCGGCTGCCGCAGG - Intergenic
1072656663 10:97334626-97334648 GCCCGCAGCTCCGCGCCCGCGGG - Exonic
1075139529 10:119818831-119818853 GCCCGCTGCGCGGTAGGCGGAGG - Intronic
1075207099 10:120457235-120457257 TCCCGCAGCTCGGCCGGCGCCGG - Exonic
1076729717 10:132432267-132432289 GCCTGCAGGGCGGGAGCCCCCGG - Intergenic
1077017414 11:403176-403198 GCTCGCAGCGCTGCAGCAGCCGG - Exonic
1077069665 11:662865-662887 GCCCTCAGCACGGCAGCAGGGGG + Intronic
1079297068 11:19242706-19242728 GGTCGCAGCGCAGCAGCTGCCGG + Intergenic
1079361957 11:19777129-19777151 CCTCGCAGCGCGGAGGCCGCTGG - Intronic
1079451198 11:20601246-20601268 GGCGGCGGGGCGGCAGCCGCGGG - Exonic
1080551265 11:33375944-33375966 CTCCGCTGCGCGGGAGCCGCCGG + Intergenic
1081773996 11:45665497-45665519 ACCCGGAGCGCCGCAGCCCCGGG + Exonic
1081863606 11:46347794-46347816 GCCCGAAGAGCCGCAGCCCCGGG - Intronic
1082807618 11:57460696-57460718 GCCCGCAGCCCGGGCGGCGCAGG + Exonic
1082986156 11:59172567-59172589 CCGCGCAGCGCCGCAGCCCCGGG + Exonic
1083827998 11:65213944-65213966 GGCCGCAGGGCAGCAGCAGCAGG - Intergenic
1083927607 11:65818041-65818063 GCCGGCCGCGCGGCTCCCGCAGG + Intergenic
1085641578 11:78196323-78196345 GGAGGCGGCGCGGCAGCCGCTGG + Exonic
1087014728 11:93543619-93543641 ACCCGCTGCGCGGGAGCCGGAGG - Intergenic
1088585090 11:111354536-111354558 GCCCGCAGTGGGGCCCCCGCTGG - Exonic
1088764265 11:112961442-112961464 GAACGCAGCTCGGCTGCCGCTGG + Exonic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1091121663 11:133062908-133062930 GTCCCCAGCGCTGCAGCTGCCGG - Intronic
1092219156 12:6700898-6700920 TCCTGCAGCGCGGCAGCAGGAGG - Intergenic
1093547980 12:20369756-20369778 GCCAGCAGCGCGACAGCCAGAGG - Exonic
1096191300 12:49622138-49622160 GCTGGCATCGCGGCAGCCCCCGG + Intronic
1101493874 12:105235857-105235879 GCCCCCGGCCGGGCAGCCGCGGG - Intronic
1102038690 12:109786882-109786904 GCCACCAGAGCGGCAGGCGCAGG - Intronic
1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG + Exonic
1102937634 12:116911122-116911144 GCCCGCCTCTCGGCAGCCTCGGG - Exonic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103779359 12:123389021-123389043 CCGCGCACCGCGGCAGCCCCGGG - Intronic
1105027035 12:132856214-132856236 GCCAGCAGAGCGTCAGCCGCAGG - Intronic
1105217448 13:18297507-18297529 CCGCGCACCGCGGCAGCCCCGGG - Intergenic
1105270897 13:18874961-18874983 GCCTGCACCGCGGTGGCCGCCGG + Intergenic
1105327334 13:19382399-19382421 GCCCGCAGCGCGGGGCCCGGAGG + Intergenic
1105533035 13:21237313-21237335 CCCCGCAGCACAGCAGCCCCAGG + Intergenic
1106602457 13:31199863-31199885 GCCGCCAGCCCGGCAGACGCTGG + Intergenic
1107787107 13:43968558-43968580 GCCCGAAGAGCCGCAGCCCCGGG - Intergenic
1108618627 13:52159584-52159606 GCCCGCCCCGCGGAAGCCGCCGG - Exonic
1109284784 13:60397420-60397442 ACCCGCGGCCCGGCAGCCGGCGG - Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1112091631 13:96090235-96090257 CCCCGCAGCGCAGCGGCAGCGGG - Intergenic
1113742602 13:112721886-112721908 GCCGTCAGCACCGCAGCCGCTGG + Intronic
1113770199 13:112903376-112903398 GCCCTCAGGGCAGCAGCCGTGGG - Intronic
1114618541 14:24081490-24081512 GCCCGCAGCCCCGCAGCTGCCGG + Exonic
1116019437 14:39442392-39442414 GCCCGCTCCGCAGCAGCAGCTGG + Intergenic
1117251834 14:53946792-53946814 GCCTGCCGCGCGGCTCCCGCGGG + Intergenic
1118312582 14:64704631-64704653 GCCCGCGTCGCGGCAGCACCTGG + Exonic
1121691027 14:95877088-95877110 ACCCGGAGCGCCGGAGCCGCAGG - Intergenic
1122145082 14:99684192-99684214 GCCCGGAGCGCCGGAGCCGGAGG + Intergenic
1122688782 14:103522007-103522029 GCCCGCAGCCCCGCACCTGCAGG + Exonic
1123014112 14:105365437-105365459 GCCCGCAGCGGGCCAGGGGCGGG - Intronic
1124922285 15:34038816-34038838 GCGCCCCGCGAGGCAGCCGCCGG - Exonic
1125834291 15:42736586-42736608 GCCCGCCGCGGGGTAGCCGCGGG - Exonic
1129592789 15:76932020-76932042 CCTCGCACCGCGGCTGCCGCGGG + Intronic
1129903382 15:79169024-79169046 ACCCACAGGGAGGCAGCCGCTGG - Intergenic
1130549504 15:84881019-84881041 GCACGCAGCGCGGTGGCCCCTGG + Intergenic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132372368 15:101307691-101307713 CATCGCAGCCCGGCAGCCGCTGG - Intronic
1132647138 16:1004320-1004342 GCCCGGAGCACGGCAGGCACAGG + Intergenic
1136498782 16:30659489-30659511 GCCCTCAGCGCCGCATCCGGAGG - Exonic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1139466048 16:67154768-67154790 GCACGAAGCGCCGCAGCAGCTGG + Exonic
1139750382 16:69106290-69106312 CTCCGGAGCGCGGCAGCCGGCGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142163140 16:88569844-88569866 GCTCGCACCGCTGCAGCCCCTGG + Intergenic
1142212891 16:88816745-88816767 GGCTGCAGCGTGGGAGCCGCTGG - Intronic
1142245634 16:88968923-88968945 GCCTGCAGCGCTGCAGACCCTGG - Intronic
1142290633 16:89192357-89192379 GCCAGCAGCGCTGCGGCCCCCGG - Exonic
1142518753 17:490331-490353 ACCCGCAGCCCGGCAGCCCCGGG + Intergenic
1143139175 17:4731293-4731315 GCCCGCTGCGCCTCAGCCACAGG - Intergenic
1143512833 17:7405473-7405495 GCCCGCAGCGCCTCACCCGGCGG - Intronic
1144848226 17:18231018-18231040 GCACGCAGCGCAGCACCCACAGG - Intronic
1145265255 17:21376826-21376848 GCAGCCAGCGCGGCAGCTGCCGG + Exonic
1145327704 17:21844354-21844376 GCCCTCAGAGCGGCGGCGGCGGG - Intergenic
1145971793 17:28960525-28960547 GACAGCAGCGGGGCAGCTGCAGG - Exonic
1147672414 17:42184271-42184293 GCCCGCGGCGTGGTTGCCGCTGG + Exonic
1147742512 17:42676986-42677008 GCCCCCAGCGCGCCAGTCCCGGG - Intronic
1147907638 17:43833192-43833214 CCGCCCGGCGCGGCAGCCGCAGG - Intergenic
1148225185 17:45894439-45894461 GCGGGCAGCGCGGCCTCCGCGGG - Exonic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148909221 17:50931633-50931655 GCGGGCAGCTCTGCAGCCGCGGG + Intergenic
1149597839 17:57874626-57874648 GCCTGCAGCGTGGCAACCGCAGG + Intronic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1152525350 17:80885157-80885179 ACCCCCAGCCCGGCAGCAGCAGG + Intronic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152695229 17:81740885-81740907 GCACGCAGGGCGGGAGGCGCGGG + Intergenic
1152714341 17:81891354-81891376 GCCCGCGGCGCGGCCGGCGGAGG - Exonic
1153030907 18:712303-712325 GCCCGCAGAGCTGCAGTCGGCGG + Intronic
1157464307 18:47930803-47930825 GCCAGCAGCCCGCCAGCCGCCGG - Intronic
1158137738 18:54224630-54224652 GCCCGCAGCGCGGCGCGCGGGGG + Exonic
1158434915 18:57428687-57428709 CCCCGCAGCTCGGCAGGCGGAGG - Intergenic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1160543498 18:79638216-79638238 GCCCGGAGCGGTGCAGCCTCGGG + Intergenic
1160983572 19:1827517-1827539 GCCCGCAGGCCAGCAGCCCCCGG - Exonic
1161038297 19:2097244-2097266 GCCCGCAGCCCGGGAGAAGCTGG + Exonic
1161221801 19:3121238-3121260 GCCACCCGCCCGGCAGCCGCAGG - Exonic
1161521122 19:4723917-4723939 GCCCGCGGCGCGGCGGCCTAAGG + Intronic
1162924044 19:13920742-13920764 GCCCACAGCCCAGCAGCAGCTGG + Exonic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1163475473 19:17523528-17523550 GCCCCCAGAGCGGCAGGCACGGG + Intronic
1163548311 19:17951913-17951935 GCCCGGAGAGCGGAAGCCCCTGG - Intronic
1163796532 19:19341287-19341309 GCCCGCAGAGGGTCAGCAGCGGG - Exonic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
1165062216 19:33210493-33210515 GCCTCCAGCGCAGCAGCAGCAGG + Exonic
1165267751 19:34676021-34676043 GACCCCAGCGCGGTTGCCGCTGG + Intergenic
1168337013 19:55602639-55602661 GCCCGCCTCGCGGAAGCGGCGGG - Exonic
1168401117 19:56086874-56086896 GTCCCCGGAGCGGCAGCCGCCGG + Intergenic
925259521 2:2517601-2517623 GCCCCCAGCATGGCAGCCCCTGG + Intergenic
925361356 2:3282704-3282726 GCCAGCACCGCGACAGGCGCCGG - Intronic
927156491 2:20224293-20224315 GGGCGCAGCGCGGCCGGCGCGGG - Intronic
927751316 2:25673250-25673272 TCCTGCAGCGCCGCACCCGCAGG + Intronic
928904505 2:36355871-36355893 CCCCGCAGCGGCGCAGCCTCCGG - Intergenic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
929777716 2:44939065-44939087 GGCGGCAGGGCGGCAGGCGCTGG + Intergenic
934296871 2:91749176-91749198 CCGCGCACCGCGGCAGCCCCAGG + Intergenic
935866468 2:107392559-107392581 GCCCACGGCGGGGTAGCCGCGGG - Intergenic
936580356 2:113694941-113694963 TCCCACAGCGAGGCAGGCGCTGG - Intergenic
937221246 2:120344391-120344413 AGCCCCAGAGCGGCAGCCGCCGG + Intergenic
939034564 2:137115263-137115285 GCCCTCAGTGCGGCAGCTGCTGG - Exonic
941987633 2:171523628-171523650 GCCCGCGGCGAGCCAGCCCCGGG + Intronic
943471007 2:188292978-188293000 GAAGTCAGCGCGGCAGCCGCAGG - Exonic
944831191 2:203535232-203535254 GCGCGCGGCGCGGGAGCTGCTGG - Exonic
946394255 2:219435253-219435275 CCCCGCAGCGCCGCAGCCACAGG - Exonic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
1169496779 20:6123060-6123082 GCGCGCAGCGTGGCAGGCGAGGG + Exonic
1171935813 20:31274163-31274185 CCCCGCAATGCGGCATCCGCTGG + Intergenic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1176253352 20:64137741-64137763 GCCCGGAGTCAGGCAGCCGCAGG + Intergenic
1176867927 21:14064017-14064039 GCCTGCACCGCGGTGGCCGCCGG - Intergenic
1178075508 21:29011419-29011441 CCCCTCCGCCCGGCAGCCGCTGG + Intronic
1178407260 21:32335012-32335034 GGCAGCAGCGGGGCAGCAGCAGG - Intronic
1178555594 21:33588106-33588128 GCCCGCAGCGGGGTAGCCAGGGG + Intronic
1182524284 22:30906020-30906042 GCCCGCAGGCCTCCAGCCGCCGG - Exonic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1184475720 22:44720200-44720222 GCCCGCAGCCTGTCAGCAGCAGG + Intronic
1185228674 22:49668015-49668037 GCCCCCAGCTCAGCAGGCGCAGG + Intergenic
1185279270 22:49962977-49962999 GCCCTCAGAGCGGCCGTCGCTGG + Exonic
1185345076 22:50307453-50307475 GGCCCCAGCGCGGCAGGCCCGGG + Intronic
949217073 3:1583212-1583234 GCCCACAGCGCGGCCTCCCCTGG + Intergenic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
950386352 3:12663688-12663710 GCCCTCTGCCCGGCAGCCGCGGG + Intronic
950421299 3:12901264-12901286 GCCCCCAGAGGGGCTGCCGCAGG - Intronic
951319396 3:21226369-21226391 GCCAGCACCGAAGCAGCCGCTGG + Intergenic
953009731 3:39013524-39013546 GCCCACAGCGGGGAAGCCCCAGG + Intergenic
954630970 3:52047472-52047494 GCCCCCAGCCCAGCACCCGCGGG + Intergenic
955015287 3:55064101-55064123 GTGCGCAGCTCAGCAGCCGCAGG + Intronic
961325914 3:126109273-126109295 GCCAGAAGCGCAGCAGCCACGGG - Intronic
966861027 3:184230855-184230877 GCCCAGAGCGCGGCAGCAGGCGG - Exonic
968305900 3:197651051-197651073 GCCTGCTGCGGGGCAGCCCCAGG - Intergenic
968353204 3:198080246-198080268 CCCCGCAGCCCCGCAGCCCCTGG - Intergenic
968422762 4:499264-499286 GCCGGAAGCGCGGCTGCAGCAGG + Exonic
968574017 4:1356665-1356687 GCCCACAGGATGGCAGCCGCAGG + Intronic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
968746368 4:2362609-2362631 GCCCCCAGCCTGGCAGCCCCTGG - Intronic
969716863 4:8871967-8871989 GCCCCGAGCGCGGCCGCTGCCGG + Intergenic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
974539791 4:63219266-63219288 GCCAGCAGCACAGCAGCAGCAGG - Intergenic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
987132480 5:14872046-14872068 GCCCTCAGCGCCGCCGCCCCCGG - Intergenic
987303376 5:16616851-16616873 CCCCGCAGAGCGGCAGCAGCAGG - Exonic
989100978 5:37822524-37822546 CACCGCACCTCGGCAGCCGCAGG - Intronic
989282801 5:39664991-39665013 GCCCGCACCACGGCAGGCGCTGG - Intergenic
991302758 5:65145080-65145102 GCACACAGCGGGGCAGCTGCTGG - Intergenic
996442996 5:123512613-123512635 GGCCGCGCCGAGGCAGCCGCCGG - Intronic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1002140404 5:177134087-177134109 GCCGGCGGCGCTGCAGCCGCCGG + Intronic
1002722756 5:181273489-181273511 GCCTGCACCGCGGGGGCCGCCGG + Intergenic
1005832386 6:29681111-29681133 GGCCGGAGCGCTCCAGCCGCTGG - Intergenic
1007571054 6:42891073-42891095 GCCCGCAGCGGCGCGTCCGCAGG - Intergenic
1007842928 6:44731395-44731417 GCCAGCAGCAGGGCAGCAGCAGG + Intergenic
1009975677 6:70668197-70668219 GCCCCGAGCGCCGCAGCGGCGGG - Intronic
1010969304 6:82247397-82247419 GCGCGAAGCCCGGCAGCCTCGGG + Intronic
1011044371 6:83065808-83065830 CGCCGCAGCGGGGCTGCCGCTGG - Exonic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1015965645 6:138693290-138693312 GCGCTGGGCGCGGCAGCCGCGGG - Intergenic
1019455498 7:1124858-1124880 ACCCGCTGCGCGGGAGCCGCAGG + Intronic
1019577974 7:1746649-1746671 GCCCGCAGCACGGCGGCCGCGGG - Exonic
1020244663 7:6421325-6421347 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244667 7:6421343-6421365 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244671 7:6421361-6421383 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244675 7:6421379-6421401 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244679 7:6421397-6421419 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244683 7:6421415-6421437 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244687 7:6421433-6421455 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244691 7:6421451-6421473 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244695 7:6421469-6421491 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244699 7:6421487-6421509 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244703 7:6421505-6421527 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244707 7:6421523-6421545 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244711 7:6421541-6421563 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244715 7:6421559-6421581 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244719 7:6421577-6421599 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244723 7:6421595-6421617 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1020244727 7:6421613-6421635 GCAGGCAGCGCGGGAGGCGCAGG + Intronic
1022216770 7:28270696-28270718 GCCCGCTCCGCTGCAGCAGCTGG + Intergenic
1022449886 7:30504799-30504821 GACCGCCGCGCGGCAGCCTCAGG + Exonic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1026765028 7:73154998-73155020 GCCGGCAGAGCAGCAGCCGAGGG - Intergenic
1026858377 7:73769524-73769546 GGCCGCGGCGCTGCAGCTGCTGG - Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1032391099 7:131556067-131556089 CTCCGCAGCGCGGCAGGTGCAGG - Intronic
1032947764 7:136871296-136871318 GCCTGCAGCGCTGCAGCCGCAGG - Intronic
1033275208 7:139966817-139966839 TCCCGCAGGGCGGCATCCTCAGG - Intronic
1034475131 7:151277161-151277183 GCCCGGAGCGGGGGAGGCGCAGG + Intronic
1035634120 8:1130793-1130815 GCCCCCAGCTCTGCAGCGGCTGG + Intergenic
1035649345 8:1253241-1253263 CCACGCAGGGCTGCAGCCGCTGG + Intergenic
1035654206 8:1293292-1293314 GCCCCCAGCCAGGCAGCAGCAGG + Intergenic
1036454226 8:8893485-8893507 GCCCGCAGCATGCCCGCCGCCGG - Exonic
1037725140 8:21477143-21477165 GCAGGCTGCGCTGCAGCCGCTGG + Intergenic
1040423410 8:47260963-47260985 GCCCCGAGCGCGGCTGCCGCGGG - Exonic
1041381758 8:57259552-57259574 GCCCGCAGCACAGCTGCAGCAGG + Intergenic
1042784925 8:72536797-72536819 CCCGGGTGCGCGGCAGCCGCGGG + Intergenic
1042857904 8:73285916-73285938 GCAGGCAGCGCTGCAGCCTCGGG - Intergenic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1045971322 8:108082704-108082726 CCCAGCAGCGCGGCCGGCGCCGG - Exonic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049288583 8:141789949-141789971 GCCAGCGGGGCGGCAGCGGCAGG - Intergenic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1049932397 9:469926-469948 GCCTGCAGCGCTGGAGCCGATGG - Intergenic
1050160989 9:2718458-2718480 GCCCGCAGCGGCGCCGCCTCTGG + Exonic
1053503192 9:38620008-38620030 CCCTGCAGCCCGGCAGCCCCTGG - Intergenic
1055321730 9:75088758-75088780 GCCGGCACCGCGGCGGTCGCAGG - Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1058866651 9:109167172-109167194 GGCCGCAGCGGGGGCGCCGCGGG + Exonic
1060087434 9:120714793-120714815 GCGCCCCGCGCGGCAGACGCCGG + Intergenic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061208696 9:129178475-129178497 CCGCGCGGCGCGGCAGCCCCAGG - Intergenic
1061261423 9:129482774-129482796 GCCCTCCGCCCGGCCGCCGCTGG - Intergenic
1061689263 9:132312134-132312156 GCCCACAGCGGAGCAGCCACAGG - Intronic
1061939925 9:133878520-133878542 GACTGCAGCGGGGCAGCCGTGGG - Intronic
1062085294 9:134645112-134645134 CCCAGCAGTGCGGCAGCCCCAGG + Intronic
1186350123 X:8731959-8731981 GCCGGCCGCCAGGCAGCCGCTGG + Exonic
1186493277 X:9992238-9992260 GCCGGTAGCTCTGCAGCCGCGGG - Intergenic
1192522755 X:71816084-71816106 GCCAACAGCGGGGCAGCCACAGG - Intergenic
1200145854 X:153926319-153926341 GCCCCCAGCGCGGCTCCCGGTGG + Intronic