ID: 1141991244

View in Genome Browser
Species Human (GRCh38)
Location 16:87611632-87611654
Sequence ATAGAGCAGCAGACAGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141991244_1141991251 18 Left 1141991244 16:87611632-87611654 CCCGCCTCTGTCTGCTGCTCTAT 0: 1
1: 0
2: 4
3: 35
4: 458
Right 1141991251 16:87611673-87611695 TGAGTGTTACAAGAACCACCTGG 0: 1
1: 0
2: 0
3: 9
4: 96
1141991244_1141991252 22 Left 1141991244 16:87611632-87611654 CCCGCCTCTGTCTGCTGCTCTAT 0: 1
1: 0
2: 4
3: 35
4: 458
Right 1141991252 16:87611677-87611699 TGTTACAAGAACCACCTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141991244 Original CRISPR ATAGAGCAGCAGACAGAGGC GGG (reversed) Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902712882 1:18252705-18252727 AAAGAGCAGCAGACAGATTTGGG - Intronic
902944355 1:19824048-19824070 ATAGGACAGCAGGCAGAGGTAGG + Intergenic
903365770 1:22804769-22804791 AAGGAGCAGGGGACAGAGGCGGG - Intronic
903647969 1:24906080-24906102 ATAGTGCTGCAGCCAGGGGCTGG - Intronic
903850467 1:26302759-26302781 ATAGAAGAGGATACAGAGGCGGG + Intronic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904999871 1:34659669-34659691 AGAGAGCACAAGAAAGAGGCAGG - Intergenic
905641360 1:39592268-39592290 GGAGAGCAGCATACAGAGTCAGG - Intergenic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906554679 1:46699572-46699594 GCAGAGTAGAAGACAGAGGCCGG + Intronic
906707272 1:47903932-47903954 TCAGAGCAGGAGGCAGAGGCAGG - Intronic
907440671 1:54476137-54476159 AGAGGGGAGCAGGCAGAGGCAGG + Intergenic
908518102 1:64913996-64914018 CTACAGCAGTGGACAGAGGCAGG + Intronic
909721729 1:78778674-78778696 AAAGAGCGCCAGACAGAGGAAGG - Intergenic
909869936 1:80726786-80726808 ACAGCGTAGCAGTCAGAGGCAGG - Intergenic
909949296 1:81700746-81700768 AGAGAGCAGCTGACAATGGCTGG - Intronic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
910982531 1:92973253-92973275 AGAGAGCAGCAGAGAGTGTCAGG - Intergenic
912246789 1:107968306-107968328 TGAGAGCAGGAGGCAGAGGCTGG + Intergenic
912968339 1:114257036-114257058 TTGGAGGAGCATACAGAGGCAGG - Intergenic
913484466 1:119321167-119321189 ATAGGGGAGCAGAAAGAGACTGG - Intergenic
914246026 1:145886190-145886212 GGAGAGCGGCAGCCAGAGGCAGG + Intergenic
914363007 1:146952272-146952294 AATGAGCAGCTGACAGTGGCTGG + Intronic
914488672 1:148134867-148134889 AATGAGCAGCCGACAGTGGCTGG - Intronic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916440887 1:164823590-164823612 AGAGAGCAGCAGTCAGACTCTGG + Intronic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918659175 1:187068345-187068367 ATAGAGCAGGCAACAGAGGCAGG + Intergenic
919429676 1:197477033-197477055 ATCTAGCAGCAGACAACGGCAGG - Intronic
919801918 1:201359380-201359402 ATAGGACAGCAGCCTGAGGCTGG + Intronic
919913918 1:202128597-202128619 AAAGAACAGCAGACACCGGCGGG - Exonic
919918504 1:202153885-202153907 ACAGGGCAGCAGAGAGGGGCTGG + Intronic
919930938 1:202221263-202221285 AGAGAGCAGCTGAAAGGGGCTGG - Intronic
920324776 1:205154675-205154697 ACTGAGTAACAGACAGAGGCTGG + Intronic
920677196 1:208046386-208046408 ATAGAGCGGCAGACACAGTCTGG + Intronic
920879904 1:209870098-209870120 ATAAAACAGCAGACAGATGCTGG - Intergenic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
922324951 1:224519260-224519282 ATAGAACAGAAGGCAGAGGAAGG + Intronic
922988531 1:229885691-229885713 ATGGGGCTGCAGACAGAGACTGG - Intergenic
924614183 1:245599045-245599067 GGAGAGCAGCAGGGAGAGGCGGG + Intronic
1064211101 10:13361141-13361163 ATATAGAAGTAGATAGAGGCTGG - Intergenic
1065083426 10:22150000-22150022 ATAGAACAGAATACAGAGCCCGG - Intergenic
1065690413 10:28326839-28326861 TCAGTGCAGCAGACAGAGCCCGG - Intronic
1065697759 10:28395558-28395580 ATAGAGAAAGAGAGAGAGGCAGG - Intergenic
1065874510 10:29985203-29985225 AGAGAGCAACAGAGAGAGCCAGG - Intergenic
1065876289 10:30000210-30000232 AAAGAGGAGCAGAGAGAGGGAGG - Intergenic
1066066172 10:31762448-31762470 ATAGGGCAGCATTCATAGGCTGG - Intergenic
1066148401 10:32587395-32587417 AGAGAGCAACAGAGAGAGGAAGG + Intronic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067438534 10:46295212-46295234 ATAGAGCAGGAAACTGAGTCAGG + Intronic
1067764619 10:49075645-49075667 ATAGAGACACAGGCAGAGGCTGG + Intronic
1067770628 10:49121031-49121053 GAAGAGCAGGAGACAGAGACAGG - Intergenic
1067828350 10:49595651-49595673 ATACAGCAGCTGACAGAGCATGG + Intergenic
1067852216 10:49761395-49761417 AGAGATCAGTAAACAGAGGCCGG + Intronic
1069335792 10:67348594-67348616 AGAGAGCAAGAGACAGAGGGAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070394994 10:76004528-76004550 AAAGAGCGGCAGACAGTGTCAGG + Intronic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1073096312 10:100982213-100982235 AGGGAGCAGCAGGCAGAGGGAGG + Intronic
1073457539 10:103646727-103646749 ATACAGCAGGAGATAAAGGCTGG + Intronic
1073624051 10:105077898-105077920 AGGGAGCAGTTGACAGAGGCAGG + Intronic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075159649 10:120011954-120011976 AAAGACCAGCAGCCACAGGCCGG - Intergenic
1075825714 10:125355820-125355842 CCAGAGCTGCAGACTGAGGCAGG + Intergenic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076872732 10:133201641-133201663 AGAGCGCAGCAGCCTGAGGCTGG + Exonic
1078290541 11:10006336-10006358 ATGTACCAACAGACAGAGGCAGG - Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080114607 11:28607594-28607616 ATAGATGAGGAAACAGAGGCTGG + Intergenic
1080229352 11:30001190-30001212 CAAGAGGAGCTGACAGAGGCAGG - Intergenic
1081283270 11:41237475-41237497 ATAGAAAAGCTGACAGAGACGGG + Intronic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1084153476 11:67301926-67301948 ATAGCGCTGCTGACAGAGGGTGG - Intronic
1084521397 11:69665217-69665239 AGAGAACAGGAGACAGAGACGGG + Intronic
1084535343 11:69753152-69753174 AGAGAGGAGCAAACAGAGGCTGG - Intergenic
1084941881 11:72617368-72617390 AGAGAGCAGGGCACAGAGGCTGG + Intronic
1085128015 11:74015115-74015137 GGAGAGCAACAGGCAGAGGCTGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1086970232 11:93073511-93073533 AGGTAGCAGCAGGCAGAGGCAGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087164623 11:94989394-94989416 ATCTGGCAGCAGAGAGAGGCAGG - Intronic
1087194906 11:95295674-95295696 ATAGAGCAGGAAAGACAGGCGGG - Intergenic
1087345318 11:96964634-96964656 ATAGGGCACCAGGCAGAGCCCGG + Intergenic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1088832632 11:113550416-113550438 ATAGAGCACTAGCCAGAGGCAGG + Intergenic
1089200512 11:116722082-116722104 CTGGAGCAGGACACAGAGGCTGG - Intergenic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089620903 11:119721647-119721669 ACAGAGCAGCAGACAGGCACGGG - Intronic
1090260102 11:125313246-125313268 AGAAAGGAGCAGACAGAGGGTGG + Intronic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091785481 12:3240701-3240723 ACAGTGCAGCAGAGACAGGCTGG - Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092254943 12:6921722-6921744 CTTGAGCAGCAGACAGTTGCAGG - Exonic
1092260222 12:6949412-6949434 ATACTGCAGCAGACAGCGTCGGG - Intronic
1092532309 12:9354597-9354619 ACAGAGCAGGTGATAGAGGCTGG + Intergenic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1093755022 12:22842502-22842524 TTAGAATAGCAGAAAGAGGCTGG - Intergenic
1094809772 12:34125830-34125852 ATAAAGCAGGAGGCAGAGTCAGG - Intergenic
1094818859 12:34209709-34209731 AGACACCAGCAGAGAGAGGCCGG + Intergenic
1096262464 12:50101458-50101480 TTAGAGTAGCAGGCACAGGCTGG - Intergenic
1096845868 12:54406099-54406121 ATAGTGAAGCAGACATAGGGTGG - Intronic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1099653254 12:85456605-85456627 AGACACCAGCAGACAGTGGCAGG + Intergenic
1099946862 12:89254789-89254811 ATAGAGTGGGATACAGAGGCAGG - Intergenic
1100812161 12:98350006-98350028 TAAGAGCACCAGACAGAGGTAGG - Intergenic
1100883893 12:99048074-99048096 ATAGAGGTGGAGGCAGAGGCTGG + Intronic
1100922119 12:99499926-99499948 ATTGGGCAGCAGACAGAAGCTGG + Intronic
1101967488 12:109291441-109291463 ATTGAGGGGCAGAGAGAGGCGGG + Intronic
1103059531 12:117847546-117847568 TTAGAGCAGGTGACAGATGCTGG - Intronic
1103357642 12:120333471-120333493 AGAGAGCAGGAATCAGAGGCAGG - Intergenic
1104887489 12:132119169-132119191 ATGGTGCCGCAGGCAGAGGCTGG - Intronic
1106225005 13:27778643-27778665 ATCCAGGAGCAGACAGAGCCAGG + Intergenic
1106788788 13:33133258-33133280 AGAGACCAGCAGACAGGGCCAGG - Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107020043 13:35741917-35741939 ATCAAGCTGCAGACAGATGCTGG - Intergenic
1107269340 13:38595993-38596015 ATACAGCAGCCTCCAGAGGCTGG - Intergenic
1107733571 13:43372858-43372880 AGACAGCAGCAGACAGATGGAGG + Intronic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1111184833 13:84720290-84720312 AGACAGCAGCAGACACTGGCAGG + Intergenic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1114731099 14:24993623-24993645 ATAAAGCAGAATACAGAGGGTGG - Intronic
1116510377 14:45737920-45737942 AGAGAGCAACAGACAGATGGAGG + Intergenic
1116647084 14:47541860-47541882 ATAAAGCAGAAGACAGATTCAGG - Intronic
1116725197 14:48554240-48554262 ATAGAGTACCAGTCAGAGTCAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1118034221 14:61849135-61849157 ATAGGGCACAAGACAGAGTCCGG - Intergenic
1118835130 14:69472450-69472472 ATAGAGCAGCATACAGAACATGG - Intergenic
1119956647 14:78805456-78805478 ATTGAGCAGCCTACAGAGACTGG + Intronic
1120104059 14:80474389-80474411 ATTGGGTAGCAGACAGAGGTTGG - Intergenic
1120169458 14:81234339-81234361 ACAAAGGTGCAGACAGAGGCAGG - Intergenic
1121452985 14:94021226-94021248 ATAGAGGAACTGACTGAGGCTGG + Intergenic
1121532434 14:94665106-94665128 GTATTGCAGAAGACAGAGGCAGG + Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121662108 14:95642805-95642827 TCAGAGCAGGAGAAAGAGGCAGG - Intergenic
1122023784 14:98859890-98859912 AGAGAAGAGAAGACAGAGGCTGG + Intergenic
1122803583 14:104245253-104245275 ACAGAGCAGGAGGCTGAGGCTGG + Intergenic
1123418979 15:20115700-20115722 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123446885 15:20337807-20337829 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1123528200 15:21122243-21122265 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123972571 15:25522266-25522288 AAAGAGCATCAGAGAAAGGCAGG + Intergenic
1124047280 15:26161866-26161888 ATAAAGCAGGATCCAGAGGCAGG - Intergenic
1125591569 15:40857541-40857563 CTAGACCAGCAGACAGAGCCAGG + Exonic
1125834545 15:42737478-42737500 TTAGAGCAGAAGATAGAAGCTGG - Intergenic
1126292589 15:47099375-47099397 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1126517657 15:49554120-49554142 ATAGGGCATCAGACAGAGATGGG - Intronic
1128043745 15:64598410-64598432 GTAGATCAGCAGATAGAGGCTGG - Intronic
1128112439 15:65085254-65085276 AAAGACCAGCTGACAGTGGCGGG - Intergenic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128449136 15:67792004-67792026 ACAGAGCACCAGGCAGAGGAGGG + Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128935872 15:71746097-71746119 ACAGAGCAGATGACAGAGGAGGG + Intronic
1129184163 15:73895597-73895619 GTAGTGCAGCATTCAGAGGCTGG + Intergenic
1129676768 15:77635876-77635898 ATAAAGCAGGAGCCAGTGGCTGG + Intronic
1130233221 15:82112520-82112542 AGAGGGCTGCAGACACAGGCAGG + Intergenic
1131296077 15:91150301-91150323 ATAGAGAGACAGACAGAAGCCGG - Intronic
1131457810 15:92597058-92597080 AAAGAGGAGCAGACAAAGGCAGG - Intergenic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1132602304 16:778769-778791 AGAGAGGAGGAGACAGGGGCAGG + Intronic
1133065886 16:3206861-3206883 AAAGAACAGCAGAGTGAGGCTGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133400558 16:5483347-5483369 AAAGAGCAGCAGTCACAGACAGG - Intergenic
1134390675 16:13817077-13817099 ATACAGCAGCACAGAAAGGCTGG - Intergenic
1135551230 16:23399702-23399724 ACACAGAGGCAGACAGAGGCTGG + Intronic
1135800900 16:25494285-25494307 AAAGAGCAGCAGTCTAAGGCTGG - Intergenic
1136573013 16:31108206-31108228 ATAGAGCAGGAGATAGAGGCTGG + Intronic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1137404084 16:48176430-48176452 AAAGAGGAGGAGACAGAGGCTGG + Intronic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137585803 16:49663635-49663657 AGAGGGCAGGAGCCAGAGGCAGG + Intronic
1137719782 16:50621337-50621359 ATAGGGCAGAAGTCATAGGCTGG + Intronic
1138137321 16:54534530-54534552 ATAGAGCAGAACAGAGGGGCAGG - Intergenic
1138542326 16:57695940-57695962 AGGGAGCAGCAGATAAAGGCTGG - Intronic
1139330961 16:66189555-66189577 ATGGAGCAGCAGCCAGAGCTGGG - Intergenic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1141029332 16:80574065-80574087 ACTGAGTAGCAGACAAAGGCAGG - Intergenic
1141114363 16:81295583-81295605 AAAGAGCAGTGGACAGAGTCAGG + Intergenic
1141568156 16:84917325-84917347 ATAGAGCTGAAGACAGTGCCTGG - Intronic
1141659226 16:85432871-85432893 ATAGAGCTGCAGAGAGTGCCGGG - Intergenic
1141667343 16:85472692-85472714 ACAGAGCCGCAGACAGCAGCAGG - Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142243857 16:88959492-88959514 ACAGAGGTGCAGGCAGAGGCAGG + Intronic
1142717964 17:1757465-1757487 ATGGAGCTGGAGACACAGGCGGG + Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143431478 17:6890570-6890592 ATAGTGCAGGAGCCTGAGGCTGG - Intronic
1143620803 17:8079432-8079454 AAAGTGCAGCAGGCAGAGGGGGG + Exonic
1143646594 17:8234473-8234495 AGAGGGCAGCAGACAGAGCCAGG + Exonic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1144837058 17:18162013-18162035 AGAGAGAAGCATTCAGAGGCAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147055409 17:37830551-37830573 AAAGAGTAGCAGGCAGGGGCAGG + Intergenic
1147526651 17:41231167-41231189 GCAGAGCAGCAGACAGAGAAAGG - Intronic
1147528770 17:41253845-41253867 GGAGAGCAGCAGACAGAGAAAGG - Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1148641429 17:49190815-49190837 TCAGAGCACCAGAGAGAGGCTGG + Intergenic
1149160055 17:53682168-53682190 ATGGAACAGAAGACAGAGCCTGG - Intergenic
1149493184 17:57099722-57099744 ACAGAGCAGCAGGCAGAGATGGG + Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1150206507 17:63412580-63412602 AAAAAGCAGCAGTGAGAGGCAGG - Intronic
1150914675 17:69424482-69424504 GTAGATCAGCAAACTGAGGCCGG + Intronic
1150948958 17:69780207-69780229 ATAGAACAAAAGACAGAGGAAGG - Intergenic
1151391815 17:73792317-73792339 ACAGAGCTGGAGCCAGAGGCTGG - Intergenic
1152876202 17:82787568-82787590 GCAGAGCTGCAGGCAGAGGCCGG + Intronic
1152900864 17:82940357-82940379 ACAGAGCAGCATCCACAGGCAGG - Intronic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1153654774 18:7272856-7272878 ACAGGGCAGCAGACACAGTCTGG - Intergenic
1153723520 18:7932138-7932160 AAAGAGCAGAAGACGGAGGTGGG + Intronic
1155466851 18:26145412-26145434 ATAAAACTGCACACAGAGGCCGG - Intronic
1156005562 18:32437170-32437192 AAATAGCACCAGACAGAGCCAGG + Intronic
1156777704 18:40813423-40813445 AAAGAGAAACAGACAGAGACAGG - Intergenic
1157625342 18:49045952-49045974 ACAGTGCAGCAGGCAGAGGCAGG + Intronic
1160269026 18:77367084-77367106 AAAGAGCGGCCGTCAGAGGCAGG + Intergenic
1162452796 19:10764863-10764885 GGTGAGCAGCAGACAGTGGCAGG - Intronic
1162724100 19:12679618-12679640 ATGGAGCAGAACACAGAGGTGGG - Exonic
1165710564 19:38007855-38007877 ATAAAGCAGAAGACAGCGACAGG - Intronic
1165775749 19:38403438-38403460 CTCGAGCAGCAGCGAGAGGCGGG + Exonic
1166198730 19:41222608-41222630 AGAAAGTAGGAGACAGAGGCTGG + Intronic
1166209945 19:41300032-41300054 ACAGAGGAGCAGGCTGAGGCTGG + Intronic
1166361445 19:42254425-42254447 AGCGAGGAGCCGACAGAGGCGGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167467461 19:49657902-49657924 AGAGAGGGGCAGACACAGGCCGG + Intronic
1167787984 19:51651442-51651464 ATGGGGCAGCAGTCAGAGGGTGG - Intergenic
1168473712 19:56661096-56661118 AGAGAGCAGCAGAAAGAGCTGGG - Intergenic
925034941 2:677607-677629 ACAGAGGAGCAGGCGGAGGCGGG + Intergenic
925296967 2:2783662-2783684 GTAGAGCAGCTGAGACAGGCAGG - Intergenic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
925686908 2:6482225-6482247 AGAGAGCAGCACAGATAGGCAGG - Intergenic
925944113 2:8844984-8845006 AGAGAGCAAGAGACAGAGACAGG + Intergenic
926513415 2:13810719-13810741 ATACTGGATCAGACAGAGGCAGG - Intergenic
926527703 2:14002826-14002848 ATAGAGTAGAAGGCAGAGGGCGG + Intergenic
926665150 2:15513647-15513669 AAAGAGCAACAGACAGAAGGAGG + Intronic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
927862398 2:26568293-26568315 ATACTGCAGCAGAGAAAGGCAGG - Intronic
928100158 2:28432128-28432150 TTAGAGCAGCAGATGCAGGCTGG - Intergenic
931607255 2:64065011-64065033 TAAAAGCAGCAGGCAGAGGCCGG + Intergenic
932361633 2:71112919-71112941 ATAGAGCATAAGACAGATGTAGG - Intronic
932401618 2:71484680-71484702 ATAGAGTAGAATCCAGAGGCAGG - Intronic
932721456 2:74141513-74141535 AGAGACCAGCGGGCAGAGGCCGG + Intronic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934169135 2:89324937-89324959 TTAGAGCAGCACACATAGGAAGG + Intergenic
934198158 2:89857647-89857669 TTAGAGCAGCACACATAGGAAGG - Intergenic
934790579 2:97056324-97056346 TTAGAGCAGCACACATAGGAGGG - Intergenic
934815885 2:97326207-97326229 TTAGAGCAGCACACATAGGAGGG + Intergenic
934821810 2:97382276-97382298 TTAGAGCAGCACACATAGGAGGG - Intergenic
935637206 2:105258438-105258460 ATAGAACAGAAGGCAGAGGAAGG + Intergenic
937680720 2:124641260-124641282 ACAGAGGAGGAGACTGAGGCTGG + Intronic
937921460 2:127134694-127134716 AGTGAGCAGCACACACAGGCAGG + Intergenic
938029817 2:127982397-127982419 CTAGAGGAACAGACAGAGGCAGG + Intronic
938395096 2:130940090-130940112 ATTGGGCAGTAGGCAGAGGCTGG - Intronic
940258695 2:151758888-151758910 ATAGAGCAACAGACTGATCCCGG - Intergenic
942510950 2:176699915-176699937 ATAGACAAGCATACATAGGCAGG - Intergenic
943369124 2:186994529-186994551 GTAGAGCAGCAAACATAGGGAGG + Intergenic
943496463 2:188627311-188627333 ATTGAGTATCAGACAGAGACTGG - Intergenic
945321629 2:208430859-208430881 AAAGAGAGCCAGACAGAGGCCGG - Intronic
945569327 2:211445341-211445363 TTAGAGCAGCAGACAGATATGGG + Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946373399 2:219294282-219294304 ACAGAGCAGCAGAGAGAAACTGG + Intronic
946383233 2:219363891-219363913 ATAAAGCAGCAGAGAAAGGGTGG + Intergenic
948434713 2:237945193-237945215 AGACAGCAATAGACAGAGGCAGG + Intergenic
948480696 2:238248341-238248363 AGAGAGCAGGAGAGAGGGGCTGG + Intronic
948518903 2:238523397-238523419 ACAGAGCATCAGACACATGCCGG + Intergenic
1168736636 20:145698-145720 CTAGAGCAGGAGACAGAGGCTGG - Exonic
1168980199 20:1997386-1997408 ACAGAGAAGGAAACAGAGGCTGG + Intergenic
1169020356 20:2326422-2326444 ATGGGGCAGGAGACAGAGGGAGG - Intronic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1171278547 20:23878505-23878527 ACAGAGCAGCAGACTGACACCGG - Intronic
1171357748 20:24563193-24563215 AAAGTGCTGAAGACAGAGGCAGG - Intronic
1171536778 20:25899218-25899240 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1171804330 20:29661939-29661961 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1171839720 20:30194483-30194505 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1172277069 20:33685794-33685816 ACAGAGCAGCAAACAGGGACCGG + Intronic
1172538949 20:35696509-35696531 ATAGAGCTGCAGACACAGGTGGG + Intronic
1172842899 20:37912692-37912714 TTAGAGCAGGAGTCAGAGCCGGG + Intronic
1173059537 20:39648238-39648260 AGAGAGCAGCGGACAGCAGCAGG - Intergenic
1173226009 20:41162861-41162883 CTAGAGCAGCAGATGGGGGCAGG - Intronic
1173418195 20:42877259-42877281 ATGGGCCAGCAGCCAGAGGCTGG - Intronic
1173605723 20:44329963-44329985 AGAGAGCAGAAGACAGAGCCTGG + Intergenic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174153709 20:48503520-48503542 ATGGAGCTGCAGACCCAGGCAGG - Intergenic
1174153721 20:48503618-48503640 ATGGAGCTGCAGACCCAGGCAGG - Intergenic
1175247230 20:57589500-57589522 TCACAGCAGCAGACACAGGCTGG - Intergenic
1175544252 20:59767973-59767995 AGAGACCAGCAGAGAGAGGGAGG - Intronic
1176077828 20:63256518-63256540 TTAGAGCAGCCTCCAGAGGCGGG + Intronic
1176582286 21:8543071-8543093 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1177195743 21:17901652-17901674 ACAGAGCAGCATGCTGAGGCTGG - Intronic
1178157529 21:29872437-29872459 TCAGAGCAGGAGGCAGAGGCGGG - Intronic
1179487900 21:41722559-41722581 GTAGAGGAGCTGAGAGAGGCCGG + Intergenic
1179941802 21:44644529-44644551 AAAGAGAAGCAGACAGAAACAGG + Intronic
1180265121 22:10520119-10520141 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1180552995 22:16555993-16556015 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1180918750 22:19507382-19507404 GTAGAGCACCAGGCGGAGGCTGG - Exonic
1180966222 22:19789216-19789238 AGAGAGCAGCAGAGACAGGGAGG + Intronic
1180971598 22:19818980-19819002 AGGAAGCAGCAGACAGGGGCAGG - Intronic
1181310358 22:21941362-21941384 AAACAGGAGCAGACAGAGTCGGG + Intronic
1181351096 22:22258446-22258468 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182866086 22:33605990-33606012 GGAGAGCAACAGACAAAGGCTGG + Intronic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183273766 22:36878325-36878347 ACAGAGCAGCAGAGACAGGAAGG - Intergenic
1183289558 22:36991376-36991398 CCAGAGCAGGAGACAGAGCCGGG - Intronic
1183324061 22:37182006-37182028 AGAGAGGAGCAGAAATAGGCTGG + Exonic
1184516809 22:44967171-44967193 AGAGACCAGGGGACAGAGGCCGG + Intronic
1184531579 22:45059477-45059499 ATACAGCAGCTGCCAGATGCTGG - Intergenic
1184612737 22:45615380-45615402 CCAGAGCAGCAGTCAGAGGCAGG + Intergenic
949898128 3:8785585-8785607 ATAGATAAGAAGTCAGAGGCTGG + Intronic
950496021 3:13335067-13335089 ATAGAGCACCCAACAGAGGCTGG - Intronic
951923498 3:27881139-27881161 ATAGAGGAGGAGACTGAGACTGG - Intergenic
953136680 3:40187950-40187972 CAAGAGCAGCAGAGAAAGGCAGG + Intronic
953339128 3:42119024-42119046 AGAGAGCAGCAGCCGGTGGCAGG - Intronic
953896641 3:46808300-46808322 ATAGAGCAGCAAGGAGAAGCAGG + Intronic
953896899 3:46809956-46809978 AGAGAGCAGCTGACACAGCCTGG - Intronic
955292997 3:57710088-57710110 ATAGAGTACCATACAGAGCCCGG + Intergenic
955403926 3:58613491-58613513 CCAGAGCAGCAGGCAGGGGCTGG - Intronic
955415362 3:58686567-58686589 ATAGACCAGGTGACAGATGCTGG - Intergenic
957434408 3:80154919-80154941 ATAGGGCACCAGGCAGAGGTGGG - Intergenic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
960214294 3:115011478-115011500 ATAGGCCAGCAGAGAGTGGCAGG + Intronic
960525482 3:118705086-118705108 AGAGAGGAGCAGATAGAAGCAGG + Intergenic
961520049 3:127461864-127461886 ATACAGCAGGAGGAAGAGGCAGG + Intergenic
962313040 3:134339360-134339382 ACTCAGCAGCAGGCAGAGGCCGG - Intergenic
963124238 3:141800107-141800129 ATAAAGAACCAGACAGAAGCAGG + Intronic
963754489 3:149219758-149219780 ATTGGGTAGCAGGCAGAGGCTGG + Intronic
964035553 3:152192304-152192326 ATTGAGGAGCAGAGAGAGACGGG - Intergenic
965322042 3:167262327-167262349 AAAGAGCAACAGGCAGTGGCTGG - Intronic
965406446 3:168275096-168275118 ATAGAGCAGCAGACAGGAGCTGG + Intergenic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
967114984 3:186328961-186328983 AAAGGGCAGAAGGCAGAGGCGGG - Intronic
967324458 3:188225427-188225449 ACAGAGCAGAAGACAGAACCTGG + Exonic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968495280 4:911955-911977 AGAGAAAGGCAGACAGAGGCAGG + Intronic
968525062 4:1052514-1052536 ATGGAGCAGCAGAGACTGGCAGG - Intergenic
968607188 4:1541101-1541123 AGAGAGCAGCAGACAGAGCAGGG + Intergenic
968657648 4:1785588-1785610 AGAGAGCTGGACACAGAGGCTGG - Intergenic
969550208 4:7860955-7860977 GGGGAGCAGCAGACAGAGGGCGG - Intronic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971019387 4:22518225-22518247 ATATAGCAGCAGAAAAGGGCTGG - Intergenic
972031015 4:34458241-34458263 ATACAGACACAGACAGAGGCAGG + Intergenic
973327484 4:48878120-48878142 ATAGGGCACCAGTCAGAGTCAGG - Intergenic
973880711 4:55268852-55268874 ATACAGCAGCAGAAAGATCCAGG + Intergenic
974387654 4:61223730-61223752 ATAGGGAAGCAGACAGAAACTGG - Intronic
974596306 4:64017488-64017510 GCACAGCAGCAGACAAAGGCAGG - Intergenic
974630381 4:64480463-64480485 ATAGGGCACCAGTCAGAGTCAGG - Intergenic
975244703 4:72106618-72106640 TTAGAGTGGCAGAAAGAGGCAGG - Intronic
975300605 4:72786239-72786261 ATATAGCAGAATACAGAAGCAGG + Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976499524 4:85771415-85771437 ATAGAACAACAGGCAGAGGAAGG - Intronic
976947332 4:90786746-90786768 ACAGAGCAGCAGACACCAGCTGG + Intronic
977401864 4:96542497-96542519 AAAGAGGATCAGAGAGAGGCAGG + Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
982680250 4:158419545-158419567 ATACAGCAGCAGAAAGGCGCTGG - Intronic
983099957 4:163613043-163613065 ACAGAGCAGCAGGCAAAGGATGG + Intronic
984529811 4:180902270-180902292 ACTGGGCAGCAGACAGAGTCAGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984927743 4:184821120-184821142 TGAGAGCAGCAGACAGAGCCAGG - Exonic
985756639 5:1723396-1723418 ACAGAGGAAGAGACAGAGGCAGG - Intergenic
986329091 5:6704400-6704422 TTAGAGACACAGACAGAGGCTGG - Intergenic
987357405 5:17076610-17076632 ATAGAATAGCAAACACAGGCCGG + Intronic
988703353 5:33698315-33698337 AAAGATCTGCAGATAGAGGCTGG + Intronic
988787347 5:34577299-34577321 ATAGAACAGAGGCCAGAGGCAGG + Intergenic
989201353 5:38767470-38767492 CTAAAGCAGCAGACAGACTCAGG + Intergenic
989723771 5:44561957-44561979 AAAGATCAGTAGTCAGAGGCTGG - Intergenic
993037372 5:82772424-82772446 ACAGTCCAGCAGTCAGAGGCTGG + Intergenic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
996133450 5:119809759-119809781 ATAGGGCATCAGTCAGAGTCAGG - Intergenic
997368578 5:133341563-133341585 AAAGAGCACCAGACAGAGAGGGG - Intronic
997449245 5:133968452-133968474 ATAGAGCGGCGGACACAAGCAGG + Exonic
999383645 5:151139388-151139410 ACGGAGCAACAGGCAGAGGCAGG - Exonic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999536570 5:152523810-152523832 ATAGAGAAGCAGGCAGATACTGG + Intergenic
1000743220 5:164996326-164996348 ATAGAACACCAGAAATAGGCTGG + Intergenic
1001042996 5:168350164-168350186 ATACAGCAGCAGGCAGAGTCAGG - Intronic
1002304044 5:178273076-178273098 CTAGAGCAGGAGAGAGCGGCCGG - Intronic
1002924648 6:1598283-1598305 AAGAAGCCGCAGACAGAGGCGGG - Intergenic
1004822045 6:19377862-19377884 AGAGAGGAGGAGACAGTGGCAGG - Intergenic
1005364362 6:25062552-25062574 ATAGGCCAGCACACGGAGGCAGG + Intergenic
1006289804 6:33126012-33126034 AGAGAGCAGGAACCAGAGGCAGG + Intergenic
1010574014 6:77510324-77510346 AGAGAGGAGAAGAGAGAGGCTGG + Intergenic
1010842679 6:80665885-80665907 ATAGAGCACTGGACAGAGTCAGG - Intergenic
1011236763 6:85227182-85227204 AAAGAGCAGTAGAGAAAGGCAGG - Intergenic
1012729769 6:102867287-102867309 ATACTGCAGCTGAGAGAGGCTGG - Intergenic
1013792357 6:113852132-113852154 ATATTGCAGCTGACAGGGGCTGG + Intergenic
1015541443 6:134317962-134317984 AAAGAGCAGAAGCCAGAGGGAGG + Exonic
1016460508 6:144276130-144276152 AAAGAGGAGAAGACAGAGGGTGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017349853 6:153427382-153427404 ATAGACCAGCAGACAAAGAAAGG - Intergenic
1017509385 6:155100267-155100289 ATAGAGCAGGAGGCAGGAGCAGG + Intronic
1018438255 6:163782759-163782781 ATGAAGGAGCAGTCAGAGGCTGG + Intergenic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1019705056 7:2493642-2493664 AGAGAGCAGGGGACAGAGACAGG - Intergenic
1022172619 7:27844286-27844308 ATAAAGCAGAGGACAGAGGCTGG - Intronic
1022592674 7:31680755-31680777 ATAGACCAGGACCCAGAGGCTGG + Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1024318833 7:48045467-48045489 AGAGAGCAGCGGTCAGAGGCTGG - Intronic
1024364876 7:48509287-48509309 CTGGACCAGGAGACAGAGGCTGG - Intronic
1025233216 7:57216811-57216833 ATGGAGCTGCAGACCCAGGCAGG + Intergenic
1025233261 7:57217099-57217121 ATGGAGCTGCAGACCCAGGCAGG + Intergenic
1026718831 7:72813470-72813492 TTAGAGAAGCAGTTAGAGGCTGG - Intronic
1027833048 7:83205121-83205143 ATACAGCAGCAGAAAAAGGTAGG - Intergenic
1028411783 7:90537950-90537972 TTAGAGCAGCCAACACAGGCAGG - Intronic
1030136291 7:106253843-106253865 ATAGAGCAAGGGACAGAGGCAGG - Intronic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1032520008 7:132536666-132536688 AAGGAGCTGCAGAGAGAGGCTGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033409501 7:141104483-141104505 ACAGAGCAGCAGATAGAGGGAGG - Intronic
1033671824 7:143500488-143500510 TTAGAGCAGGGGACAGAGACAGG - Intergenic
1034575306 7:151991629-151991651 ATAGAGCAGAAGAGAGATGCTGG - Intronic
1034923651 7:155103605-155103627 GCAGAGCCACAGACAGAGGCAGG + Intergenic
1035570179 8:667443-667465 ATAGAGCTGCAGATAGATCCTGG - Intronic
1035723214 8:1808398-1808420 AAAGACAAGCAGACACAGGCTGG + Intergenic
1036411501 8:8506173-8506195 ACAGAGCAGCAGAGAGCGGTGGG + Intergenic
1036779039 8:11633273-11633295 AGAGAGCAGGAGAGATAGGCAGG - Intergenic
1037932377 8:22889302-22889324 AAACAGCAGGAGGCAGAGGCTGG + Intronic
1038328141 8:26587884-26587906 ATAGAGGGGAAGACTGAGGCCGG + Intronic
1038535704 8:28351623-28351645 GTGGAAGAGCAGACAGAGGCAGG + Exonic
1038581385 8:28752007-28752029 ATGGGGCTCCAGACAGAGGCGGG - Exonic
1039108324 8:34014203-34014225 ATTGAACAGGAGACAGAGTCAGG + Intergenic
1039276366 8:35937227-35937249 AAAAAGCAGCTGGCAGAGGCAGG + Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1040031769 8:42831515-42831537 ATAAAGGAGCAGACAGGGCCAGG - Intergenic
1041102902 8:54414740-54414762 ATCGAGGACCAGTCAGAGGCAGG + Intergenic
1041289479 8:56295501-56295523 AGAGAGCAGCAGACCTAGGAAGG - Intergenic
1042471035 8:69188461-69188483 ATAAGGCAGAAAACAGAGGCAGG - Intergenic
1042561773 8:70077251-70077273 TCAGATCTGCAGACAGAGGCAGG - Intergenic
1043724329 8:83590609-83590631 ATAGGGCACCAGTCAGAGTCAGG - Intergenic
1044370894 8:91409518-91409540 ATTGGGCAGCAAGCAGAGGCTGG - Intergenic
1044386534 8:91595476-91595498 ATGGAGCAGGAGACAGACCCAGG + Intergenic
1045050146 8:98316913-98316935 GTAGGGCAGCGGAGAGAGGCAGG + Intergenic
1045559015 8:103242907-103242929 TTAAAGCTGCAGACAGAGGGAGG - Intergenic
1048231934 8:132651072-132651094 ACAGAACAGGAGATAGAGGCTGG - Intronic
1048308515 8:133300172-133300194 ATAGGTCAGAAGACAGAGGAAGG + Intronic
1048546758 8:135394803-135394825 AGAGAGCAGCAGACAGAACAAGG + Intergenic
1048667042 8:136674027-136674049 ATAGTGGAGTACACAGAGGCTGG - Intergenic
1049414252 8:142488137-142488159 AAGGAGCACCAGGCAGAGGCTGG - Intronic
1050342435 9:4654362-4654384 CTAGAGGAGCAGACAGACGGGGG + Intronic
1053344472 9:37368203-37368225 AAAAAGCAGCTGACACAGGCTGG + Intergenic
1053428130 9:38024490-38024512 TGAGAGGAGCTGACAGAGGCTGG - Intronic
1055087218 9:72326480-72326502 ATAAAGAACCAGATAGAGGCTGG + Intergenic
1055181259 9:73389197-73389219 ATAGGGCAGCAGGCAGAGCTGGG - Intergenic
1055269035 9:74534907-74534929 ATATAGCAGCAGACAAATCCAGG + Intronic
1055615918 9:78072796-78072818 AGAGAGCAGGAGACAGAGTTAGG + Intergenic
1055690639 9:78826707-78826729 AGAGAGCAGAAGAGGGAGGCAGG + Intergenic
1055998995 9:82194170-82194192 CTAGAGCAGCAGACAGACAGTGG + Intergenic
1056275111 9:84986768-84986790 ACAGAGCAGGAGACAGAAGGTGG + Intronic
1057075711 9:92137166-92137188 ACAGAGCAGAGGACAGAGGAAGG + Intergenic
1058226565 9:102371617-102371639 ATAGGGCACCAGACAGAGTGCGG - Intergenic
1058264584 9:102882771-102882793 ATAAAGCAGCAGGCAGATTCCGG - Intergenic
1058621788 9:106890701-106890723 TTAGAGCAGAGGACAAAGGCAGG - Intronic
1058671980 9:107367565-107367587 AAAGAGGAGGAGAGAGAGGCCGG - Intergenic
1059251347 9:112890304-112890326 CTTGAGCAGCAGCCCGAGGCGGG + Exonic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1059417022 9:114168567-114168589 GTAGAGCCGCCAACAGAGGCTGG - Exonic
1059450151 9:114366451-114366473 GAAGAGCAGCCGACGGAGGCTGG + Intronic
1059696443 9:116734335-116734357 ACAGTGCAGCAGAGGGAGGCAGG + Intronic
1060282841 9:122225763-122225785 ATGGAGCCGGAGACAGAGGTTGG + Intronic
1060320982 9:122561329-122561351 ATAGATGAACTGACAGAGGCAGG - Intergenic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1061627408 9:131849102-131849124 AAAGAGCAGAGGACAGAAGCTGG - Intergenic
1061720792 9:132550055-132550077 CTAGAGCAGCACTCAGAGTCTGG + Intronic
1203612304 Un_KI270749v1:21085-21107 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1185533101 X:837737-837759 ATAGAGCAGGAAGCAGGGGCAGG + Intergenic
1186204107 X:7183313-7183335 GTCCAGCAGCAGACAGAGGGAGG - Intergenic
1186522756 X:10220659-10220681 AGAGAACGCCAGACAGAGGCAGG + Exonic
1186851030 X:13580337-13580359 AGAATGCAGCAGAAAGAGGCTGG - Intronic
1187041906 X:15605361-15605383 ACACTGCAGCAGACAGAGACTGG + Intergenic
1187390592 X:18884198-18884220 AGAGCAGAGCAGACAGAGGCAGG - Intergenic
1188013023 X:25077490-25077512 CTAGAGCAACAGAGAAAGGCTGG + Intergenic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1189010081 X:37038263-37038285 ACAAAGGAGCAGAGAGAGGCTGG + Intergenic
1189038503 X:37517467-37517489 ACAAAGGAGCAGAGAGAGGCTGG - Intronic
1189872106 X:45394693-45394715 ACTGGGTAGCAGACAGAGGCTGG - Intergenic
1190214720 X:48472420-48472442 ATAGGAAAGGAGACAGAGGCTGG - Intergenic
1190950973 X:55142390-55142412 ATCGAGGAGGAGACAGAGTCTGG + Intronic
1191690714 X:63935185-63935207 AGAGAGCGGCAGACAGAGAAAGG + Intergenic
1192667382 X:73102034-73102056 ATAGGGCACCAGTCAGAGTCAGG - Intergenic
1192696137 X:73417892-73417914 ATGGGGTAGCAGGCAGAGGCTGG - Intergenic
1194119455 X:89942909-89942931 AGAGAGCAGTAGACAGCAGCAGG + Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1196111660 X:111953100-111953122 ATTGAGCAGCAGCAAGAAGCAGG - Intronic
1197127849 X:122968993-122969015 ATAGAGAAGTAGACAAAGACAGG + Intergenic
1198283504 X:135167259-135167281 ATGGAGCAGAATACAGAGCCCGG + Intronic
1198285810 X:135190502-135190524 ATGGAGCAGAATACAGAGCCCGG + Intergenic
1200227961 X:154429483-154429505 ATAGATGAGAAGACTGAGGCTGG + Intronic
1200472328 Y:3600466-3600488 AGAGAGCAGTAGACAGCAGCAGG + Intergenic
1201271134 Y:12255060-12255082 ATAGACAAGCAGACAGAGAGGGG + Intergenic
1201576992 Y:15471453-15471475 GTCTAGCAGCAGACAGAGGGAGG - Intergenic
1201755730 Y:17483809-17483831 ATAAAGCAGGAGGCAGAGTCAGG - Intergenic
1201845822 Y:18422176-18422198 ATAAAGCAGGAGGCAGAGTCAGG + Intergenic