ID: 1141992506

View in Genome Browser
Species Human (GRCh38)
Location 16:87618574-87618596
Sequence CAGTGTGGCCAGGTGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141992506_1141992516 12 Left 1141992506 16:87618574-87618596 CCTTTTTCCACCTGGCCACACTG 0: 1
1: 0
2: 3
3: 28
4: 344
Right 1141992516 16:87618609-87618631 CGCCAGCAGCATGGGGGCTCTGG No data
1141992506_1141992511 4 Left 1141992506 16:87618574-87618596 CCTTTTTCCACCTGGCCACACTG 0: 1
1: 0
2: 3
3: 28
4: 344
Right 1141992511 16:87618601-87618623 CTCGTTCCCGCCAGCAGCATGGG No data
1141992506_1141992512 5 Left 1141992506 16:87618574-87618596 CCTTTTTCCACCTGGCCACACTG 0: 1
1: 0
2: 3
3: 28
4: 344
Right 1141992512 16:87618602-87618624 TCGTTCCCGCCAGCAGCATGGGG 0: 1
1: 0
2: 0
3: 12
4: 63
1141992506_1141992510 3 Left 1141992506 16:87618574-87618596 CCTTTTTCCACCTGGCCACACTG 0: 1
1: 0
2: 3
3: 28
4: 344
Right 1141992510 16:87618600-87618622 ACTCGTTCCCGCCAGCAGCATGG No data
1141992506_1141992513 6 Left 1141992506 16:87618574-87618596 CCTTTTTCCACCTGGCCACACTG 0: 1
1: 0
2: 3
3: 28
4: 344
Right 1141992513 16:87618603-87618625 CGTTCCCGCCAGCAGCATGGGGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141992506 Original CRISPR CAGTGTGGCCAGGTGGAAAA AGG (reversed) Intronic
900878500 1:5363662-5363684 CAGGGTGGGCAGGTGGAAAGAGG - Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901238153 1:7678570-7678592 ACGTGTGCCCAGGTGGGAAATGG - Intronic
901269037 1:7936125-7936147 CACTGTGCCCAGCTGGAAAGTGG - Intronic
901427627 1:9192596-9192618 CGGTGTGGCAAGGTAGAGAAGGG - Intergenic
901665693 1:10824952-10824974 CAGTCTGGCCAGGTGGGCAGCGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902035064 1:13451945-13451967 CAGTGTGGCCATCTGAAAGATGG - Intergenic
902363959 1:15958804-15958826 CTGAGGGGCCAGGTGGAGAAGGG + Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902510697 1:16965538-16965560 CAGGGTGGCCAGTTTGTAAAGGG + Intronic
902679630 1:18033879-18033901 CAGTGTGTCCATCTGCAAAATGG + Intergenic
903741181 1:25559597-25559619 CAGGGAGGCCAGGTAGCAAAGGG - Intronic
904472837 1:30746480-30746502 CGCTGTGTCCAGGTGGAAACCGG - Intronic
904744752 1:32703580-32703602 CAGGGTAGCTAAGTGGAAAAAGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905213864 1:36393123-36393145 CAGTCTGGTCAGGTGGAAAATGG - Intronic
905265805 1:36753668-36753690 CGGTGTGGCCATGTGCAGAAGGG + Intergenic
905615180 1:39392089-39392111 CAAGGTGGACAGGTGGAACAGGG - Intronic
905676439 1:39828854-39828876 CAGTTTTGCCATATGGAAAATGG + Intergenic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
907162879 1:52384275-52384297 CAGTGTGGCAACATGGAAAAGGG - Intronic
907339560 1:53725358-53725380 CAGTGAGGTAGGGTGGAAAAGGG - Intronic
907377441 1:54055252-54055274 CACTGTGCCCAGCTGGAAAGAGG + Intronic
907998853 1:59660259-59660281 AACTGTGGCCAGGTAGAGAATGG - Exonic
908100678 1:60787927-60787949 TAGTGTGGCAAAGTGGATAAAGG - Intergenic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
909747577 1:79117079-79117101 ATGTGTGTCCAGGTGGAAATAGG + Intergenic
911042330 1:93600607-93600629 GCTTGTGGCCAGGTGGAAAAAGG - Intronic
911404810 1:97423336-97423358 TAGTCTGGCCAAGTGGAAAGAGG + Intronic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
913496534 1:119433050-119433072 CAGTGGGGTAAGGTGAAAAATGG + Intergenic
913501368 1:119475576-119475598 CAGTGGGGTAACGTGGAAAATGG + Intergenic
914942206 1:152033142-152033164 CAGCGGGTTCAGGTGGAAAAAGG + Intronic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915498090 1:156295185-156295207 CAGTGGGGACAGGATGAAAAGGG + Intronic
915720103 1:157978647-157978669 GAGTGTGGCCCTGGGGAAAATGG - Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916407843 1:164515090-164515112 CAGTGTGGGCAGTTTGAGAATGG + Intergenic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
919563320 1:199151997-199152019 GAATGTAGCCAAGTGGAAAAAGG - Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
924165570 1:241278643-241278665 GTGTGTGGGCTGGTGGAAAAGGG - Intronic
924481219 1:244436054-244436076 CAGTGTTTCCAGGGGAAAAAAGG - Intronic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
1064076875 10:12275902-12275924 CACTGTGCCCAGGTGATAAATGG + Intergenic
1064342222 10:14497729-14497751 CAGTGTGGCCGAGTGGGTAAAGG + Intergenic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066104906 10:32147820-32147842 AAGTGTGGGAAGGTGGGAAAGGG - Intergenic
1067684482 10:48458368-48458390 CAGGCAGGCCAGGTGGAGAAAGG + Intronic
1068627688 10:59267021-59267043 CAGTTTGGTCATGTGTAAAATGG - Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069583531 10:69581300-69581322 CAGTGTGCTCTGGTAGAAAATGG - Intergenic
1069586419 10:69606848-69606870 CAGTAAGGCAAGGGGGAAAAAGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1073632382 10:105161790-105161812 GACTGTGGGCAGGTGGAAACAGG + Intronic
1073958251 10:108896718-108896740 CAGTGTGGCCACATGAAAAAAGG - Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074234513 10:111571908-111571930 GAATGTGGGCAGGTGTAAAAGGG + Intergenic
1074987261 10:118669338-118669360 CAGCGTGGCCTGGGAGAAAAAGG + Intergenic
1075062172 10:119264808-119264830 CACCCTGGCCAGGAGGAAAAGGG - Intronic
1075210457 10:120486465-120486487 CAGTTTGACCAGCTGTAAAATGG + Intronic
1075943342 10:126410023-126410045 CAGAGTGCCCAGGTGGAATTAGG - Intergenic
1076072471 10:127501724-127501746 CAGTGTGGTCACATGGAAACAGG + Intergenic
1076252536 10:128995679-128995701 CAGTGTTCCCATCTGGAAAATGG + Intergenic
1076386418 10:130060043-130060065 CAGTGGGACCAGGTGGGAACAGG + Intergenic
1077015950 11:399305-399327 CAGAGGGGGCAGGTGGAGAAGGG - Intronic
1078444095 11:11391172-11391194 CAGAGTGGCTAGGTGGTAAGTGG - Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1079105025 11:17565490-17565512 CAGTATGGAAAGGGGGAAAAAGG - Intronic
1079158058 11:17967302-17967324 CAGTGTGACCACGTGAAAAGTGG - Intronic
1080100390 11:28453008-28453030 TAGGTTGGCCAGATGGAAAATGG - Intergenic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1080925904 11:36755591-36755613 AAGTGGAGGCAGGTGGAAAAGGG - Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1084411059 11:69006122-69006144 CTGTGTGGCCTGGTGGGCAACGG - Exonic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084691892 11:70732420-70732442 CTTTGGGGCCAGGTGGAGAAAGG - Intronic
1085023371 11:73222615-73222637 AAGTGTGACCTGCTGGAAAAAGG - Intronic
1085304780 11:75479129-75479151 AAGTGTGACCAGGTGGCAATGGG + Intronic
1087290019 11:96310745-96310767 CAGTCTCCCCAGGTGTAAAAAGG + Intronic
1088687597 11:112298107-112298129 CAGGGGGGCCATGTGGAAAGGGG - Intergenic
1089453998 11:118615284-118615306 CAATGTGGCCAAGAAGAAAAAGG + Intronic
1089792419 11:120954429-120954451 CAGTGTGGCAAAGTGGAGAGGGG - Intronic
1090459601 11:126878858-126878880 AAGTGTGGCCAGGTCCACAAGGG - Intronic
1091256068 11:134187120-134187142 CAGTCTGCCCAGGTGGGGAATGG - Intronic
1092963450 12:13618222-13618244 CAGTTTGGCCAGGTAGGAATTGG + Intronic
1092981612 12:13800089-13800111 CAGTGATTCCAGGAGGAAAATGG - Intronic
1095362064 12:41354331-41354353 AAGTGAGGCAAGGTTGAAAACGG - Intronic
1095427264 12:42089828-42089850 AAGTGTAGCCAGGTTGAAGAAGG + Intronic
1097038652 12:56140904-56140926 CAGGGTGGCTAGATGGATAAGGG + Intronic
1098791644 12:74831618-74831640 CAGAGTAGCAAGGTGGATAATGG - Intergenic
1099585896 12:84513316-84513338 CAGTATGGAAAGGGGGAAAAGGG - Intergenic
1100438112 12:94590551-94590573 AAGTGAGGCCATGTGGGAAAAGG + Intronic
1100818472 12:98408468-98408490 CGGTGTGGCATGGTGGAAAGAGG - Intergenic
1101586050 12:106087050-106087072 CTGTCCCGCCAGGTGGAAAATGG + Intronic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1103696223 12:122817917-122817939 CAGGGTGCCAAGGTGGAGAAGGG - Intronic
1103949909 12:124545003-124545025 CAGTGTGCCCATCTGTAAAACGG + Intronic
1106300445 13:28459520-28459542 GAATGAGGCCATGTGGAAAATGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1108882817 13:55142092-55142114 CAGTGTGGCTAGGTCAAAACAGG + Intergenic
1111665102 13:91257245-91257267 CAGTCTGGCCAGATGAAATATGG - Intergenic
1111908685 13:94285611-94285633 TACTGTGGCCTGGGGGAAAAAGG - Intronic
1114756884 14:25269609-25269631 CAGAGTGGGCAGGTGGGGAAGGG - Intergenic
1115021658 14:28688243-28688265 CAGAGTGGGCAGTTGGATAAAGG - Intergenic
1116712852 14:48391276-48391298 CAGTGTGGTCCAGTGGGAAAAGG - Intergenic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1119609709 14:76051445-76051467 CAGTGTGGCCAAGATGACAATGG + Intronic
1121552782 14:94814875-94814897 CAGTTTGGGCAGCTGTAAAATGG + Intergenic
1122036274 14:98951330-98951352 CAGAGAGGCCAGGAGGGAAATGG + Intergenic
1122848654 14:104514636-104514658 GAGTGTGGTGAGGTGGAAGATGG + Intronic
1126373296 15:47969543-47969565 AAGTGTGGGCAGGAGAAAAAGGG - Intergenic
1127940108 15:63686441-63686463 CAGTGTTGCCTAGTGGAGAATGG - Exonic
1128090348 15:64914971-64914993 CAGCGTGGGCAGGTGGAAGCTGG + Intronic
1128806644 15:70536089-70536111 CAGTGTTCCCATCTGGAAAAGGG - Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1130566910 15:85004040-85004062 AAGTGTGGCCATGTGGCCAATGG - Intronic
1130885436 15:88088894-88088916 CAGTGTCCCCAGGTATAAAATGG + Intronic
1132864499 16:2086732-2086754 CAGGGTGGCGATGTGGAAGACGG - Exonic
1133315937 16:4884126-4884148 GAGAGTGTCCAGGTGGAGAAGGG - Exonic
1134446593 16:14335948-14335970 CAGTTTCCCCAGGTGCAAAATGG - Intergenic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1134827909 16:17299257-17299279 CATGGTGGCCAGGTTGATAAAGG - Intronic
1135069296 16:19338248-19338270 CAGTTTGCCCATGTGCAAAATGG + Intergenic
1135932682 16:26751894-26751916 CACTGTGTCCGTGTGGAAAATGG + Intergenic
1136349870 16:29699773-29699795 AAGTGTAGCCAGATGGACAAGGG - Intergenic
1137071202 16:35906357-35906379 GAGTGTGGCCAGGTTTAAATGGG + Intergenic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137815170 16:51391947-51391969 CAGAGTGGCAACGTGGAACACGG - Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1141080585 16:81048184-81048206 CAGTGGGTCCAGGTTGAAAATGG - Intergenic
1141224502 16:82102169-82102191 CAGTGCTGCCAGCAGGAAAATGG + Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142127075 16:88415478-88415500 CAGTGTGTTCAGCTGTAAAATGG - Intergenic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1142741851 17:1936222-1936244 CACTCTGGCAAGGTGGGAAAAGG - Exonic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146682213 17:34816357-34816379 GAGTGGGTCCAGGTGGGAAATGG + Intergenic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1147439228 17:40437359-40437381 CAGTTTGGCCATCTGTAAAATGG - Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147965720 17:44193343-44193365 CAGGGTGGGCAGGAGGAACACGG + Exonic
1148131148 17:45263255-45263277 CAATGTGGACAGCTGGACAAAGG + Exonic
1150470432 17:65432677-65432699 CTATGTGTCCAGGAGGAAAATGG - Intergenic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152923051 17:83075285-83075307 CAGGTTGGCCAGGTGGAGAGAGG - Intergenic
1153303945 18:3615568-3615590 AAGTCTGGCCAGTAGGAAAATGG + Intronic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155886676 18:31217098-31217120 TAGTGTGGGCAGGTGGGAAGGGG + Intergenic
1155988458 18:32255030-32255052 CAGTGTGGCCGGGTGGAGAGAGG + Intronic
1157324235 18:46657451-46657473 CTGTGAGGCCAGGTGGGAAATGG - Intergenic
1157439817 18:47702152-47702174 CAGTGTGATCATCTGGAAAATGG + Intergenic
1158376963 18:56882035-56882057 TAATGTGCCCAGGTGGAGAAGGG - Intronic
1160078135 18:75697436-75697458 CAATGTGGCCAGGTAGAAGGAGG + Intergenic
1160362732 18:78297439-78297461 CTGTGTGGCCAGGTGGGAATTGG - Intergenic
1160422738 18:78758725-78758747 CACCGTGACCAGGAGGAAAAGGG + Intergenic
1160444163 18:78914279-78914301 CAGGGAAGCCAGGTGGAAAATGG - Intergenic
1160618176 18:80149775-80149797 CAGTGCTACCAGTTGGAAAAAGG + Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161227916 19:3155891-3155913 CAGTGAGGCCAGGTAGATGAGGG - Exonic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1162495194 19:11019530-11019552 CCGGGTGGCCAGGTGGCAAGAGG - Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163042807 19:14615059-14615081 CAGTTTGCCCAGGTATAAAATGG - Intergenic
1163431191 19:17268779-17268801 CTGTGTGGCTAGATGGAACACGG - Exonic
1163643252 19:18473807-18473829 CAGTGGGGCCAGGTGGTGCAGGG - Intronic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164767853 19:30785268-30785290 CAGTGTGGCGAGATGCAAACTGG - Intergenic
1165256572 19:34580072-34580094 CAGTGTGGCGAGGTGGGCAGGGG - Intergenic
1165273639 19:34731334-34731356 CAGTGTGGCCAGGTGGGCAGGGG + Intergenic
1165954004 19:39490300-39490322 CAGTGTGGCCCTGGGGTAAAGGG + Exonic
1166777247 19:45320596-45320618 CAATTTCCCCAGGTGGAAAACGG + Intronic
1167672155 19:50859509-50859531 CACTGTGGGTAGGTGGAGAATGG - Intronic
1168089253 19:54071359-54071381 CAATGTGGGAAGGTGGAAATGGG - Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
926805107 2:16701190-16701212 CAATGTGGGCTGGTGTAAAACGG + Intergenic
927672770 2:25082727-25082749 CAGTGGGGACAAGTGGACAAAGG + Intronic
928340568 2:30439792-30439814 CAGGGTGGGGAGGAGGAAAACGG - Intergenic
928483434 2:31706621-31706643 GAGTGAGGTCAGGTGGAAAGGGG - Intergenic
930048559 2:47195023-47195045 CGGGGAGGCCAGGTGGGAAAGGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
933248489 2:80002408-80002430 GAGTTTGACCAAGTGGAAAATGG + Intronic
933571859 2:84023278-84023300 CAGTGAGGCCAGGTGCAAGAAGG + Intergenic
936029521 2:109059859-109059881 CACTGTGCCCAGGAGGATAATGG + Intergenic
937249402 2:120514065-120514087 CAGGGTGGCCAGGCAGGAAAAGG - Intergenic
938015483 2:127863695-127863717 GAGAGTGGCCAGTTGGAAGAAGG - Exonic
938323142 2:130378854-130378876 CAGTGTTGACATTTGGAAAATGG + Intergenic
938900106 2:135792447-135792469 CAGTGTGGGCAGGTGGGGAGGGG + Intronic
940065553 2:149623556-149623578 CAGTGAAACCAGGTAGAAAAGGG + Intergenic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
942462160 2:176175781-176175803 CAGAATGGCCAGCTGCAAAACGG + Intergenic
942825885 2:180175798-180175820 CACAATGGCCAGGTGGAATAAGG - Intergenic
942928568 2:181461486-181461508 CAGAGTGCCCGGGTGGAAAGTGG - Intronic
945327265 2:208496769-208496791 CACTGTGGCCAGGTGGGCACTGG + Intronic
945798167 2:214390632-214390654 GAGTGTGGGGAGGTGGAAAGGGG - Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947052300 2:226059146-226059168 CAGAGTCCCCAGGTGGTAAAAGG + Intergenic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1172599608 20:36174775-36174797 CAGTTTCCCCAGGTGTAAAATGG - Intronic
1172925744 20:38533218-38533240 CAGTGTGGCAAGGAGGGTAATGG + Intronic
1173076483 20:39824277-39824299 CAGTTTGCCCATGTGCAAAATGG + Intergenic
1174182045 20:48681089-48681111 CAGTGTGGCCCGCAGGAACATGG - Intronic
1174375868 20:50126279-50126301 CAGTGTGCTCATGTGGAAAATGG - Intronic
1174429437 20:50456948-50456970 CAGTTTTGCCATCTGGAAAAAGG + Intergenic
1175788462 20:61726434-61726456 CAGTGTGTCCATATGTAAAATGG + Intronic
1177073720 21:16545277-16545299 CAGTTTGGTCATCTGGAAAATGG - Intergenic
1177727038 21:24983278-24983300 GACTGTGGCAAGGTGTAAAAAGG + Intergenic
1177960467 21:27660377-27660399 CAGTATGGCCACATGGAGAATGG + Intergenic
1179565630 21:42246101-42246123 CAGTGTGGATGGGTGGAGAAGGG - Intronic
1179894227 21:44352306-44352328 GAGTGTGGCCAAGGGGCAAAGGG + Intronic
1180060506 21:45382639-45382661 CAGCATGGTCAGCTGGAAAATGG + Intergenic
1181133475 22:20748448-20748470 CTGGGTGGCCAGGTGGACACAGG - Intronic
1182115662 22:27754925-27754947 GACTGTGGCCATGTGGAGAAGGG + Intronic
1182276838 22:29195271-29195293 CAGTGTGTTCACCTGGAAAATGG - Intergenic
1182366600 22:29783316-29783338 CAGAAGAGCCAGGTGGAAAAGGG - Intergenic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1182649134 22:31836570-31836592 CAGAGTGGCTAGGTGGGGAAAGG - Intronic
1182979045 22:34650867-34650889 TAGTGAGGCCTGGTGAAAAACGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184294100 22:43512941-43512963 CAGGGGGGCCAGGTGGACAGAGG - Intergenic
1184297555 22:43534643-43534665 ATGTGGGGCCAGGTGGAAAGGGG - Intronic
1184305694 22:43600007-43600029 CTGTGAGGCCAGATGTAAAAGGG + Intronic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1185025453 22:48407479-48407501 CGGTGTGGGCAGGAGGGAAAAGG - Intergenic
1185101760 22:48844421-48844443 CAGTGAGGCCAGGTGTCCAAGGG - Intronic
949538232 3:5012124-5012146 CAGTGTTGGGAGGTGGAAATTGG + Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
955179952 3:56658147-56658169 CAGTGAGGCCTGCTGGAAAACGG + Intronic
955321000 3:57974247-57974269 CAGTTTGCCCAGCTGTAAAATGG - Intergenic
955703373 3:61704232-61704254 CAGTTTGTCCAGCTGTAAAAAGG + Intronic
956176331 3:66476558-66476580 CAGTGTGGCATCTTGGAAAAAGG - Intronic
956835093 3:73090044-73090066 CAGCGTGGCCAGGTAGGACAAGG - Intergenic
958813320 3:98888483-98888505 CAGTTTTGCCAGGGGTAAAATGG + Intronic
959552671 3:107680527-107680549 CAGTATGGCTTGTTGGAAAAAGG + Intronic
959852253 3:111102300-111102322 AAGTGGGGTGAGGTGGAAAATGG - Intronic
960143187 3:114171303-114171325 ATGTGAGGCCAGGAGGAAAAAGG - Intronic
962308857 3:134312069-134312091 CAGAGTGCCCAGGTGGCAAGTGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
963005503 3:140723200-140723222 CAGTGTGGAGGGGTGGAACATGG - Intergenic
964392169 3:156209180-156209202 CAGTTTGGCTTGGTGGAAAGAGG + Intronic
965614000 3:170574520-170574542 CAGTGTGCTCAGGAAGAAAAAGG - Intronic
966888536 3:184389867-184389889 GAGTGGGGCCTGGTGGAGAAGGG + Intronic
968206561 3:196807505-196807527 AAGTGTGACCAGGTCTAAAATGG - Intronic
969481110 4:7447425-7447447 CAGTGTTCCCATCTGGAAAATGG - Intronic
970489067 4:16553825-16553847 CAGTGTGCTCAGGTATAAAATGG - Intronic
970856100 4:20651007-20651029 CAGTGTGGACTGATGGAAAGGGG + Intergenic
971970180 4:33609272-33609294 TAGAGTGGCAAGCTGGAAAAGGG + Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
974316138 4:60282924-60282946 CAGTATGGCCACATGGAGAATGG - Intergenic
975590817 4:75998077-75998099 CAGTGTGGCCAGGAGGATTCTGG + Intergenic
976137427 4:81953894-81953916 CAGTGTTCTCAGGTGAAAAAGGG - Intronic
976900043 4:90162068-90162090 GAGTGTGGTAAGGTGGCAAAGGG + Intronic
977137783 4:93327704-93327726 TAGTGTGGAAAGGTAGAAAATGG + Intronic
977350902 4:95885853-95885875 CAGTGTTGCTGGGTAGAAAATGG + Intergenic
979727603 4:123982838-123982860 CAGGGTGGGGAGCTGGAAAAGGG + Intergenic
981161427 4:141503780-141503802 CAGTGAGTGCAGGTGGAAAGAGG - Intergenic
981835605 4:149049962-149049984 CAGTGTGGGAAGGTTGAGAAGGG + Intergenic
982101820 4:151975683-151975705 CACTGTGGGCAGGTAGAAAGGGG - Intergenic
984779910 4:183515697-183515719 CAGTTTGTTCAGCTGGAAAATGG + Intergenic
985218570 4:187678426-187678448 CAATGTGTCTAGGTGGAATATGG - Intergenic
985661189 5:1157449-1157471 CAGTGTGGGCAGGTGGGAACAGG - Intergenic
985661203 5:1157528-1157550 CAGCGTGGGCAGGTGGCACAGGG - Intergenic
987269971 5:16297150-16297172 CAGAGTGACAAGGTGGATAAAGG - Intergenic
987322486 5:16783636-16783658 CAATGTGGCCAGCAGGAGAAAGG - Intronic
989152920 5:38317927-38317949 CAGTGTTGGCAGGAGGAAACCGG + Intronic
989239461 5:39187618-39187640 CAGTTTGGGCAGGTGGGAAGGGG + Intronic
989952564 5:50316945-50316967 CAGTTTGGCCAGATGGAATCAGG - Intergenic
990368786 5:55095888-55095910 CAGTGGGGCAGGGTGGGAAAGGG - Intergenic
990746899 5:58967829-58967851 CATGGTGGCCAGGTTGAACAAGG + Intergenic
992950649 5:81853892-81853914 CAGTGTGGACAGGTGAATGAAGG + Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996069360 5:119117365-119117387 TGGTGTGGCCAAGTTGAAAATGG - Intronic
996162920 5:120188651-120188673 CAATGTGTGGAGGTGGAAAATGG + Intergenic
997658928 5:135575470-135575492 CAGTTTGGCCATCTGTAAAATGG + Intronic
997719777 5:136068734-136068756 CTGGGTAGCCACGTGGAAAATGG - Intergenic
997794376 5:136794002-136794024 AAGTGTGGCCTGGTGTAGAAGGG - Intergenic
997892966 5:137691554-137691576 CAGTGTGGAAAGGTGGAGCAGGG + Intronic
999028456 5:148262415-148262437 CAGTGTGTCCATCTGTAAAATGG - Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003019289 6:2496129-2496151 GGGTGGGGCCAGGTGGAGAAGGG + Intergenic
1003556817 6:7147213-7147235 CAGCTCGGCCAAGTGGAAAACGG - Intronic
1004701962 6:18087723-18087745 CAGTGTGGCCAGGTCCAAAGTGG + Intergenic
1005405755 6:25486087-25486109 CAGTGTTTACAGCTGGAAAAAGG - Intronic
1006192742 6:32219697-32219719 CTGTGTAGCCAGGTGGACAGAGG + Exonic
1006358082 6:33572498-33572520 CAGTCTGGCCTGATGGAAAGAGG + Intergenic
1007390924 6:41549015-41549037 CAGTGGGGCAAGGTGGCAAGGGG + Intronic
1007924762 6:45642171-45642193 CAGTGAGGCCTGGTGAAAATAGG + Intronic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1012849960 6:104434767-104434789 CAGAGTGGGCAGGTAGAAAGTGG + Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014516168 6:122381167-122381189 CAGACTGGCAAGTTGGAAAAAGG - Intergenic
1014554715 6:122831635-122831657 CAGGGTAGAAAGGTGGAAAAAGG - Intergenic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1019472270 7:1227363-1227385 GAATGTGGCCAGGAGGAGAAGGG - Intergenic
1021956358 7:25828828-25828850 TAGTGTGGGGAGATGGAAAATGG + Intergenic
1022209326 7:28193542-28193564 GTCTGAGGCCAGGTGGAAAAAGG - Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1024107278 7:46105466-46105488 CCTTGTGGCCTGTTGGAAAAAGG + Intergenic
1024198410 7:47082467-47082489 CAGTGGGGCCGGGTGGCAAAGGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026387523 7:69865214-69865236 GAGTTTGGGGAGGTGGAAAAGGG + Intronic
1026970566 7:74465122-74465144 CAGTGAGGCCAGGTGGGGAGAGG + Intronic
1027252571 7:76408451-76408473 CACTGAGGCCAGGAGGCAAAAGG - Intronic
1029255769 7:99268495-99268517 CTGTTTGGCCAGGTGGTAAACGG - Intergenic
1029626050 7:101720811-101720833 CATTGTGGCGTGGTGGAGAAAGG + Intergenic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030970899 7:116053517-116053539 CAGTATTGAGAGGTGGAAAACGG + Intronic
1034014669 7:147569279-147569301 CAGTGTGGGCAGGAGGAAATGGG + Intronic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035201529 7:157270395-157270417 CAGCATGTCCAGGTGGGAAAAGG + Intergenic
1036545899 8:9769574-9769596 AAGTTTTGCCTGGTGGAAAAAGG - Intronic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1037072681 8:14671571-14671593 CAGGGTGCCCAGGTGAGAAAAGG + Intronic
1037822643 8:22142327-22142349 CAGTGGGTCCAGGAGGGAAAGGG + Intergenic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1039521060 8:38172228-38172250 CAGTGTGGCAGAGTGGGAAAAGG + Intronic
1039711518 8:40060746-40060768 CAGTGTGCCCAGCTGGGAATTGG + Intergenic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1042701711 8:71622517-71622539 CAGTGTGGCCTTGTTGAAATTGG - Intergenic
1044936943 8:97302528-97302550 CAGTTTGGCCATGGGGCAAATGG + Intergenic
1048047406 8:130785880-130785902 CAGTGTGGCAAGGGGCAAAGGGG - Intronic
1048302636 8:133262691-133262713 CTGAGTGCCCAGGAGGAAAAGGG - Intronic
1048586476 8:135778627-135778649 CAGTGAGGCCAGTATGAAAAGGG - Intergenic
1048721440 8:137330280-137330302 CAGTTTGGCCATCTGTAAAATGG + Intergenic
1048996754 8:139799396-139799418 CAGTGTGGTCAGTGGAAAAATGG - Intronic
1049316622 8:141972585-141972607 GAGTGTGGCCATTTGGAAGATGG + Intergenic
1049923929 9:390784-390806 GTGTGTGGCCAGGTGGAGAGTGG - Intronic
1049976232 9:862837-862859 CAGCGTGGTCAGGTGAATAACGG + Intronic
1050396238 9:5199993-5200015 TAGTGTGGGAGGGTGGAAAATGG - Intergenic
1050625720 9:7501912-7501934 CAGTGGGGTGAGGTGAAAAAGGG + Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1052883687 9:33623075-33623097 CATTGTGGAAAGGTGAAAAAGGG + Intergenic
1054962053 9:70979970-70979992 TAATGTGGCCAGCTGGAAATAGG - Intronic
1055453761 9:76454479-76454501 CTTTGTGGTCAGCTGGAAAAGGG + Intronic
1057481649 9:95449360-95449382 GAGTGTGGCCAGCAGGTAAATGG - Intronic
1057979054 9:99639777-99639799 CAGTGTGGCATGGTAAAAAAGGG + Intergenic
1058195572 9:101970891-101970913 GTGTGTGTCCAGGAGGAAAAGGG + Intergenic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1059476278 9:114550525-114550547 CACTGTGGCCAGGGGGCAACTGG + Intergenic
1059684203 9:116619130-116619152 CAGTGTGGTATCGTGGAAAAAGG - Intronic
1059705665 9:116820962-116820984 CAGTGTGCCCACCTGTAAAATGG + Intronic
1060427084 9:123514958-123514980 CAGTTTGGCAGGGTGGAATACGG + Intronic
1060598853 9:124864560-124864582 CATGGTGGCCAGGTGAAATATGG - Intronic
1061056157 9:128224099-128224121 CAGTGTCCCCAGTTGTAAAATGG - Intronic
1061057388 9:128231792-128231814 CAGTTTCTCCATGTGGAAAATGG - Intronic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1061258423 9:129466134-129466156 CAGTGTGGTCAGGGGTATAATGG + Intergenic
1061609379 9:131736341-131736363 AAGTGAGGCCTGGTGGAGAAAGG - Intronic
1061908350 9:133710236-133710258 CAGTTTCGCCACCTGGAAAATGG - Intronic
1061912806 9:133733910-133733932 CAGCTTGGCCAGGTGGTACAGGG + Exonic
1185953099 X:4458174-4458196 GAGGGTGGCAAGGAGGAAAATGG - Intergenic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1189092806 X:38105149-38105171 CAGTGTGTCCAACTGGACAAAGG + Intronic
1189288873 X:39871222-39871244 CTGTGAGGCCAGGTTGGAAAAGG - Intergenic
1189495854 X:41508268-41508290 CAGAGTGGCAAAGAGGAAAAGGG - Intergenic
1190064897 X:47233155-47233177 CAGTGGCGCCAGATAGAAAACGG + Exonic
1190221912 X:48517226-48517248 CAGGTAGGCCAGGTGGAAGATGG - Exonic
1192008925 X:67247411-67247433 TGGTGTGGGCAGATGGAAAAGGG + Intergenic
1192340345 X:70258806-70258828 CAGCCTGGCCAGGTAGTAAATGG + Exonic
1193448983 X:81643514-81643536 CACTGTGGCAAGGTGGATAAAGG - Intergenic
1199400367 X:147391643-147391665 CAGAGTGGCAAGTTGGATAAAGG + Intergenic
1201536525 Y:15054506-15054528 CAATGTGGCAATGAGGAAAATGG + Intergenic