ID: 1141994959

View in Genome Browser
Species Human (GRCh38)
Location 16:87630435-87630457
Sequence TCCCCAGCCAGTCCTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 411}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141994954_1141994959 -10 Left 1141994954 16:87630422-87630444 CCCTTCCTGGCATTCCCCAGCCA 0: 1
1: 0
2: 4
3: 34
4: 451
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994943_1141994959 29 Left 1141994943 16:87630383-87630405 CCCTCTCCCCTTGTCCTTCTGGG 0: 1
1: 0
2: 2
3: 61
4: 527
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994941_1141994959 30 Left 1141994941 16:87630382-87630404 CCCCTCTCCCCTTGTCCTTCTGG No data
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994949_1141994959 21 Left 1141994949 16:87630391-87630413 CCTTGTCCTTCTGGGGAGATCAC 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994953_1141994959 -9 Left 1141994953 16:87630421-87630443 CCCCTTCCTGGCATTCCCCAGCC 0: 1
1: 0
2: 4
3: 55
4: 656
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994945_1141994959 28 Left 1141994945 16:87630384-87630406 CCTCTCCCCTTGTCCTTCTGGGG 0: 1
1: 0
2: 4
3: 44
4: 461
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994952_1141994959 -5 Left 1141994952 16:87630417-87630439 CCTGCCCCTTCCTGGCATTCCCC 0: 1
1: 0
2: 8
3: 82
4: 655
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994947_1141994959 23 Left 1141994947 16:87630389-87630411 CCCCTTGTCCTTCTGGGGAGATC No data
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994948_1141994959 22 Left 1141994948 16:87630390-87630412 CCCTTGTCCTTCTGGGGAGATCA 0: 1
1: 0
2: 0
3: 19
4: 154
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411
1141994950_1141994959 15 Left 1141994950 16:87630397-87630419 CCTTCTGGGGAGATCACGAACCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG 0: 1
1: 0
2: 7
3: 39
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141994959 Original CRISPR TCCCCAGCCAGTCCTCCCTG GGG Intronic
900365290 1:2309707-2309729 CCCCCACCCCCTCCTCCCTGTGG + Exonic
900365310 1:2309745-2309767 CCCCCACCCCCTCCTCCCTGTGG + Exonic
900365331 1:2309784-2309806 CCCCCACCCCCTCCTCCCTGTGG + Exonic
900365354 1:2309825-2309847 CCCCCACCCCCTCCTCCCTGTGG + Exonic
900369829 1:2326732-2326754 TCTCCTGCCAGTTCTGCCTGAGG + Intronic
900665713 1:3814230-3814252 GCCCCAGCCTGTGCTCCCAGGGG - Exonic
900674034 1:3872829-3872851 GTCCCCTCCAGTCCTCCCTGTGG + Intronic
900721202 1:4176948-4176970 TCCCCACCCTGTCCTCACAGAGG - Intergenic
900976540 1:6020305-6020327 TCCCGAGCCAGCCCTGTCTGGGG - Intronic
901094293 1:6665891-6665913 TTCCAAGCCAGACCTCCCTCCGG + Intronic
902290055 1:15429515-15429537 CCCCCAGCCAGAACACCCTGAGG + Exonic
902368502 1:15991882-15991904 TACCCAGCCAGACCTCCCTCTGG - Intergenic
902631205 1:17705694-17705716 ACCCCAGCCATCACTCCCTGGGG + Intergenic
902675576 1:18006358-18006380 TCCCCACACACTCCTGCCTGAGG - Intergenic
902925709 1:19694535-19694557 TCAGCAGCCAGTCTCCCCTGTGG + Exonic
903213306 1:21830268-21830290 TTCCCCTGCAGTCCTCCCTGTGG - Intronic
903859144 1:26354618-26354640 TGGCCAGCCATGCCTCCCTGGGG - Intergenic
904288452 1:29468792-29468814 CCCCCTGCCAGTCCTGCTTGTGG + Intergenic
904424086 1:30412461-30412483 TCTCCAGCCACGCCTCCCTAAGG - Intergenic
904906711 1:33902726-33902748 TCCAGAGCCAGTCCTGCATGTGG - Intronic
905022637 1:34828310-34828332 TCACCTTCCAGTGCTCCCTGTGG - Intronic
906651710 1:47517385-47517407 TACCCAGCCAGTCAGCACTGAGG - Intergenic
906658786 1:47567887-47567909 CCTCCTCCCAGTCCTCCCTGGGG - Intergenic
907193168 1:52665521-52665543 CCTCCAACCAGCCCTCCCTGGGG + Intronic
907556439 1:55348534-55348556 TCCCCAGCCATGCCTCCCTCAGG - Intergenic
907571293 1:55486475-55486497 CCACCAGCCTGTCCTCCCTAGGG - Intergenic
909374529 1:74924396-74924418 TCCCCAGGCACTCCTCCCCAGGG - Intergenic
909883580 1:80911734-80911756 GGCCCAGCCAGTTCTACCTGAGG + Intergenic
910192348 1:84606913-84606935 TCTTCAGCCATTCTTCCCTGGGG - Intergenic
911474817 1:98361820-98361842 TCCCCACACAGTCTTCACTGGGG - Intergenic
912086594 1:106013930-106013952 ACCCCACACAGTCTTCCCTGAGG - Intergenic
913117863 1:115713364-115713386 TTCCCAGCCAGGCCTGCCTAAGG + Intronic
913352343 1:117875498-117875520 CCTCCAGGCAGTCCTCACTGGGG + Intronic
914908180 1:151763536-151763558 GCCCCCGCCAGTGCTGCCTGCGG + Exonic
915214288 1:154329484-154329506 TCCCCAGCCCGTCTCCCCGGGGG - Intronic
915260411 1:154672981-154673003 TTCTCAGTCGGTCCTCCCTGTGG + Intergenic
915648626 1:157291690-157291712 TACCCAGCATGTCATCCCTGAGG - Intergenic
915705994 1:157844326-157844348 TCCCCAGCACTTCCTCACTGAGG - Intronic
916360561 1:163962764-163962786 TACCCAGTCAGTACTCACTGTGG + Intergenic
916817394 1:168367215-168367237 TCCTCAGCCAGCCCACCCAGGGG - Intergenic
917352221 1:174090090-174090112 TTCTCAGCCAGTCCAGCCTGTGG - Intergenic
918238441 1:182601604-182601626 TCCCCAGGCTGACCTGCCTGAGG - Intronic
919911012 1:202110761-202110783 TCCCTGGCCACACCTCCCTGTGG - Intergenic
919917558 1:202148158-202148180 ACTCCAGCCACTCCTTCCTGGGG - Exonic
920854003 1:209648938-209648960 GCCCTAGCCAGGACTCCCTGTGG - Intronic
921236400 1:213136271-213136293 TGCCAGGCCAATCCTCCCTGAGG - Intronic
924382069 1:243474486-243474508 TGCCCACCCAGACCTCCCGGCGG - Intronic
924561170 1:245156862-245156884 TCCTCAGCCAGGCCGCCCGGGGG + Intronic
924578677 1:245303796-245303818 TCTTCAGCAAGTCCTGCCTGAGG + Intronic
1063025829 10:2178231-2178253 TCCCCAGTCAGTTCTCTCTAGGG + Intergenic
1063181596 10:3606166-3606188 ACCCCAGAAACTCCTCCCTGGGG - Intergenic
1063321871 10:5058825-5058847 TTCTCAGTCAGTCCTCCTTGTGG - Intronic
1065044958 10:21738912-21738934 TCTCCAGCCAGACCTCTCTCTGG + Intronic
1065797173 10:29318542-29318564 TCCCCAAACAGTCCTTCCTCTGG - Intergenic
1066745912 10:38604202-38604224 TCACCCTCCAGCCCTCCCTGTGG + Intergenic
1068947642 10:62745390-62745412 TCAACAGCCAGACCTCCCTGGGG + Intergenic
1069825876 10:71254672-71254694 TCCCCAGAGAGGCCTTCCTGTGG + Intronic
1070447556 10:76522726-76522748 TCCCCCGCCACCTCTCCCTGAGG + Intronic
1072553386 10:96495808-96495830 TCCCCAGCTGCTCCTGCCTGGGG + Intronic
1073493915 10:103874014-103874036 CCCCAAGCCAAACCTCCCTGAGG + Intergenic
1074808066 10:117073890-117073912 TCCCCCTCCAGAGCTCCCTGAGG + Intronic
1074853072 10:117454291-117454313 TCCCCAGCCAGTGCAGCCTCTGG - Intergenic
1075250252 10:120862773-120862795 TCCCCATCCAAGCCTCCCTCAGG + Exonic
1075654103 10:124149945-124149967 TCCCCACCCCCTACTCCCTGAGG - Intergenic
1076239421 10:128892694-128892716 TCCCCAGGCGGTCCTCACAGGGG - Intergenic
1076840722 10:133043913-133043935 TCCCCTGCCTCCCCTCCCTGGGG + Intergenic
1077340744 11:2025292-2025314 TCACCAGGCAGGGCTCCCTGGGG + Intergenic
1081993751 11:47350969-47350991 TCCCCCTGCAGACCTCCCTGGGG - Intronic
1083478860 11:62930660-62930682 TCCCCAGCTAGGACACCCTGTGG - Intergenic
1083638508 11:64133057-64133079 GCCCCAGCCAGAGCGCCCTGTGG + Intronic
1083912786 11:65719996-65720018 TCCCCAGCCCATCCACCCGGGGG + Intronic
1084273821 11:68042037-68042059 TCCCCAGCCAGCCCTGCCCTAGG - Intronic
1084320936 11:68373039-68373061 GCCCCACACAGTCCTCCCTTGGG - Intronic
1084473379 11:69375808-69375830 ACCACACCCACTCCTCCCTGGGG - Intergenic
1084883646 11:72189553-72189575 GCACCAGCCAGGCCTCCATGGGG - Intronic
1084998561 11:73007866-73007888 TCCCCACCCAGTTCTCCCAGTGG - Intronic
1086821896 11:91445665-91445687 ACTCCAGCCATCCCTCCCTGGGG + Intergenic
1086821905 11:91445687-91445709 GCTCCAGCCATCCCTCCCTGGGG + Intergenic
1087195335 11:95299298-95299320 GCCCCAGACAGTTCTACCTGTGG - Intergenic
1089729243 11:120510558-120510580 TAGCCAGCCAGCCCTCCCCGGGG + Intergenic
1090334017 11:125950899-125950921 TCCCCATCCAGATCCCCCTGAGG + Intergenic
1091221133 11:133930757-133930779 TCCCCAGAAAGACCTCCCTGAGG + Intronic
1202823729 11_KI270721v1_random:80481-80503 TCACCAGGCAGGGCTCCCTGGGG + Intergenic
1091460354 12:639724-639746 TCCCCAGCAAGTGCCTCCTGAGG + Intronic
1091666667 12:2423831-2423853 TCCCCAGCCAATACTCTCTCAGG - Intronic
1091964961 12:4732337-4732359 TCTCTAGCCACTCCTCCCGGTGG - Intronic
1092878045 12:12865591-12865613 TTCCCAGCCAGTCCTTGGTGAGG + Intergenic
1093580705 12:20781888-20781910 TCCTCAGTCAGTCCTCCTTGTGG - Intergenic
1095194458 12:39296694-39296716 TCCAAAGCCACTCCTGCCTGAGG - Intronic
1095463947 12:42470929-42470951 TCCTCAGCCAGTCTTCCAAGGGG + Intronic
1096693181 12:53333487-53333509 TGCCCAGCCTGGCCTCCCAGCGG + Intronic
1100057050 12:90524640-90524662 TCCTCAGCTAGTCATCCATGGGG - Intergenic
1100442474 12:94629446-94629468 TCCCCAGCCTGAGCTCCTTGAGG + Intronic
1100982522 12:100172835-100172857 CCCCAAGCCTGACCTCCCTGGGG - Intergenic
1102513382 12:113430530-113430552 TCCCCAGCCAGTGGCCACTGGGG + Intronic
1102942210 12:116953362-116953384 TCACCAGCCAGCCCTGCCTGTGG - Intronic
1103396323 12:120610043-120610065 TCCCCAGGCAGACCTCCCCACGG + Intergenic
1103920818 12:124398341-124398363 TCCCCAGCCAGTACCCACCGTGG + Intronic
1104632427 12:130414564-130414586 GCCCCAGCCTGTGCTCTCTGAGG - Intronic
1104718930 12:131033922-131033944 CCCTCTGCCAGTCCTCCCCGGGG + Intronic
1104860775 12:131922312-131922334 TCCCCTGCCGCCCCTCCCTGTGG + Exonic
1104983045 12:132582518-132582540 TCCCCGGCGACTCCTCCCTGCGG + Intronic
1105241302 13:18611172-18611194 GCCACAGCCAGTCCCTCCTGGGG - Intergenic
1105369755 13:19792175-19792197 GCCCCAGCCAGTGCTGCCTAAGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1107449094 13:40492476-40492498 TCACCCGGCAGCCCTCCCTGGGG - Intergenic
1107720873 13:43246732-43246754 TGCCCAGCCAATCCTGCATGTGG - Intronic
1107792533 13:44016663-44016685 TCTCAAGCCAGTCATTCCTGGGG - Intergenic
1112731539 13:102368069-102368091 TCCCAAGCCAGTTCCTCCTGTGG - Intronic
1113382125 13:109813683-109813705 TCCCCAACCAGTTCCCCCTGAGG - Intergenic
1113893272 13:113747801-113747823 TCCCCAGCCCAGCCTCCCTGAGG - Intergenic
1117110411 14:52447262-52447284 TAGCCTGCCAGTACTCCCTGTGG + Intronic
1117377399 14:55129150-55129172 TGCCCAGCCAGTCCTCTCCCCGG - Exonic
1117988004 14:61407540-61407562 TCCCCACCAGGTCCTCACTGAGG - Intronic
1119025449 14:71148799-71148821 TCCCCAGCCAGCCCTCACCAGGG + Intergenic
1119557992 14:75567963-75567985 TCCCCAGCCAGCCCTGCCTGGGG - Intergenic
1119568626 14:75650172-75650194 TCATCAGAAAGTCCTCCCTGAGG - Exonic
1122803892 14:104247133-104247155 TCCCCGGCCAGGGCACCCTGTGG - Intergenic
1122897626 14:104768405-104768427 TCGCCAGCCTGTGCTCCCTATGG + Intronic
1123490055 15:20773975-20773997 GCCACAGCCAGTCCCTCCTGGGG + Intergenic
1123546556 15:21343062-21343084 GCCACAGCCAGTCCCTCCTGGGG + Intergenic
1126268362 15:46781791-46781813 TCCCCATACAGTCCTCTTTGTGG + Intergenic
1126424893 15:48516656-48516678 TCTCCATCCAGTCCCACCTGTGG + Intronic
1128079089 15:64845541-64845563 CCTCCAGCCAGTCCTCCCCTGGG + Intronic
1129194706 15:73956859-73956881 TCCCCAGCCATTCCTCACCACGG + Intergenic
1129242297 15:74258920-74258942 TCCCCAGCTAGGCATTCCTGGGG - Intronic
1129843782 15:78758966-78758988 TCTGCAGACAGCCCTCCCTGGGG + Intergenic
1130549526 15:84881110-84881132 TCCCCTACCTGTCCTCCATGGGG - Intergenic
1131106205 15:89736564-89736586 TCCCCATGCAGTTTTCCCTGGGG - Intronic
1131294699 15:91136727-91136749 TCACCACCCCCTCCTCCCTGAGG - Intronic
1131426521 15:92349747-92349769 TCACCACCAAGTCCTCCCTGTGG + Intergenic
1131558583 15:93420079-93420101 CACCTAGCCTGTCCTCCCTGAGG + Intergenic
1202954886 15_KI270727v1_random:70277-70299 GCCACAGCCAGTCCCTCCTGGGG + Intergenic
1132465782 16:76911-76933 TCCCCAGGAAGTCCTGGCTGGGG + Intergenic
1132465783 16:76912-76934 GCCCCAGCCAGGACTTCCTGGGG - Intergenic
1132513370 16:354570-354592 TCCCCATGCAGTCCCACCTGTGG - Intergenic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132590012 16:722447-722469 TCCCCAGCCTGCCCACCCTCAGG - Exonic
1132746484 16:1438413-1438435 CACCCAGCCTGCCCTCCCTGGGG - Intronic
1132799091 16:1742682-1742704 TGCCCAGCCCTGCCTCCCTGTGG - Intronic
1132933048 16:2468418-2468440 TGCCCAGCCAGGCCGCTCTGCGG - Intergenic
1137468046 16:48729137-48729159 TCCCCGGATAGTCTTCCCTGAGG + Intergenic
1138083670 16:54115173-54115195 TTTCCTGCCAGTCCTCCCTGTGG + Exonic
1138348838 16:56335726-56335748 TCCCCATCCTGTGCTCCCAGTGG - Intronic
1139161833 16:64519556-64519578 CCTCAAGCCAGTCCTCCATGGGG + Intergenic
1139459312 16:67109438-67109460 GCCCCACCCAGTCGCCCCTGGGG - Intergenic
1139636170 16:68259923-68259945 GGCCCAGCCAGTCCACCCTGTGG - Exonic
1140306744 16:73809878-73809900 TCCCCACCCAGCCTTCCCTGTGG + Intergenic
1140884930 16:79234770-79234792 CCCTAAGCCAGTCCTGCCTGAGG + Intergenic
1141091961 16:81136522-81136544 CCCGCAGCCAGTGCTCCCTGAGG + Intergenic
1141333816 16:83136593-83136615 TCCCCTGGCAGACCTCCCTGTGG - Intronic
1141686617 16:85574016-85574038 TCCCAAGCCAGTCCCCGCGGGGG - Intergenic
1141773931 16:86109779-86109801 ACCCCAGCAAGTCTTCTCTGAGG - Intergenic
1141972569 16:87493148-87493170 TCCGCGGCCACGCCTCCCTGGGG + Intergenic
1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG + Intronic
1142151570 16:88514731-88514753 CCTCCAGGAAGTCCTCCCTGGGG - Intronic
1142172885 16:88632095-88632117 TCCACAGCCGGTCCTCCCGGGGG - Intergenic
1142410002 16:89911089-89911111 CCCCCAGCCACTCCTTCCTCGGG - Exonic
1142458567 17:73019-73041 TCCCAAGCCAGTCTTCACAGTGG + Intergenic
1142884391 17:2903749-2903771 TGACCAGCCAGCCCTCCCTGTGG - Intronic
1143019367 17:3908798-3908820 CCCTCAGCCACTCCACCCTGTGG - Intronic
1143026264 17:3943659-3943681 TTCCCAGCCTGGCCGCCCTGGGG + Intronic
1143856323 17:9853290-9853312 TCTCCATCGAGTCCTCCATGGGG + Intronic
1144065095 17:11617639-11617661 TGCCCAGCAACTGCTCCCTGGGG + Intronic
1144291606 17:13832086-13832108 TCCTCTACCAGTCTTCCCTGGGG - Intergenic
1144503372 17:15808420-15808442 TCCCCAGCCTCTCTTCCCTCTGG - Intergenic
1144709277 17:17389803-17389825 TCCCCAGCCCTTCCTGGCTGTGG - Intergenic
1145165552 17:20611127-20611149 TCCCCAGCCTCTCTTCCCTCTGG - Intergenic
1145799186 17:27672353-27672375 TCCCCTGCCGGTCCAGCCTGAGG - Intergenic
1147637281 17:41971881-41971903 TCTCCCGGCAGTCGTCCCTGGGG + Exonic
1147997971 17:44371654-44371676 TCCCCTTCTAGTCTTCCCTGAGG + Intergenic
1148125823 17:45236278-45236300 AGCCCAGCCTGTCCTCACTGGGG + Intronic
1148686855 17:49505916-49505938 TTCCCACCCAGCCCTCCCCGCGG - Intronic
1148734636 17:49858571-49858593 CCACCAGCCAGTGCTCCCGGAGG + Intergenic
1148842718 17:50508986-50509008 TCCCCAGCCAGTGGTCCCTGAGG - Intronic
1150394209 17:64808859-64808881 TCCCCAGAGACTCCTCCATGGGG + Intergenic
1151586817 17:75013831-75013853 TCCCCAGCCATCCCTCTCTTTGG - Intronic
1151682185 17:75628086-75628108 CCCCACGCCCGTCCTCCCTGGGG - Intronic
1152019502 17:77772987-77773009 TCCCCAGCCAGTCCCAGCTACGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152155194 17:78628562-78628584 TCCACACCCACTCATCCCTGGGG - Intergenic
1152421357 17:80195083-80195105 TCTCCAGTCAGTTCTCACTGTGG + Intronic
1152745429 17:82036569-82036591 TCTCCAGCCAGTGCTCCCAGCGG - Exonic
1153183271 18:2459685-2459707 TCACCAGGCAGTACTCACTGTGG - Intergenic
1154304118 18:13218158-13218180 TCCCCCGCCACCCCTCCCTCCGG - Intronic
1154447656 18:14448729-14448751 GCCACAGCCAGTCCCTCCTGGGG + Intergenic
1155961180 18:31996224-31996246 TCCCCGGAGAGTCCTCCCTCAGG - Intergenic
1156516777 18:37686831-37686853 TCCACACCCATTCCTCTCTGTGG - Intergenic
1157624712 18:49041775-49041797 TCCCCAGTCAGGCCTTCCTTGGG + Exonic
1159225112 18:65523443-65523465 TAGCCAGGCAGTACTCCCTGTGG + Intergenic
1160426779 18:78783285-78783307 TCTCCAGCCAGCCCACCCTCCGG - Intergenic
1160722283 19:602989-603011 GCCCCGGGCATTCCTCCCTGGGG - Intronic
1160722314 19:603068-603090 GCCCCGGGCATTCCTCCCTGGGG - Intronic
1160722370 19:603225-603247 GCCCCGGGCATTCCTCCCTGGGG - Intronic
1160722401 19:603304-603326 GCCCCGGGCATTCCTCCCTGGGG - Intronic
1160905648 19:1450542-1450564 TCACCATCCGGACCTCCCTGAGG + Intronic
1160983398 19:1826934-1826956 TCCGCAGGCACTCCTCCATGGGG + Exonic
1161143914 19:2665552-2665574 TCCCCACCCAATCCTTCCTCGGG - Intronic
1161427612 19:4212550-4212572 TGCCCAGCCTTTCCTCCCAGAGG + Intronic
1162134698 19:8548194-8548216 CCCACATCCTGTCCTCCCTGGGG - Intronic
1163492821 19:17626814-17626836 TCCTCATCCAGCCCTTCCTGTGG - Intronic
1163567309 19:18059270-18059292 TCCCCATCCAGTGCTCCTGGGGG + Exonic
1163667663 19:18610809-18610831 CCCCCAGCCAGGCCGCCCCGGGG + Intronic
1163783893 19:19264604-19264626 TGCCCAGTCAGCCCTACCTGGGG - Exonic
1165778083 19:38416751-38416773 ACCTCAGCCAGTCCTCCCCATGG + Intronic
1166194888 19:41198943-41198965 TCCCCAGCCAGGTGTCCCTGGGG + Intronic
1166373692 19:42315646-42315668 TCCCCAGCCCATCCTCCCCCAGG - Intronic
1166532706 19:43552468-43552490 CCCCCAGCCCCTCCTCCCTCAGG + Intronic
1166756113 19:45192572-45192594 TACCCAGGCAGTACTCCGTGTGG - Intronic
1167005780 19:46775590-46775612 TCCGCTGCCAGTCCCCACTGAGG - Exonic
1167298294 19:48664426-48664448 CCCCCAGCCCCTCCTCCCTCAGG + Intronic
1167486668 19:49766999-49767021 CCGCCAGCCAGCCCTCCCCGCGG + Intronic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1167678855 19:50906842-50906864 TTCCCAGCCCCTCCTCCCTCAGG - Exonic
1167689149 19:50974964-50974986 CCCCCAGCCCCTCCTCCCTCAGG - Intergenic
1167738306 19:51310683-51310705 TCCCCAGCCCCTCCTCCCTCAGG - Intergenic
1167792991 19:51692305-51692327 CCCCCAGCCCCTCCTCCCTCCGG - Intergenic
1168107240 19:54172603-54172625 TTCCCAGCCCCTCCTCCCTCAGG + Intronic
1168238173 19:55076300-55076322 GCCCCAGCCCCTCCTCCCTCAGG - Intronic
1168406889 19:56115111-56115133 TCCCAGGCCTGCCCTCCCTGAGG + Intronic
1168415699 19:56166839-56166861 TCCCCAACCCCTCCTCTCTGGGG + Intergenic
925849045 2:8062480-8062502 GCCCCAGACAATTCTCCCTGGGG + Intergenic
926214323 2:10894838-10894860 TCCCCAGCAACACTTCCCTGGGG - Intergenic
927201193 2:20579058-20579080 TCTCAGGTCAGTCCTCCCTGGGG + Intronic
927507007 2:23621241-23621263 TCCAGAGCCAGACCTCCCAGGGG + Intronic
927902184 2:26828474-26828496 TCCCCAGCAAGTGTTCCCCGTGG - Intergenic
927966787 2:27275394-27275416 TCCCCACCCAGTGCTTCCGGGGG + Intronic
928160927 2:28923842-28923864 TGCCCAGGTAGTCCTCACTGTGG - Intronic
928275584 2:29897523-29897545 TCCCAAGAGAATCCTCCCTGGGG - Intronic
928713461 2:34033625-34033647 TCCCCAGGCAGTTCTGCCTCAGG + Intergenic
928715685 2:34056931-34056953 TCCACTGACAGTCCTCCCTGAGG - Intergenic
929242386 2:39666012-39666034 GCCTCAGCCTGTGCTCCCTGGGG + Exonic
929272953 2:39993741-39993763 TCCCCAACCACTCCAGCCTGTGG - Intergenic
929564776 2:42977471-42977493 CTCCCAGCCCTTCCTCCCTGTGG - Intergenic
929593554 2:43162022-43162044 TCCCCGGCCAGCTCACCCTGGGG - Intergenic
930721854 2:54645789-54645811 TCCCCAGACAGCCCTCCCGAGGG + Intronic
931429666 2:62197819-62197841 TGCCCTGCCGGTCCTCCCTCCGG - Intronic
932408779 2:71532536-71532558 ACCCCAGCCAGCACTGCCTGTGG - Intronic
932705484 2:74021166-74021188 TCCCCAGCCAGGTGGCCCTGAGG + Intronic
932749645 2:74363262-74363284 TCCCATCCCAGTCCTCCCCGTGG + Intronic
933978101 2:87528080-87528102 TCCCCATGGAGTCCTGCCTGGGG - Intergenic
934052173 2:88220146-88220168 TCCTCAGCCAGGTCACCCTGAGG + Intergenic
934149644 2:89134106-89134128 TCCTCAGCCAGCTCTCCCTGAGG + Intergenic
934188287 2:89764560-89764582 TCACCCACCAGCCCTCCCTGTGG - Intergenic
934196581 2:89841912-89841934 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
934217651 2:90047922-90047944 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
935879001 2:107542476-107542498 TCACCAGCCAGTCCTCCTCAAGG + Intergenic
936862344 2:117032724-117032746 TCCCCACGCAGTCCTTACTGGGG - Intergenic
937633992 2:124135266-124135288 TCCCCAGCCAGCTCCCACTGAGG + Intronic
938096671 2:128468405-128468427 CTCCCAGCCAGGCCTCCCTCAGG - Intergenic
940990531 2:160091956-160091978 TCCCTAGCCAGTCCTCCCAGAGG - Intergenic
945065921 2:205947456-205947478 TCCCCAGCCAAACCACCCAGGGG + Intergenic
945431689 2:209772131-209772153 TGCCCATCCAGACCTTCCTGTGG + Exonic
946359410 2:219210112-219210134 TTCCCATCCCGTCCTCTCTGTGG - Intronic
947567114 2:231201303-231201325 CCCCTTGCCAGCCCTCCCTGAGG + Intronic
947667959 2:231918928-231918950 TGCCCAGCGACTCCTCCCTGTGG + Intergenic
948002510 2:234580015-234580037 GCCACAGCCAGTCCTACCTAGGG + Intergenic
948727750 2:239945159-239945181 TCCCCAGTCAGGCCCTCCTGCGG - Intronic
948770719 2:240250182-240250204 CCCCCAGCCAGAACTCCCTGGGG - Intergenic
948972860 2:241442752-241442774 ACTCCAGCCAGTCCTCCTAGAGG + Intronic
948978625 2:241480447-241480469 TCCCCAGAGAGTACACCCTGAGG - Intronic
949051561 2:241900409-241900431 TCCTCAGCCTGTCCTCTCCGGGG + Intronic
1168974269 20:1952517-1952539 ACCCCAGCCAGTACCCTCTGTGG + Intergenic
1169867477 20:10217567-10217589 TCCCCAGCCCTCCCTCCCTGCGG + Intergenic
1170142985 20:13143634-13143656 TCCCCATACCCTCCTCCCTGAGG + Intronic
1172226987 20:33311691-33311713 TCCCCTACCAGTGTTCCCTGGGG + Intergenic
1172633965 20:36396930-36396952 TTCCCAGAAACTCCTCCCTGGGG - Intronic
1173040226 20:39455184-39455206 TCCCAAGCTAGTCCAGCCTGAGG + Intergenic
1173153408 20:40587160-40587182 TCCCCAGACAAGCTTCCCTGTGG + Intergenic
1173338310 20:42131199-42131221 CCCCCAGGAAGTCCTCTCTGGGG - Intronic
1173664528 20:44754949-44754971 TCCCAGCCCAGCCCTCCCTGGGG - Intronic
1174390673 20:50216662-50216684 TGCCCCTCCAGGCCTCCCTGGGG + Intergenic
1174531219 20:51215865-51215887 ACCCCAGCCACTGCTCCCTCTGG - Intergenic
1175256638 20:57652027-57652049 GCCCCAGCCCGGCCCCCCTGGGG + Exonic
1175717624 20:61265958-61265980 TTCCCAGGCAGTTCACCCTGTGG - Intronic
1175732016 20:61360611-61360633 TCACCACCCAGTCCAGCCTGGGG + Intronic
1175883485 20:62274141-62274163 ACCCCAACCAGTCCTTCCAGAGG - Intronic
1176005565 20:62860904-62860926 CCCCCAGCCTGCCCTCCCGGCGG - Intronic
1176103982 20:63377097-63377119 TCCCCCGCCATCCCTCCTTGGGG + Intronic
1176138321 20:63534688-63534710 TCTCCAGCCAGCCCTGCCCGAGG - Intronic
1176199958 20:63855674-63855696 CCCCCAGCCCTTCCTTCCTGGGG - Intergenic
1178470411 21:32887236-32887258 TCCCCAAGCCATCCTCCCTGTGG + Intergenic
1178612811 21:34100402-34100424 TCCCCAGCTATTCTTTCCTGGGG + Exonic
1179024227 21:37667020-37667042 TTCCTAGCCAGTGGTCCCTGCGG - Intronic
1179039144 21:37786260-37786282 GCCCCAACCCTTCCTCCCTGTGG - Intronic
1179906418 21:44425479-44425501 TCCCGTGGCTGTCCTCCCTGGGG + Intronic
1179939741 21:44629633-44629655 GCCCCAGCCAGGCCCCACTGGGG - Intronic
1180068792 21:45425748-45425770 TCCCCTGCCAGACCACCCTGGGG - Intronic
1180195680 21:46192166-46192188 TCCCCAGCCTGTCATTGCTGTGG - Intronic
1180782412 22:18528667-18528689 TCCTCACCAAGTCCTCCTTGTGG - Exonic
1180797549 22:18613903-18613925 TCTCAAGATAGTCCTCCCTGTGG - Intergenic
1181034931 22:20165348-20165370 GCCCCAGCCAGCCGTCCATGTGG + Intergenic
1181125963 22:20702694-20702716 TCCTCACCAAGTCCTCCTTGTGG - Intergenic
1181224168 22:21381359-21381381 TCTCAAGATAGTCCTCCCTGTGG + Intergenic
1181254464 22:21553464-21553486 TCTCAAGATAGTCCTCCCTGTGG - Intronic
1181508889 22:23380011-23380033 GCCCCAGCCAGCCGTCCATGTGG - Intergenic
1181635386 22:24172036-24172058 CCACCATCAAGTCCTCCCTGCGG + Intronic
1182359516 22:29738367-29738389 TCTCCAGCCAGTCCTCCAGATGG + Exonic
1182630885 22:31684286-31684308 TCCCCAGCCAGCCTTCTTTGAGG - Exonic
1183347915 22:37318192-37318214 TGCCAAGCTAGTCCTCCCTCAGG - Intergenic
1183544686 22:38449145-38449167 AGCTCAGCCACTCCTCCCTGTGG - Intronic
1183950050 22:41347704-41347726 TCCCAGGCCAATGCTCCCTGTGG - Intronic
1184083914 22:42246633-42246655 TCCTTCCCCAGTCCTCCCTGAGG - Intronic
1184737149 22:46405990-46406012 ACTACAGCCAGCCCTCCCTGTGG - Intronic
1184871910 22:47245948-47245970 TCTCCAGCGAGTCCTCCTAGGGG + Intergenic
1184912206 22:47543640-47543662 TTTCCAGCCCCTCCTCCCTGTGG + Intergenic
1185015114 22:48338527-48338549 TGCCCAGCCAGGCCTGCCTAGGG - Intergenic
1185166921 22:49267014-49267036 TGTCCAGCAAGACCTCCCTGGGG + Intergenic
1185298109 22:50064035-50064057 TCCCCAGCCAGGCGCTCCTGCGG + Exonic
1185344157 22:50304174-50304196 TCCCCAGACAGACATCCCCGGGG + Intronic
949867045 3:8554965-8554987 TCCCCAACCACTCCTTCCTCAGG + Intronic
950105152 3:10383992-10384014 CCCTCAGCCACCCCTCCCTGAGG + Intronic
950684557 3:14607162-14607184 CCCCCAGCCAGCGCTCCCTGGGG + Intergenic
950720048 3:14876108-14876130 TCCCCACCATGTCCTACCTGTGG - Intronic
950863696 3:16172352-16172374 TCCCCAGAAAGTCATCCATGTGG - Intergenic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
953184073 3:40621767-40621789 ACCCCAACCATCCCTCCCTGTGG - Intergenic
953428372 3:42815387-42815409 CCCCTAGCCAATTCTCCCTGGGG - Intronic
953906041 3:46868680-46868702 TCCCCATCCTGTCCCCCATGAGG - Intronic
953907184 3:46874306-46874328 GCCCCAGCCAGTGTCCCCTGAGG + Intronic
954416273 3:50394949-50394971 TCTCCAGCAAGCCTTCCCTGAGG - Intronic
954745960 3:52787750-52787772 TCCCCAGCCTGAGGTCCCTGGGG + Intronic
954880285 3:53831122-53831144 TATCCTGGCAGTCCTCCCTGTGG + Intronic
955032398 3:55233758-55233780 TTCCCAGCCTGGCCTCTCTGTGG + Intergenic
956044661 3:65182750-65182772 TCTCTAGCCATTCCTCACTGAGG + Intergenic
956699289 3:71944615-71944637 CTCCCAGCCACTGCTCCCTGGGG + Intergenic
957939948 3:86991336-86991358 TCCGCAGCCAGCCTTCCCCGGGG - Intergenic
958684040 3:97369560-97369582 TACCAAACCAGTCATCCCTGAGG - Intronic
960153541 3:114275142-114275164 TACCCAGGCAGTACTCACTGTGG - Intergenic
961504119 3:127358921-127358943 TCACCACCCAGTTCTCACTGAGG - Intergenic
961648943 3:128407943-128407965 TCCCTAGCCAATCAGCCCTGAGG - Intronic
964634020 3:158841574-158841596 TGCCCAGCCAGGCATGCCTGCGG + Intergenic
964763117 3:160153205-160153227 TCCCCAGCCAGGCCTTCCACAGG + Intergenic
966912895 3:184569206-184569228 CCCGCAGCCAGTCCTCCCGCCGG - Intronic
969130152 4:4985170-4985192 TCCCCATCCTGCCATCCCTGGGG - Intergenic
969386017 4:6848900-6848922 ATCACAGCCAGTCCTGCCTGAGG + Intronic
969540233 4:7784175-7784197 CCCTCAGCCAATCCTCCCTGGGG - Intronic
969641457 4:8401576-8401598 TCTTCAGCCCATCCTCCCTGTGG + Intronic
969690962 4:8703957-8703979 TCCTCTGCCAGACCTCACTGGGG - Intergenic
970082364 4:12301938-12301960 TACCCATCCACTCCTCCATGTGG + Intergenic
971329153 4:25668118-25668140 ACCCTAGCCATACCTCCCTGTGG - Intronic
972995075 4:44869864-44869886 TCCCCAACCAGGCCTCCCTCTGG + Intergenic
973797469 4:54442817-54442839 TGTCCAGCCTTTCCTCCCTGAGG - Intergenic
974559057 4:63493783-63493805 TCCCCTGCCTGTCCTACTTGGGG + Intergenic
984395301 4:179190328-179190350 CTCTCAGCCAGCCCTCCCTGTGG - Intergenic
984974142 4:185215353-185215375 CTGCCATCCAGTCCTCCCTGTGG - Intronic
985980300 5:3456997-3457019 TCCCCAGCAAGCCCTCCGAGGGG + Intergenic
986631182 5:9775579-9775601 CCCCCAGACAGTACTCACTGTGG - Intergenic
987043200 5:14082554-14082576 TCCCCTCCCAGTACTTCCTGGGG - Intergenic
987545886 5:19309762-19309784 CCCCCACCCAGTCCCCACTGGGG - Intergenic
989368239 5:40679780-40679802 CCCCCCGCCAGTCTTCCCTGCGG + Exonic
992531804 5:77659459-77659481 TACCCAGGCAGTACTCACTGTGG - Intergenic
993431661 5:87840636-87840658 TCCCCAGCAAAACCTCACTGTGG - Intergenic
995096402 5:108240412-108240434 TAGCCAGGCAGTACTCCCTGTGG + Intronic
997510751 5:134452219-134452241 TGCCCAGTCACCCCTCCCTGGGG + Intergenic
997882067 5:137600281-137600303 TCCTCAACCAGAGCTCCCTGGGG + Intergenic
998004193 5:138646519-138646541 GCCCCTGCCAGTCCTTCCTTGGG + Intronic
998128293 5:139638428-139638450 GGCCCAGCCTGTCCTCCCCGCGG - Intergenic
998596570 5:143536620-143536642 CTCCTAGCCAGTCCTCCCAGGGG + Intergenic
1001330087 5:170755694-170755716 GTGCCAGCCAGTCTTCCCTGTGG + Intergenic
1002136853 5:177112971-177112993 TCCTCTGCCTGACCTCCCTGAGG + Intergenic
1003634526 6:7820496-7820518 TCCCCAGGCAGAACTCCCTTTGG - Intronic
1003887482 6:10534483-10534505 TCCCCAGAGAGTCCTGCCTTGGG + Intronic
1004104937 6:12658532-12658554 TCCCCAGCCCTTCCTCCCAAAGG - Intergenic
1004316395 6:14591808-14591830 TCCACAGCCAGTGCTTCCTGTGG - Intergenic
1006428690 6:33982223-33982245 TCCCCAGGCAGGCTTCCCTTGGG - Intergenic
1006463524 6:34177533-34177555 CCAGCAGCCAGCCCTCCCTGGGG + Intergenic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1007001607 6:38319050-38319072 TACCCTGGCAGTACTCCCTGTGG - Intronic
1007680231 6:43628850-43628872 TCCCGTGCCCCTCCTCCCTGGGG + Intronic
1007693615 6:43718221-43718243 TCCCCAGACTGCCCTCCCTCCGG + Intergenic
1009325733 6:62345925-62345947 TCCCCAGACAGAGCTCCCAGAGG + Intergenic
1009417676 6:63433882-63433904 TTCCCATCCAGCTCTCCCTGTGG + Intergenic
1011849107 6:91603745-91603767 TCCCCACAGAGTCCTCACTGGGG - Intergenic
1012010940 6:93784437-93784459 TCCCCAACCACACCTCCCTTTGG - Intergenic
1012444539 6:99294420-99294442 TGGCCAAACAGTCCTCCCTGTGG + Intronic
1012869453 6:104656612-104656634 ACCTCAGCCAGTCCAACCTGTGG + Intergenic
1013226693 6:108124131-108124153 TGGCAAGCCTGTCCTCCCTGTGG + Intronic
1013444085 6:110203832-110203854 TCCCCTGCCAGTCTTACTTGGGG + Intronic
1014385079 6:120790667-120790689 TGACCAGTCAGTTCTCCCTGTGG - Intergenic
1014649686 6:124019808-124019830 TCCCCATCCTGCCCTCACTGGGG + Intronic
1014855523 6:126396341-126396363 TAGCCAGGCAGTGCTCCCTGTGG - Intergenic
1017028538 6:150201448-150201470 TCCCCAGCCAGGCCTCCACAGGG - Intronic
1017633360 6:156421137-156421159 TCCACAGCAACTCCTTCCTGAGG + Intergenic
1019057765 6:169235507-169235529 TCCCGAGCCAGGCCTCCCTGGGG + Intronic
1019575421 7:1735430-1735452 TCCCCAGCCCGGCCTCCTGGAGG + Intronic
1019658948 7:2213101-2213123 TCTCCAGCCAGGCATCTCTGTGG - Intronic
1020200682 7:6077462-6077484 GCCCTAGCCAGCCCTCACTGTGG + Intergenic
1020256706 7:6506447-6506469 TCCCCTGCCTGCCCTCCCTTTGG - Intronic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1023348876 7:39299787-39299809 TCCCGAGCCTTTCCTGCCTGAGG - Intronic
1024674487 7:51625812-51625834 TCACCAGTGAGTCCACCCTGTGG - Intergenic
1025937415 7:66048309-66048331 TCCCTAGCCACACCTCCCTTGGG - Intergenic
1025946722 7:66110381-66110403 TCCCTAGCCACACCTCCCTTGGG + Intronic
1026016914 7:66678736-66678758 GCCCCAGGCAGTCCTCCCACAGG + Intronic
1027145294 7:75689780-75689802 CCCACAGCCAGTCCTGGCTGAGG - Intronic
1028676238 7:93465323-93465345 TCCCAAACCAGTCTTCCCTAAGG + Intronic
1028738543 7:94246219-94246241 TACCCAGACATTCCTACCTGTGG + Intergenic
1029205877 7:98869362-98869384 TGCCCATCCCGTGCTCCCTGGGG + Intronic
1029575383 7:101400146-101400168 TCCCCACCCCTGCCTCCCTGAGG - Intronic
1029673565 7:102050504-102050526 TCCAACGCCAGGCCTCCCTGGGG + Intronic
1029746413 7:102517783-102517805 TCCCCGGCCCGCCCCCCCTGCGG - Intergenic
1029820169 7:103139007-103139029 TCCCTTGCCAGTCCAGCCTGGGG - Intronic
1036284940 8:7435948-7435970 TCCCCTAAAAGTCCTCCCTGAGG - Intergenic
1036336535 8:7875582-7875604 TCCCCTAAAAGTCCTCCCTGAGG + Intergenic
1036697116 8:10982839-10982861 CCCCAAGCCATGCCTCCCTGGGG - Intronic
1037761334 8:21743693-21743715 AACCCAGCCAGTCCTCCCTGGGG - Intronic
1038062671 8:23929981-23930003 TGCCCCGCCAGCCCTCCCTTTGG - Intergenic
1038556310 8:28520631-28520653 TCCCTAGCCATTCCACCCTATGG + Exonic
1039498748 8:38000616-38000638 ACCCCAGGCAGACCTCCCCGTGG + Intergenic
1040286165 8:46101512-46101534 TGCCCAGCCAAGCCACCCTGCGG + Intergenic
1040576079 8:48652486-48652508 TGCCCAGGCAGCCTTCCCTGAGG - Intergenic
1040578390 8:48674484-48674506 CCGCCAGCCAGGCCTCCCTCAGG + Intergenic
1041092810 8:54318522-54318544 TGCCCAGCCAGTCCTTCCCCAGG - Intergenic
1042428166 8:68673122-68673144 TACCCAGGCAGTACTCTCTGTGG + Intronic
1042489569 8:69381742-69381764 TTCTCAGCCAGTCCAGCCTGTGG + Intergenic
1043683416 8:83060050-83060072 TGCCCATCCAGTCCTCAGTGGGG + Intergenic
1047431413 8:124796542-124796564 TCCCCTTCCAGTCCTACCTGCGG + Intergenic
1049566933 8:143345201-143345223 GCACCAGCCAGTCCTTCCCGAGG + Intronic
1052845846 9:33335703-33335725 TCCCCACTCAGTCCTCCCCCAGG + Intronic
1053166423 9:35846811-35846833 GCCCCAGCCTCTCCACCCTGCGG - Exonic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1056640221 9:88363622-88363644 TCACCACGCAGTCATCCCTGTGG + Intergenic
1056681028 9:88719195-88719217 TCCACATGCAGACCTCCCTGCGG + Intergenic
1056843356 9:90016676-90016698 TACCCTGCCATTCCTCCATGTGG - Intergenic
1057054488 9:91950145-91950167 TCCCCAGCCAGCCCTTGCCGTGG - Exonic
1057196617 9:93119138-93119160 ACTCCAGCCAGTCCTGCCCGTGG - Intergenic
1057259546 9:93576325-93576347 TCCCCAGCCCGCCTTCCCGGCGG + Intergenic
1057457649 9:95228807-95228829 TGCCCAGCAACTCCTTCCTGGGG - Intronic
1057702455 9:97373878-97373900 TCACCTGCCTGTTCTCCCTGGGG - Intronic
1058711377 9:107682182-107682204 TCCCCAGGCATTCCGCCCTTGGG - Intergenic
1059839061 9:118191835-118191857 TACCCAGGCAGTTCTCACTGAGG + Intergenic
1060319380 9:122541754-122541776 TTCCCAGCCAGATCACCCTGTGG + Intergenic
1060806913 9:126583492-126583514 TGGCCAGCCAGATCTCCCTGGGG + Intergenic
1061135414 9:128730655-128730677 TGTCCAGCCAGGCCTGCCTGAGG - Exonic
1061483206 9:130907253-130907275 TCCCCACCCACCCCTCCCTCGGG - Intronic
1061720466 9:132547886-132547908 TGCCCAGGCAGCCCTCCCTGGGG + Intronic
1061817479 9:133205660-133205682 TCCACAGCGAGGCCTCCCTCCGG - Exonic
1062242926 9:135549566-135549588 TCCACAGCGAGGCCTCCCTCCGG + Exonic
1062285736 9:135771772-135771794 TCCCCAGCCAGGCCTTCCTGGGG + Intronic
1062613968 9:137387757-137387779 GCCCCAGCCAGCCCTCCCTGAGG + Intronic
1186840959 X:13484381-13484403 TCCCAACCCAGTACTTCCTGGGG + Intergenic
1187244327 X:17540227-17540249 TCCTCAGCAACTCCTCCCTAGGG - Intronic
1188608790 X:32070026-32070048 TCCCCTGCCTGTACTCCCTGTGG - Intronic
1188864634 X:35299996-35300018 TACCAAGGCAGTACTCCCTGTGG + Intergenic
1190690040 X:52906439-52906461 TTCCCAGCCAGTCCTGCCACGGG + Intronic
1190695943 X:52949353-52949375 TTCCCAGCCAGTCCTGCCACGGG - Intronic
1194103649 X:89739047-89739069 TCCTCTGGCTGTCCTCCCTGAGG + Intergenic
1194110261 X:89824810-89824832 TCACCTGGCAGTACTCCCTGTGG + Intergenic
1195454431 X:105051709-105051731 GCTCCAGCCATGCCTCCCTGCGG + Intronic
1196099145 X:111829867-111829889 TCCCCACACAGTCCCCACTGGGG + Intronic
1197481773 X:126995450-126995472 TACCCAGACAGTACTCGCTGTGG + Intergenic
1199510213 X:148613258-148613280 TTCCCACCAAGGCCTCCCTGTGG - Intronic
1200109674 X:153733940-153733962 CCCCCAGCCAATGATCCCTGAGG + Intronic
1200259019 X:154602225-154602247 TCCCTGGCCGGCCCTCCCTGCGG - Intergenic
1200462922 Y:3479551-3479573 TCACCTGGCAGTACTCCCTGTGG + Intergenic