ID: 1141998625

View in Genome Browser
Species Human (GRCh38)
Location 16:87650368-87650390
Sequence CAGAGGAGAGAGAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2729
Summary {0: 1, 1: 3, 2: 25, 3: 315, 4: 2385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141998625_1141998637 17 Left 1141998625 16:87650368-87650390 CCCCCATCCCTCTCTCTCCTCTG 0: 1
1: 3
2: 25
3: 315
4: 2385
Right 1141998637 16:87650408-87650430 GACACAACAGTATTAAAATTAGG 0: 6
1: 76
2: 381
3: 659
4: 862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141998625 Original CRISPR CAGAGGAGAGAGAGGGATGG GGG (reversed) Intronic
Too many off-targets to display for this crispr