ID: 1141998625 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:87650368-87650390 |
| Sequence | CAGAGGAGAGAGAGGGATGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2729 | |||
| Summary | {0: 1, 1: 3, 2: 25, 3: 315, 4: 2385} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141998625_1141998637 | 17 | Left | 1141998625 | 16:87650368-87650390 | CCCCCATCCCTCTCTCTCCTCTG | 0: 1 1: 3 2: 25 3: 315 4: 2385 |
||
| Right | 1141998637 | 16:87650408-87650430 | GACACAACAGTATTAAAATTAGG | 0: 6 1: 76 2: 381 3: 659 4: 862 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141998625 | Original CRISPR | CAGAGGAGAGAGAGGGATGG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||