ID: 1142000418

View in Genome Browser
Species Human (GRCh38)
Location 16:87661172-87661194
Sequence GAGAGGAGAGGCTGCCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 328}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000418_1142000432 25 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000418_1142000424 8 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000418_1142000431 24 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110
1142000418_1142000428 18 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000418_1142000430 23 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000418 Original CRISPR GAGAGGAGAGGCTGCCCCGC TGG (reversed) Intronic
900371009 1:2332192-2332214 AGGAGGACAGGCAGCCCCGCTGG - Intronic
900625937 1:3608629-3608651 GAGAGGAGTGTCTGCTTCGCGGG - Intronic
900956655 1:5890088-5890110 GAGAGGACAGGAAGCCCCGGGGG + Intronic
901640105 1:10688808-10688830 AAGAGGAGGGGCAGCCTCGCCGG - Intronic
902190541 1:14759976-14759998 GGGAGGAGGGGCTGCCCTGAGGG - Intronic
902963972 1:19984720-19984742 GAGAGGCCAGCCTGCCCTGCCGG - Intergenic
903320065 1:22537709-22537731 CACAGGCGAGGCTGCCCCCCAGG - Intergenic
903363356 1:22790918-22790940 GAGAGCAGGGGCTGCACAGCAGG - Intronic
903500189 1:23796346-23796368 CAGAGCAGCGGCTGGCCCGCAGG + Intronic
903668366 1:25021536-25021558 GAGGGCAGGGGCTGCCCCGAAGG - Intergenic
904001837 1:27343157-27343179 GAGAGGAGAGGCCGCCCAGTGGG + Intronic
904410478 1:30322034-30322056 GAGAGGAGAGGGGGCCACCCTGG - Intergenic
904498778 1:30902351-30902373 GAGGGGAGTGGCTGCCCCTCTGG + Intronic
904597751 1:31657437-31657459 CAGAAGAGAGGCTGCCTTGCTGG - Intronic
904599095 1:31664119-31664141 GAGAGCAGGGGCTGCCACTCAGG + Intronic
904616937 1:31755060-31755082 GAGAGGAGAGGCCTCCCTGTCGG + Intronic
906188711 1:43881637-43881659 GAGAGGAGAGGCTGAGCCAGAGG - Intronic
907280500 1:53344100-53344122 CAGAGGAGAGGCAGCCTGGCAGG - Intergenic
907387645 1:54136410-54136432 CAGAGGAGAGGGTGTCCCTCTGG - Intronic
907581694 1:55578042-55578064 GACAGGAGAGGCTGCCTTCCCGG + Intergenic
908425745 1:64005475-64005497 GTGAAGAGAGGCTGCCAGGCTGG + Intronic
910283458 1:85527272-85527294 GAGAGGAGAGGCAGCACCATTGG + Intronic
910735114 1:90445075-90445097 GAGTGGAGAGCCTTCCCCTCTGG - Intergenic
911178142 1:94838040-94838062 TAGAGGAGCGGCTGGCCCTCTGG + Intronic
911407809 1:97464442-97464464 GATAGGAGAGGCTGCCACATAGG - Intronic
912861192 1:113215238-113215260 GATGGGAGAGGCTGCCCTGAAGG + Intergenic
914206555 1:145535718-145535740 GAGAGGAGAGGCAGCACCATTGG - Intergenic
915447717 1:155983546-155983568 GAGAGGAGAAAATGCCCCCCGGG - Intronic
915791299 1:158674514-158674536 GAGAAGAAAGGCTGCCCAGTAGG - Intronic
917523396 1:175766529-175766551 GAGAGGTGAAGCTGCCCTTCTGG + Intergenic
918040750 1:180912760-180912782 CTCAGGAGAGGCGGCCCCGCGGG + Intergenic
918787014 1:188775946-188775968 GAGAGGAGGGGCTGCCATGAAGG - Intergenic
919861173 1:201740248-201740270 GAGAGGAGTGCCTGCGCCGCCGG + Intronic
920251534 1:204625325-204625347 GAAAGGAGAGGCTGCAATGCTGG - Intronic
920444615 1:206006483-206006505 GAGAGGAGATGCTGAACCTCTGG + Intergenic
920497674 1:206467107-206467129 GAGAGGAGAGGGTGAGCTGCAGG + Intergenic
920872489 1:209805892-209805914 GGGAGGAGAGGCTCCCCCGTGGG - Intronic
922219255 1:223545195-223545217 CAGAGGAGAGGATGCCCAGAAGG + Intronic
922730179 1:227945512-227945534 GAGAGGAGAGGCTGGCCTGGGGG - Intronic
922785187 1:228279117-228279139 GATAGGACATGCTGCCCCTCCGG - Intronic
923007969 1:230067242-230067264 GCGAGCAGCGGCGGCCCCGCCGG + Exonic
924715241 1:246566764-246566786 GAGGGCAGAGGCTGCGCGGCTGG - Intronic
1064203392 10:13302488-13302510 GAAAGGAGAGACCGCCTCGCCGG - Intergenic
1065102004 10:22340722-22340744 CGGAGGAGCGGCTGCCCCGCGGG - Intergenic
1065918003 10:30368310-30368332 GGGAGGAGAGGCTGCGGAGCAGG - Intronic
1067139878 10:43648382-43648404 GGGAGGAGAGGCAGCCCCTGCGG - Intronic
1067277874 10:44850755-44850777 GGGAGGAGAGGCAGGCCCGAAGG + Intergenic
1067498054 10:46776218-46776240 GTGAGGAGGGGCTGCTCCGACGG + Intergenic
1067596592 10:47564196-47564218 GTGAGGAGGGGCTGCTCCGACGG - Intergenic
1068853139 10:61767788-61767810 GAGAGGACATGCTGCCCCACAGG - Intergenic
1070736000 10:78864040-78864062 CAGAGGACAGGCTCCACCGCAGG - Intergenic
1070819343 10:79345937-79345959 GAAAGGAGGGGCTGCTCCCCAGG + Intergenic
1071110198 10:82146855-82146877 GAGAGGGGAGGCTTCCCTGATGG + Intronic
1071336424 10:84604132-84604154 GAGGGGAGAGGCTGCACATCTGG + Intergenic
1073123475 10:101135553-101135575 GGGAGGAGAGGCAGCCTGGCAGG + Intronic
1074440921 10:113476831-113476853 GAGGTCAGAGGCTGCCCCACTGG - Intergenic
1074761577 10:116670458-116670480 GAGAGGAGTGGCTGTCCACCTGG + Intergenic
1076163699 10:128265888-128265910 GAGATGTGCGGCTGCCCCGCGGG - Intergenic
1077252253 11:1565864-1565886 GTGAGGAGGGGCTGCTCCGACGG + Exonic
1077274914 11:1700122-1700144 AAGATGAGAGGCTGCTCCCCAGG - Intergenic
1077388858 11:2290054-2290076 GAGAAGGGAGGCTGGCCCTCGGG + Intergenic
1079006543 11:16795110-16795132 CAGAGGGGATGCTGCCCCTCAGG - Intronic
1080394526 11:31877449-31877471 TAGAGGAGAGGCTGCCTCCCTGG - Intronic
1080938526 11:36887418-36887440 AATAGGAGAGGCTGCACAGCAGG + Intergenic
1080981456 11:37412030-37412052 GAGAGGAGAGAATGCCAAGCAGG + Intergenic
1083596321 11:63919617-63919639 GAGAGGAGGGGCTGGTCCCCGGG - Intergenic
1084367802 11:68714413-68714435 TAGAGGACAGGCGGCCCCACAGG + Intronic
1084714135 11:70863017-70863039 CAGGGCAGAGGCTGCTCCGCAGG + Intronic
1085046301 11:73355745-73355767 GAGAGCGGAGGCTGGCCCACTGG - Intronic
1085350974 11:75797722-75797744 GGAAGAAGAGGCTGCCCTGCAGG + Intronic
1087088281 11:94242257-94242279 GAGAGAACAGGCTGCCCTGAAGG - Intergenic
1087182060 11:95150953-95150975 AGGACGAGAGGCTGGCCCGCGGG - Intergenic
1089195623 11:116692629-116692651 GAGAAGAGAGGCAGCCTTGCTGG - Intergenic
1090247494 11:125226888-125226910 CAGAGGAGAGGCTGCCAGGGAGG - Intronic
1090763120 11:129854489-129854511 GTGAGGTGAGGGTGGCCCGCGGG - Intronic
1090998554 11:131888960-131888982 GAAAAGAGAGGCTGCACCGAAGG - Intronic
1091043229 11:132301690-132301712 GAGAGCAGAGGCTGCAGAGCTGG + Intronic
1091225235 11:133953166-133953188 AGGAGCAGAGGCTGCCTCGCTGG - Intronic
1091564868 12:1640811-1640833 GACTGGAGGGCCTGCCCCGCAGG + Intronic
1091915725 12:4271044-4271066 AAGAGGCGAGCCTGCCACGCGGG + Intergenic
1094428035 12:30336339-30336361 GAGAGGAGATGCAGCCTCTCTGG + Intergenic
1096787235 12:54024193-54024215 GAGAAGAACGGTTGCCCCGCTGG - Intronic
1097024186 12:56042125-56042147 GAGAGGAGACGGTGCCTGGCAGG - Exonic
1098914861 12:76246761-76246783 GAAAGGGGATGCTGCCCAGCTGG - Intergenic
1099898713 12:88681356-88681378 GATAGGAGAGGCTGCCATGAAGG - Intergenic
1101113217 12:101506559-101506581 GATGGGAGAGGCTGCCACACAGG - Intergenic
1101666620 12:106822385-106822407 GAGAGGAGATGCTGACTCACAGG - Intronic
1102233267 12:111278044-111278066 GACTGAAGAGGCTGCCCGGCTGG - Intronic
1102237642 12:111304209-111304231 GCGAGCTGAGGCTGCCCAGCGGG + Exonic
1103925736 12:124422603-124422625 GAGCCGATCGGCTGCCCCGCAGG - Intronic
1104858170 12:131911543-131911565 CAGTGGAGAGGCTGCCACCCCGG - Intronic
1105305963 13:19169480-19169502 GGGAGGAGACGCTGCCCAGGTGG - Intergenic
1105378300 13:19864018-19864040 GCGAGGGCAGGCAGCCCCGCCGG - Intergenic
1105388921 13:19958330-19958352 GCGAGGGCAGGCGGCCCCGCCGG + Intergenic
1105783227 13:23722398-23722420 GAGAGCAGCGGCTACCCAGCTGG - Intergenic
1106730048 13:32531961-32531983 GAGAGAAGATGCTGCACTGCTGG - Intronic
1110857682 13:80314275-80314297 TAGAGCAGAGGCTGCCACACAGG + Intergenic
1113184497 13:107672543-107672565 GAGAGTCAAGGCTGCCCAGCTGG + Intronic
1113511973 13:110863648-110863670 GAGAGGAGAGGCCGCTCACCAGG - Intergenic
1113967801 13:114164280-114164302 GGGAGGAGAGGGTCCCTCGCTGG - Intergenic
1114528512 14:23380873-23380895 GAGAGGAGTGGCTGCCACCAAGG - Intergenic
1116500253 14:45612343-45612365 GAGAAGAGAGGCAGCCCCAAAGG + Intergenic
1117911599 14:60642568-60642590 GAGAGGAGAGGCTGCCAGTATGG - Intergenic
1118535402 14:66758172-66758194 CAGAGGAAAGGCTGCCACACAGG + Intronic
1120583188 14:86279604-86279626 GAAAGGAGAGGCTGCCTTGAAGG - Intergenic
1122155894 14:99750238-99750260 GAGCGGAGAGGCTCCCCTGGTGG + Intronic
1122405167 14:101496518-101496540 GCCAGGACAGGCTGGCCCGCCGG + Intergenic
1122981873 14:105195711-105195733 GAGAGGAGAGTCTGGCAAGCCGG - Intergenic
1123019329 14:105390303-105390325 GAGAGGAGAGACTGCCTGCCCGG + Intronic
1123464558 15:20505964-20505986 GAGGCCCGAGGCTGCCCCGCGGG + Intergenic
1123653556 15:22495077-22495099 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1123743976 15:23303937-23303959 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1124252847 15:28118288-28118310 TGGAGGAGAGGCAGCCCCGTGGG - Intronic
1124275287 15:28321931-28321953 GAGGCCCGAGGCTGCCCCGCGGG + Intronic
1124307417 15:28589670-28589692 GAGGCCCGAGGCTGCCCCGCGGG - Intergenic
1126103502 15:45133796-45133818 GAGAGGACAGGCAGGCCTGCCGG - Intronic
1126789246 15:52205343-52205365 AAGAGGAGCTGCAGCCCCGCTGG - Intronic
1127295434 15:57604770-57604792 GAGAGGAAAGGCTGGCAGGCAGG + Intronic
1127917251 15:63464881-63464903 GAGAGGAGAGGAAGCCCGGAAGG + Intergenic
1128280051 15:66387101-66387123 GAGCCGAAAGGCTGCCCTGCAGG - Exonic
1129372749 15:75108501-75108523 TACAGTAGATGCTGCCCCGCAGG + Intronic
1130927548 15:88396746-88396768 GAGAGGAGGGGCAGCCCAGGAGG + Intergenic
1131036601 15:89226599-89226621 GAGAGCCCAGGCTGCCCCGTGGG + Intergenic
1132400357 15:101501472-101501494 GAGAGGAGAGGCTGGCCTGGGGG - Intronic
1133930308 16:10226859-10226881 AAGAGGAGGGGGTGCCCAGCTGG + Intergenic
1134250001 16:12567805-12567827 GAGAGCAGAGGGTGCTCAGCAGG - Intronic
1137547091 16:49411753-49411775 CAGTGGAGAGGCTGCCACCCTGG + Intergenic
1137695169 16:50456693-50456715 GAGAGGCGAGGCTGGCACGTGGG - Intergenic
1138487417 16:57355529-57355551 GAGTGGAGAGGCTGGCAGGCAGG - Intergenic
1139558028 16:67724969-67724991 GAGAGGACTGGCTGCCCTGGAGG - Exonic
1141585708 16:85032264-85032286 GAGAAGAGAGGCAGACCCACAGG - Intronic
1141948159 16:87324306-87324328 GAGAGGTGAGGCTGCGGGGCTGG + Intronic
1141957507 16:87382974-87382996 GCGAGCCGAGGGTGCCCCGCTGG - Intronic
1142000418 16:87661172-87661194 GAGAGGAGAGGCTGCCCCGCTGG - Intronic
1142133582 16:88441800-88441822 GGAAGGTGTGGCTGCCCCGCTGG - Intergenic
1142151062 16:88512762-88512784 GAGAGAAGAGACTCCCCCGATGG - Intronic
1142160382 16:88554526-88554548 GAGAGGAGAGGCTGCCCTGCTGG - Intergenic
1142199465 16:88754214-88754236 GAGGGGAGAGGCTGCCCCCACGG + Intronic
1142428352 16:90012435-90012457 GAGAGGAGGGGGTGCCCCTCAGG - Intronic
1142607175 17:1088294-1088316 ATGAGGAGAGGATGCCCCCCAGG + Intronic
1143186559 17:5013751-5013773 AAAAGCAGAGGCTGCCCCCCAGG - Intronic
1143186701 17:5014341-5014363 AAAAGCAGAGGCTGCCCCCCGGG - Intronic
1143652961 17:8275645-8275667 GAGAGCAGAGGGTGCCCTGGCGG - Intergenic
1145772189 17:27501476-27501498 GATGGGAGAGGCTGCCACGAAGG - Intronic
1146399204 17:32490095-32490117 GGGAAGAGAGCCTGCCCGGCCGG + Exonic
1147610345 17:41798331-41798353 GAGAGGAGAGGGTGCGCTGCAGG - Intergenic
1147932099 17:43988083-43988105 GAGAGGAGAAGGTGACCCGTGGG + Intronic
1148563110 17:48617662-48617684 GAGAGGAGAGGCTGCAGCTGGGG + Intronic
1149666126 17:58365776-58365798 GAGAGGATAGGCAGGCCCTCAGG + Intronic
1149867751 17:60160129-60160151 GAGAGAAGAGGCTGCTTGGCTGG + Intronic
1151130545 17:71892422-71892444 GGGAGTAGAGGCTGCCCCCCAGG - Intergenic
1151544379 17:74783618-74783640 GAGAAGACAGGCTTCCCAGCAGG - Intronic
1151659610 17:75511956-75511978 GAGGGGAGTGGCTGCACTGCTGG + Intronic
1151964842 17:77425901-77425923 TAGAGGAGAGGCTGCTGTGCCGG + Intronic
1152128278 17:78460501-78460523 CATAAGAGAGGCTGCCCCTCCGG + Intronic
1152234177 17:79129984-79130006 GAGGGCAGGGGCTGCCCTGCGGG + Intronic
1152245806 17:79183992-79184014 GAGAGGAGGAGCCGCTCCGCCGG + Intronic
1152380157 17:79938210-79938232 CGGAGGAGACGCTGCTCCGCGGG - Exonic
1152632492 17:81416841-81416863 GATGGGAGAGGCTGGCCAGCAGG + Intronic
1152676498 17:81644205-81644227 GGGGGAAGAGGCAGCCCCGCAGG - Intronic
1153648163 18:7214016-7214038 GAGAGGAGAGGCAGCAGAGCAGG - Intergenic
1154087360 18:11320471-11320493 GAGGGGAGAGGTTGTCCTGCAGG - Intergenic
1156499249 18:37546610-37546632 GAGAGGGGAGGATGCCCAGAGGG - Intronic
1156940937 18:42766705-42766727 GATAGGAGGGGCTGCCCTGAAGG - Intronic
1157784461 18:50469517-50469539 AGGAGGAGGGGGTGCCCCGCTGG + Intergenic
1160210116 18:76870823-76870845 GTGAGGAGAGCCTGCCCGGCGGG + Intronic
1160763774 19:798150-798172 GAGAGAAGCGGCCGCCCCGAGGG + Intronic
1161015025 19:1979215-1979237 GCCAGGGGAGGCTGCCGCGCAGG - Exonic
1161125919 19:2556984-2557006 GGGAGGGGAGGCAGCCCCCCTGG - Intronic
1162534511 19:11254845-11254867 GAGGGTAGAGGGTGCCCAGCAGG + Intronic
1162572112 19:11479933-11479955 GAGGGGAGAGGAGGGCCCGCGGG - Intronic
1163493199 19:17629348-17629370 GAGAGGAGAGGCTGGCACCAAGG + Intronic
1163679530 19:18672644-18672666 GGGAGGAATGGCTGCCCGGCTGG - Intergenic
1165297419 19:34938795-34938817 AACAGGTGAGGCTGCCCCGCTGG - Intronic
1165383363 19:35496012-35496034 AACAGGAGAGGCTGCGGCGCAGG - Intergenic
1166048272 19:40242407-40242429 GAGAGACAAGGCTGCCCTGCAGG - Intronic
925414137 2:3657542-3657564 GAGTGGATAGCTTGCCCCGCAGG + Intergenic
926150585 2:10423496-10423518 GAGAGAAGAAGCTGCCCAGATGG + Intronic
926395245 2:12434658-12434680 GAGAGGAGAGGCTGGCAGGGGGG + Intergenic
927940070 2:27097935-27097957 GAGAGGAGATGCTTCCACACAGG - Intronic
928206898 2:29290889-29290911 GAGAGGAGAGGCAGGCAGGCAGG + Intronic
929532401 2:42761361-42761383 GAGAGCAGAGGCTGCCCTTGAGG - Intergenic
929607275 2:43243116-43243138 GGGAGGAGGAGCTGCCCAGCAGG - Intronic
930243349 2:48958436-48958458 GAGAGGAGGAGCTGCACTGCAGG + Intergenic
932036562 2:68252260-68252282 GGGAGGGGAGGCGGCGCCGCGGG + Exonic
932486380 2:72086674-72086696 GAGAGGAGTGCCTGCCCATCTGG + Intergenic
935145132 2:100390404-100390426 CAGAGGAGAGGATGCCCAGGGGG - Intergenic
936153735 2:110035444-110035466 CAGAGGGGAGGCTGCCCCCACGG + Intergenic
936190950 2:110335971-110335993 CAGAGGGGAGGCTGCCCCCACGG - Intergenic
936396895 2:112138357-112138379 GGGAGGAGGGGCTGCCCGGCCGG - Intergenic
937031573 2:118745014-118745036 GATAGGAGAGGCTGCCATGAAGG + Intergenic
938461830 2:131502263-131502285 GGGAGGAGATGCTGCCCAGGTGG + Intergenic
943942706 2:194020253-194020275 GAGTGGCCAGCCTGCCCCGCTGG + Intergenic
947933710 2:233985242-233985264 GAGAGCAGAGGCTGAGCAGCAGG - Intronic
948814359 2:240502346-240502368 GAGGGGAGAAGGTGCCCAGCAGG - Intronic
1172487033 20:35304499-35304521 GAGAGGGGAAGCTGCCACCCTGG - Intronic
1172510550 20:35497952-35497974 CAGAGTAGAGGCTGGCCAGCTGG - Exonic
1172669369 20:36624179-36624201 GAGAAGAGAGGATGCCGCGCAGG - Intronic
1172757871 20:37299933-37299955 GAGAGGAGAGGCTGGAGAGCTGG + Intronic
1173537921 20:43829985-43830007 GACACGAGAGGCTGCCCTGTTGG + Intergenic
1173810061 20:45950077-45950099 GAGAGGAGAGGATGCTCACCTGG + Intronic
1173865101 20:46308190-46308212 CCGAGGGGAGGCTGCCCGGCAGG - Intronic
1174186318 20:48708741-48708763 GAGGGGAGAGCCTGCCGGGCAGG + Intronic
1174985516 20:55447571-55447593 GAGAGGAGAGGCTGTAAGGCAGG + Intergenic
1175553107 20:59829592-59829614 GTGTGGAGACGCTGCCTCGCTGG + Intronic
1175582690 20:60112741-60112763 GACAGGAGAGGGGGCCCTGCTGG - Intergenic
1175691423 20:61068356-61068378 GAATGGAGAGCCTGCACCGCTGG + Intergenic
1175730761 20:61352518-61352540 CACCGGAGAGGCTGCCCCACAGG - Intronic
1175825991 20:61936803-61936825 GAGGGGAGCGGCTCCACCGCAGG + Exonic
1175930808 20:62492947-62492969 CTGGGGAGAGGCTGCCTCGCAGG + Intergenic
1176056730 20:63152853-63152875 GAGAGGAGAGCCAGGCCCGGGGG + Intergenic
1179333454 21:40427670-40427692 GAGAGGATAAGCTGCCCCATTGG + Intronic
1180066861 21:45416731-45416753 GAGAGTAGAGGCTGCACCTCTGG - Intronic
1180640279 22:17292646-17292668 TAAAGGAGAGGCTGCCCCTCGGG + Intergenic
1181533284 22:23529317-23529339 GGGAGGCGAGGCTGCCTCGGAGG + Intergenic
1181939785 22:26466232-26466254 TACGGGAGAGGATGCCCCGCAGG - Exonic
1182664022 22:31944488-31944510 GGGAGGAGACGCGGCCGCGCTGG - Exonic
1183363376 22:37394489-37394511 GAGAGGTGAGGCTGCCCGGGAGG - Intronic
1184152174 22:42645635-42645657 GTGAGCAGAGGCTGCCCGCCTGG - Intronic
1184970999 22:48019753-48019775 GAGAGGAGAGGCCGGTCCTCGGG + Intergenic
1185100219 22:48836356-48836378 GAGAGCAGAGGCTGCAGGGCAGG + Intronic
1185128129 22:49023012-49023034 ATGAGGAGAGGCTGACCTGCAGG - Intergenic
949894261 3:8757742-8757764 CAGAGGAGAGGCTGTCCACCCGG + Intronic
950086288 3:10260328-10260350 GAAGGGAGAGGCTGCCACTCGGG + Exonic
950121545 3:10485311-10485333 GAGAGGTGAGGTTGCCGAGCTGG + Intronic
950438511 3:12994222-12994244 GCGCGGGGAGGCCGCCCCGCCGG - Intronic
952619012 3:35313558-35313580 GAGAGGAAAGGCTGACCAGTTGG - Intergenic
953690116 3:45110698-45110720 GGAAGGAGACGCTGGCCCGCAGG + Exonic
954218847 3:49140016-49140038 CAGGGGTGAGGCTGCCCTGCAGG - Intergenic
956703572 3:71980376-71980398 GAAAGGAGAGACTGGCCGGCCGG - Intergenic
957624601 3:82642155-82642177 CAGCAGAGAGGCTGCCCTGCTGG + Intergenic
957624642 3:82642346-82642368 CAGCAGAGAGGCTGCCCTGCTGG + Intergenic
957746340 3:84347781-84347803 GATAGGAGAGGCTGCCATGAAGG + Intergenic
960057917 3:113288997-113289019 CAGAGGTGAGGCTGCTCCTCTGG + Exonic
961336196 3:126180990-126181012 GAAAGGAGACGCTGCCCTCCGGG + Exonic
962929439 3:140023180-140023202 GAGAGGAGAGGTTGTCTTGCAGG + Intronic
967558974 3:190895939-190895961 GATGGGAGAGGCTGCCCCAGAGG - Intergenic
968126576 3:196164372-196164394 GACAGGAGAGGTTGCCGCGGGGG - Intergenic
968618434 4:1592788-1592810 GGGAGGAGAGGCGGCCGCGGGGG + Intergenic
968987060 4:3881183-3881205 GAGAGGTGGGGCCGCACCGCTGG + Intergenic
969379105 4:6782791-6782813 CAGAGGAGAGGCGCCCCCGCCGG + Exonic
969497699 4:7535378-7535400 GGGATGAGAGGCTGACCCCCTGG + Intronic
969602204 4:8183034-8183056 CAGAGGAGAGGCTGCCCTGGGGG + Intronic
973011184 4:45075981-45076003 GAGAGGAGAAGCTGCTCAGAGGG + Intergenic
974922709 4:68261641-68261663 GAGAGAAAAGACTGCCACGCAGG + Intergenic
976559759 4:86488029-86488051 GAGAGGAGAGGAGGCCCAGATGG + Intronic
980737359 4:136907772-136907794 GAGAGGAGAGACTGCCCACCAGG - Intergenic
981214547 4:142149015-142149037 GAGAGGAGATGCTGCCTATCTGG + Intronic
982202923 4:152976149-152976171 AAGAGCAGAGGCTGCCGCGGGGG + Exonic
982342289 4:154313168-154313190 AAGAGGAAAGGGTGCCCCACTGG - Intronic
982767524 4:159365769-159365791 GAGAGGAGAGACTGCTCACCTGG + Intergenic
983379069 4:166968362-166968384 GATGGGAGAGGCTGCCACGAAGG - Intronic
983622343 4:169774567-169774589 GAGAGGACAGGCTGGCCTGAAGG + Intergenic
984466123 4:180101554-180101576 GAGAGCACAGGCTGGCCTGCAGG - Intergenic
984766688 4:183405417-183405439 GAGAGGAGGGGCTGACCCTAAGG + Intergenic
985788114 5:1910540-1910562 GAGAGGAGAGGATCCACCACTGG + Intergenic
985912705 5:2896171-2896193 GAGGGGAGAGGCTGCGCCAAGGG - Intergenic
986169455 5:5303809-5303831 GAGAGAAGAGGCAGTCCCGAGGG - Intronic
986746817 5:10752129-10752151 GAGCGGACAGGCTGCCCTGCAGG - Intronic
987099957 5:14582356-14582378 GAGAGGACACGGGGCCCCGCGGG - Intronic
990382715 5:55232558-55232580 GAGGGGGGAGGCGGGCCCGCTGG + Intronic
990819641 5:59823476-59823498 GAAAGGAGAGGCTGCCAAGCTGG - Intronic
991776305 5:70089261-70089283 GACAGGAGGGGCTGCCCCATAGG - Intergenic
991855592 5:70964708-70964730 GACAGGAGGGGCTGCCCCATAGG - Intergenic
991869603 5:71097486-71097508 GACAGGAGGGGCTGCCCCATAGG - Intergenic
992627675 5:78649205-78649227 GAGAGGCCAGGCTGCTCCGGCGG + Intronic
992678098 5:79125979-79126001 GAGAGGAGAGCTGGCCCTGCTGG + Intronic
994710407 5:103258760-103258782 GAGAGGAGAGGGTACCCGGCTGG + Exonic
996312608 5:122123732-122123754 GAGAGGAGAGGCTAACCTGGGGG + Intergenic
996738541 5:126778191-126778213 GCGCGGAGAGGCGGCCCCTCAGG + Intronic
997210644 5:132074854-132074876 GCTTGGTGAGGCTGCCCCGCAGG - Exonic
999364502 5:151013247-151013269 GCGAAGAGAGGCAGCCCCTCTGG + Intergenic
1001568191 5:172713951-172713973 GAGAGGTGAGGCTGCTCCATGGG + Intergenic
1001993587 5:176135817-176135839 GAGAGGAGGGCCTGCACCCCGGG + Intergenic
1002212474 5:177607156-177607178 GAGTGGAGGGACTGCCCCACAGG + Intronic
1002317573 5:178353611-178353633 GAGAGGAGAAGCTGCGTCCCAGG - Intronic
1002600810 5:180353139-180353161 GCGCGGAGAGGCTGCGGCGCCGG + Intronic
1002887853 6:1312120-1312142 GCGGGGAGATGCTGCCCCGGAGG + Intergenic
1003146262 6:3512971-3512993 GAGGGGAGAGGCTGCAGGGCAGG + Intergenic
1003640112 6:7869154-7869176 GTGCGGGGAGGCTGCACCGCGGG - Intronic
1005908235 6:30284244-30284266 GATGGGAGAGGCTGCCCCCAAGG + Intergenic
1006059540 6:31410249-31410271 AAGGGGAGAGGCTGCCCTGCAGG - Intronic
1006072029 6:31505320-31505342 AAGGGGAGAGGCTGCCCTGCAGG - Intronic
1006152222 6:31995692-31995714 GAGAGGAGAGGTGGCCGCTCAGG - Intronic
1006158524 6:32028430-32028452 GAGAGGAGAGGTGGCCGCTCAGG - Intronic
1006341297 6:33448598-33448620 GAGAAGAGAGGCTGGGCAGCAGG - Intronic
1006377697 6:33680674-33680696 GAGAGGAGAAGCTCACCTGCAGG - Exonic
1006448216 6:34091594-34091616 GAGGAGAGCGGCCGCCCCGCAGG + Intronic
1006599165 6:35214307-35214329 GAGGGGAGGGGGCGCCCCGCCGG - Intergenic
1006921786 6:37632415-37632437 GAGAAGAAAGGCTGCCCCCAGGG + Exonic
1007226803 6:40320943-40320965 GATAGGAGAAGCTGCACTGCAGG - Intergenic
1007282080 6:40720305-40720327 CAGAAGAGAGGCTGACCAGCTGG + Intergenic
1007787905 6:44291950-44291972 GAAAGGAGAGGCTGCCTGGGTGG - Intronic
1012369673 6:98487849-98487871 GAGTTAAGAGGCTGCCCAGCTGG - Intergenic
1014961756 6:127695243-127695265 GGGAGGTGAGCCTGCCCCCCAGG + Intergenic
1015483500 6:133742135-133742157 GAGAGAAGAACCTGGCCCGCTGG + Intergenic
1017331726 6:153207374-153207396 GAAAGGAGGGGCTGCCATGCTGG - Intergenic
1017880725 6:158560596-158560618 GGCAGGAGAGGCTGCCCGGGAGG - Intronic
1018156712 6:160991934-160991956 GAGAGAAGCCGCTGCCGCGCTGG + Exonic
1018754803 6:166839708-166839730 GAGAGGAGAGGCGGCACTGGAGG + Intronic
1018936907 6:168279637-168279659 GGGGGGAGAGGCTGCCCCCGTGG - Intergenic
1019060393 6:169253461-169253483 GAGAGGAAGGGGTGCCCGGCTGG + Intronic
1019209410 6:170393187-170393209 GAGAGGAGAGGGAACCCTGCAGG - Intronic
1019305184 7:330919-330941 GAGAGGAGAGGTTGTCCTTCAGG - Intergenic
1019390182 7:782395-782417 GTGAGGGGAGGCGGCCACGCCGG - Intronic
1019414234 7:920058-920080 GAGAGGAGAGACTGAGCCACTGG + Intronic
1019478160 7:1254027-1254049 GGCAGGCGAGGCTGCGCCGCGGG + Intergenic
1019596363 7:1860241-1860263 GGGAACAGAGGCCGCCCCGCAGG - Intronic
1020207628 7:6131153-6131175 CTGGGGAGAGGCTGCCCCTCAGG - Intronic
1020470655 7:8530692-8530714 GAGAGCAGAGGGTGCCATGCAGG + Intronic
1022625519 7:32032221-32032243 GAGAGAAGAGGCTGCCTCAAAGG + Intronic
1023867858 7:44247316-44247338 GAGAGGAGATGCTGGCCAGGAGG + Intronic
1024341177 7:48262281-48262303 GAGAGGAGTGGATGCCTGGCTGG + Intronic
1025030917 7:55556120-55556142 GAGAGCAGAGGCTGCCCTTAGGG - Intronic
1026868814 7:73838573-73838595 GAGAGGAGAGGCTCCGGAGCAGG + Intronic
1029706578 7:102279680-102279702 GAGAGGAGACGCCCCCCAGCTGG - Intronic
1032128000 7:129208707-129208729 CAGGGGTGAGGCTGCCCTGCTGG - Intronic
1032128103 7:129209207-129209229 GAGGAGAGAGTCTGCCCCACTGG - Intronic
1033314437 7:140285809-140285831 CAGAGGAGAGGCTGGCCAGGTGG - Intergenic
1033516644 7:142113287-142113309 GAGAGGAGACGCTGAGCAGCTGG + Intronic
1034356354 7:150453478-150453500 CAGGGGAGAGGCTGCACTGCAGG - Intronic
1037820035 8:22131013-22131035 GAGTGGGGAAGCTGCTCCGCCGG + Exonic
1037876752 8:22552294-22552316 GAGAGGGGAGGCGGCTCTGCTGG - Intronic
1037916115 8:22774541-22774563 GAGAGGGAAGGAGGCCCCGCAGG + Intronic
1038313882 8:26466400-26466422 GAAGGGAGAGGCTGCCAGGCTGG - Intronic
1038483236 8:27915915-27915937 GAGAGGGGAGGCAGCCCAGAAGG - Intronic
1038483247 8:27915951-27915973 GAGAGGGGAGGCAGCCCAGGAGG - Intronic
1040487145 8:47884240-47884262 GAGACAGGAGGCTGCCCTGCAGG + Intronic
1041662476 8:60413324-60413346 GAGGGAAGGGGCAGCCCCGCAGG + Intergenic
1042686290 8:71444553-71444575 GACAGGAGATGCTGCCACTCAGG + Intronic
1042785171 8:72537716-72537738 GAGAGGAGGGTCTCCCCGGCTGG - Exonic
1047782411 8:128120768-128120790 CAGAGGAGAGGCTGTCAGGCAGG + Intergenic
1048287173 8:133150972-133150994 GAGAGGAGAGCATGCCAGGCAGG - Intergenic
1049342124 8:142118802-142118824 GAGAAGAGAGGCAGCCCCCATGG - Intergenic
1049360530 8:142210628-142210650 GAGAGGAGGGGCTTGCCTGCAGG - Intergenic
1049430028 8:142557828-142557850 TAGAGCAGTGGCTGCCCCGGGGG - Intergenic
1049927218 9:421049-421071 GAGGGGAGATGATGCGCCGCCGG + Exonic
1050302007 9:4268792-4268814 CTGAGGAGATGCTGCCCAGCTGG - Intronic
1053174584 9:35912764-35912786 GAGAGGAGAGACGGCCGTGCAGG + Intergenic
1053186803 9:36023214-36023236 GAGTGGAGAGGCAGCCGCTCAGG + Intergenic
1053358173 9:37464865-37464887 GAGAGGATCTGCTGCCCTGCGGG - Intronic
1056276082 9:84995554-84995576 GGGATGAGAGGCTGTGCCGCTGG + Intronic
1056766277 9:89446587-89446609 GAGAGGGGAGGCTGCCTCCCAGG + Intronic
1058038809 9:100282276-100282298 GAGATGACAGGCTGTCCGGCTGG + Intronic
1058053662 9:100429038-100429060 GAGAGGAAAGGGTGCCCCCTTGG - Intronic
1059411602 9:114136036-114136058 GAGGGGAGAGGCTACCAAGCTGG + Intergenic
1060103171 9:120857499-120857521 GGGAGGACTGGCTGCCCCACGGG + Exonic
1060586628 9:124790655-124790677 GAGAGGATATGCTGCCTCACTGG + Intronic
1060738651 9:126082904-126082926 AAGCTGAGAGGCTGCCCCGAAGG - Intergenic
1060909886 9:127341074-127341096 GGGAAGAGAGGCAGCCCAGCTGG - Intronic
1061300173 9:129699782-129699804 CAGAGCAGAGGCTGCCCTGAAGG - Intronic
1062115419 9:134805769-134805791 GAGGGGAGGGGTTGCCCTGCAGG + Intronic
1062115453 9:134805869-134805891 GAGGAGAGAGGGTGCCCCGTGGG + Intronic
1062575500 9:137205457-137205479 GAGAGGAGACGCAGCCCCGCGGG - Exonic
1062610312 9:137370523-137370545 GAGAGACGAGGCTGTCCAGCTGG + Intronic
1187591884 X:20725754-20725776 AAGAGGAGATGCTGCTCAGCTGG + Intergenic
1188833443 X:34928672-34928694 GACAGGAGAGGCTGCCACTAAGG + Intergenic
1189324497 X:40104749-40104771 GAGAGGAGGGGTTTCCCCGCTGG - Intronic
1190302005 X:49062475-49062497 GTTCGGAGAGGCTGCCCCCCAGG + Exonic
1193346742 X:80412310-80412332 GATAGGAGAGGCTGCCACGAAGG + Intronic
1198032559 X:132767688-132767710 GAGAGGAGTGGCGGCCTGGCAGG - Intronic
1199185664 X:144912137-144912159 CAGATGAGAGGCTGCCACTCGGG - Intergenic
1201887535 Y:18902039-18902061 GAGAGGAAAGGCTGGCACGGTGG + Intergenic