ID: 1142000419

View in Genome Browser
Species Human (GRCh38)
Location 16:87661184-87661206
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2324
Summary {0: 1, 1: 1, 2: 18, 3: 259, 4: 2045}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000419_1142000430 11 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000419_1142000431 12 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110
1142000419_1142000428 6 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000419_1142000424 -4 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000419_1142000432 13 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000419 Original CRISPR GAGGTCGGAGAGGAGAGGAG AGG (reversed) Intronic