ID: 1142000420

View in Genome Browser
Species Human (GRCh38)
Location 16:87661189-87661211
Sequence GGCAGGAGGTCGGAGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1178
Summary {0: 1, 1: 0, 2: 5, 3: 108, 4: 1064}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000420_1142000430 6 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000420_1142000424 -9 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000420_1142000428 1 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000420_1142000432 8 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000420_1142000431 7 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000420 Original CRISPR GGCAGGAGGTCGGAGAGGAG AGG (reversed) Intronic
900032246 1:380430-380452 GGCAGGAGGTGGGTGGGGACCGG + Intergenic
900206880 1:1435398-1435420 GGCTGGGGGTCGGAGAGGGGTGG + Intronic
901018592 1:6245033-6245055 GGGAGGGGGAGGGAGAGGAGGGG - Intronic
901203352 1:7479345-7479367 GGCAGGAGAACTGAGAGGGGAGG - Intronic
901256709 1:7834982-7835004 GGCAGGAGGAAGGTGAGGAGGGG + Intronic
901286831 1:8087097-8087119 GGCAGGAGGGAGGAAAGGAGGGG - Intergenic
901535840 1:9882649-9882671 AGCAGGAAGCAGGAGAGGAGGGG + Intronic
901629775 1:10642482-10642504 GGCAGGAGGAGAGAGAGGCGGGG + Intronic
901842865 1:11964778-11964800 GGCAGCAGGTCAGCCAGGAGCGG + Exonic
902150296 1:14437617-14437639 GGCAGGGGAAGGGAGAGGAGAGG - Intergenic
902171302 1:14613694-14613716 GGCAGCAGGTTGGAGATGTGTGG + Intronic
902398268 1:16144051-16144073 GGCTGGAGGCAGGACAGGAGCGG - Intronic
902784696 1:18725408-18725430 GGCGGGAGGAAGGAGAGGGGAGG - Intronic
903149739 1:21398309-21398331 GTCAGGAGGCCGGGGAGGGGTGG - Intergenic
903849886 1:26299741-26299763 GGCTGGGAGTGGGAGAGGAGGGG + Intronic
903864564 1:26388871-26388893 GGCAGGAGAGGGGACAGGAGGGG - Intergenic
903907830 1:26697942-26697964 GGCCGGGGGACGGAGAGGAGCGG - Intronic
903944090 1:26951024-26951046 GGCAGGAGACAGCAGAGGAGAGG + Intronic
904045801 1:27607475-27607497 GGCAGGGGGTGTGGGAGGAGAGG + Intergenic
904282060 1:29427558-29427580 GACAGGAGGTCAGAGAGATGGGG - Intergenic
904321728 1:29702118-29702140 GGAAGGTGGTGGGAGGGGAGAGG - Intergenic
904466066 1:30708140-30708162 GGAAGGAGGTTGGGAAGGAGGGG + Intergenic
904624627 1:31795512-31795534 GAGAGGAGGTGGGAGGGGAGGGG - Intronic
904686846 1:32266738-32266760 GGGAGGAGGGGGAAGAGGAGGGG - Intronic
904686871 1:32266785-32266807 GGGAGGAGGGGGAAGAGGAGGGG - Intronic
904873218 1:33634830-33634852 AGCAGGAGGGAGGAGAGGAATGG - Intronic
905119456 1:35670627-35670649 GGCAAGAGCAAGGAGAGGAGGGG - Intergenic
905248459 1:36630732-36630754 TCCAGGAAGTCGGAGAGGTGGGG - Intergenic
905471309 1:38194135-38194157 GGCTGGAGCTTGGAGAGCAGGGG + Intergenic
905581000 1:39082362-39082384 AGCAGGTGGTCTGAGAGGAGGGG + Intronic
906508655 1:46398287-46398309 GGCAGAAGGGAGGAGAGGCGGGG - Intronic
906520450 1:46464107-46464129 GGGAGGAGGGAGAAGAGGAGGGG - Intergenic
906606158 1:47173810-47173832 GGCTGGGGGTCTGAGTGGAGTGG - Intergenic
906659639 1:47573308-47573330 GGCAGGAGGGAGGAGAGGGAGGG - Intergenic
906798981 1:48719653-48719675 GGCAAGAGGTGGAAGAGGATAGG - Intronic
907012674 1:50978056-50978078 GGCAGGAGGCGGGAGCGGGGGGG + Intergenic
907248761 1:53123974-53123996 AGCAGGAGGAGGCAGAGGAGCGG - Intronic
907255119 1:53173378-53173400 GGGAGGAGAGGGGAGAGGAGAGG - Intergenic
907403325 1:54238930-54238952 GGCAGGGGGTGGGAGAGGAAGGG - Intronic
907418355 1:54329867-54329889 GGCTGGAGTACGGAGGGGAGAGG + Intronic
907560786 1:55385667-55385689 GGAAGGAGGGAGGAGAGGGGAGG - Intergenic
907799385 1:57749700-57749722 GGCAGGAGATGGAAGAGGATGGG + Intronic
908438319 1:64128822-64128844 GGCATGAGGTCAGAGAGGCAAGG + Intronic
909177226 1:72376672-72376694 GGAAGGAGGTGAGAGAGAAGAGG - Intergenic
909686523 1:78355115-78355137 GGGAGGAGGAGGAAGAGGAGAGG - Intronic
910012785 1:82486201-82486223 GGCAGGATCTTGGGGAGGAGAGG + Intergenic
910631976 1:89364658-89364680 GGGAGGGGGTGGGGGAGGAGGGG + Intronic
911011593 1:93287117-93287139 GCCTGGAGATGGGAGAGGAGTGG - Intergenic
911045903 1:93628177-93628199 GACATGAGGTGGGAGAAGAGAGG - Intronic
911096611 1:94060318-94060340 GGCAGGAAGTGGGAGATGGGAGG + Intronic
911224653 1:95291746-95291768 GGTAGGAGGTGGTATAGGAGAGG + Intergenic
911871879 1:103108731-103108753 GCGAGGAGGGAGGAGAGGAGTGG - Intergenic
912098024 1:106169248-106169270 GTCAGGTGGTGGGAGAGGGGAGG + Intergenic
912761081 1:112368114-112368136 GGTAGGAGGTGGGAGGGGAGAGG - Intergenic
913059690 1:115193720-115193742 GGCAGAAGGTGAGAGTGGAGAGG - Intergenic
913489764 1:119368096-119368118 GGCAAGAGCTGGGGGAGGAGTGG + Intergenic
913688985 1:121260433-121260455 GAGATGAGGTCAGAGAGGAGAGG + Intronic
914148613 1:145019842-145019864 GAGATGAGGTCAGAGAGGAGAGG - Intronic
914706940 1:150177925-150177947 GGAGGGAGGTGGGAGAGTAGTGG - Intergenic
914994825 1:152534365-152534387 GGCAGGAGGCCCGACGGGAGCGG - Intronic
915152052 1:153841437-153841459 GGCAGGAGATGGGAGGGGATAGG - Intronic
915450564 1:156002322-156002344 GGCAGGAGGTAGAAGAAGACTGG - Intronic
915526021 1:156476774-156476796 GGCAGGAGGTGAGAGAGAAGTGG - Intronic
915555952 1:156660926-156660948 GGCAGAAGGTGGGGGAGGTGAGG - Intergenic
915637340 1:157195881-157195903 GCCAGGAAGTGGGAGAGGACAGG - Intergenic
915911423 1:159918009-159918031 GGAAGGAGGGCAGAGATGAGAGG - Intergenic
916082177 1:161240954-161240976 GGAAGGATGTAGGGGAGGAGAGG + Intergenic
916759510 1:167803827-167803849 GGGAGGAGAAAGGAGAGGAGGGG - Intergenic
917027858 1:170662238-170662260 GGCAGGAGGACAGAGAGGGGCGG - Intergenic
917223684 1:172759219-172759241 GGCAGAAGGTGAGAGAGGAGAGG - Intergenic
917386614 1:174483262-174483284 GGCAGGGGGTGGGAGAGAAGTGG - Intronic
917738442 1:177940742-177940764 GGCAGAAAGTAAGAGAGGAGAGG + Intronic
918198912 1:182248685-182248707 GGTGGGAGGAGGGAGAGGAGCGG - Intergenic
919816384 1:201443398-201443420 GGCAGGAGGGGAGAGAGGTGTGG + Intergenic
919988837 1:202694777-202694799 AGGAGGAGGAGGGAGAGGAGAGG - Intronic
920418508 1:205813871-205813893 CACCTGAGGTCGGAGAGGAGGGG + Intergenic
920476309 1:206278920-206278942 GAGATGAGGTCAGAGAGGAGAGG + Intronic
920654892 1:207867904-207867926 GGTAGGAGGACAGAGAGGAGGGG - Intergenic
920666457 1:207966102-207966124 GGCAGGAGGTGAGACAGGAGGGG + Intergenic
920704534 1:208242049-208242071 GCCTGGAGGTCAGAGGGGAGAGG + Intronic
920728377 1:208459277-208459299 GTCAGGAGGTAGGAGAGGACTGG - Intergenic
921097415 1:211899237-211899259 GTGAGGAGGTGGGAGATGAGAGG - Intergenic
921218455 1:212956307-212956329 GGCAGGAGGAGGGAGTGGAGTGG - Intronic
921458179 1:215396652-215396674 GGTAGAAGGTGGGATAGGAGAGG + Intergenic
921734529 1:218612145-218612167 GGAAGGAGGTCCAGGAGGAGGGG - Intergenic
922460520 1:225811437-225811459 GGCTGGAGGTGGGAGGTGAGGGG + Intronic
922465855 1:225845349-225845371 GGCAGGCGGGGGGAGAGGGGTGG - Exonic
922905060 1:229168048-229168070 GGAAGGAGGAGGAAGAGGAGGGG + Intergenic
922937636 1:229433977-229433999 GGCAGGAGTTGGGAGGGGACAGG - Intronic
923006654 1:230055288-230055310 TGCAGGAGGTTGGCGAGGTGGGG - Intergenic
923036164 1:230286674-230286696 GGCAGGAGGGCGGGTAGGATGGG + Intergenic
923266740 1:232321673-232321695 AGGAGGAGGTGGAAGAGGAGGGG - Intergenic
923360206 1:233203768-233203790 AGGAGGAGGTGGCAGAGGAGAGG - Intronic
923482516 1:234397597-234397619 GGGAGGAGGTGGGGGAAGAGGGG + Intronic
923482525 1:234397617-234397639 GGGAGGAGGTGGGGGAAGAGGGG + Intronic
923482598 1:234397771-234397793 GGGAGGAGGCGGGGGAGGAGGGG + Intronic
923516810 1:234704528-234704550 GGCTGGAGGTCTCAAAGGAGGGG + Intergenic
923534478 1:234838271-234838293 GGAAGGAGAGGGGAGAGGAGGGG + Intergenic
1062857233 10:785383-785405 GGCAGGAGAGCGGGCAGGAGGGG - Intergenic
1063491817 10:6471014-6471036 AACAGGAGGTCAGAGAGGGGTGG + Intronic
1063722824 10:8601650-8601672 GGCAGAAAGTAGAAGAGGAGTGG - Intergenic
1064208949 10:13347740-13347762 GGAGGGAGGGCGGGGAGGAGCGG - Intronic
1064221109 10:13440629-13440651 GGCAGGTGCCCGGCGAGGAGTGG + Intronic
1065003753 10:21361183-21361205 GACAGGAGGAAGGAGAGCAGGGG + Intergenic
1065286752 10:24194306-24194328 GGGAGGAGAGGGGAGAGGAGGGG - Intronic
1065712707 10:28533053-28533075 GGCCGAGGGTGGGAGAGGAGGGG + Intronic
1065748315 10:28862113-28862135 GGGAGGAGGAGAGAGAGGAGAGG + Intronic
1065845804 10:29742281-29742303 GGCAGAAAGTAGAAGAGGAGTGG - Intergenic
1065856979 10:29838900-29838922 TGCAGGAGGGAGGAGGGGAGGGG + Intergenic
1065967058 10:30779091-30779113 GGGAGGAGGAAGGGGAGGAGGGG + Intergenic
1066067549 10:31773393-31773415 GCCAGGAAGTCGGAAAGCAGAGG + Intergenic
1066221862 10:33343055-33343077 GGAAGGAGGAGGAAGAGGAGGGG + Intergenic
1066384313 10:34929247-34929269 GGGAGGAGGAAGAAGAGGAGGGG - Intergenic
1067020515 10:42792776-42792798 GACAAGAGGTCAGAGAAGAGGGG - Intronic
1067062941 10:43087271-43087293 GGCTGGAGGTCCAAGAGGAGAGG + Intronic
1067090128 10:43262215-43262237 GGCGGGAGCTGGGAGAGGAGAGG - Intronic
1067146582 10:43698665-43698687 GGCAGGAGGAGGGCGAGAAGAGG - Intergenic
1067184439 10:44014999-44015021 GGTAGGAGGTGGGGGCGGAGTGG - Intergenic
1067190872 10:44067075-44067097 GTGAGGAGGAGGGAGAGGAGAGG + Intergenic
1067438124 10:46292982-46293004 GGAGGGATGACGGAGAGGAGAGG + Intronic
1067561099 10:47305181-47305203 GGCAGGAGGTCAGGGAGCAAGGG + Intronic
1068244308 10:54343645-54343667 GGGGGGAGGTGGGAGGGGAGAGG + Intronic
1068435744 10:56989044-56989066 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1068681263 10:59822942-59822964 AGCTGGAGGTTGGAGAGAAGCGG + Intronic
1069059175 10:63875922-63875944 GGTGGGAGGAGGGAGAGGAGCGG - Intergenic
1069226471 10:65951618-65951640 GGTGGGAGGTAGGAGAGGAGTGG - Intronic
1069605682 10:69737371-69737393 GCCAGGAGGTTGTAGTGGAGTGG - Intergenic
1069679731 10:70275393-70275415 GGCTTAAGGTGGGAGAGGAGGGG + Intronic
1069720118 10:70544495-70544517 GGCAGGAGCTGAGTGAGGAGGGG + Intronic
1069806769 10:71131190-71131212 GACAGCAGGACGGAGCGGAGTGG - Intergenic
1070341006 10:75498592-75498614 GGATGGAGTTCAGAGAGGAGCGG + Intronic
1070358024 10:75659322-75659344 GGCAGGAAGACAGAGAGAAGGGG - Intronic
1070711861 10:78688976-78688998 AGGAGGAGGAAGGAGAGGAGAGG - Intergenic
1070772395 10:79090037-79090059 GGCAGGATGAGGGAGAGGTGGGG - Intronic
1070916835 10:80160592-80160614 GGGAGGAGGACGCAGAGGAAGGG - Intronic
1070942124 10:80357075-80357097 GGGAGGGGGCCAGAGAGGAGGGG + Intronic
1071233077 10:83611727-83611749 GGAAGGAGGACGAAGAGTAGGGG + Intergenic
1071326401 10:84523086-84523108 GGCAGGAGGCAGCAGAGCAGTGG - Intergenic
1071717278 10:88110085-88110107 GTCAGGAGCTGGGGGAGGAGAGG + Intergenic
1072101240 10:92231472-92231494 AGGAGGAGGTGGGAGGGGAGAGG - Intronic
1072195729 10:93116019-93116041 GGCAGGAGGAGGAGGAGGAGGGG + Intergenic
1072914809 10:99531270-99531292 GTCGGGAGGTGGGAGAGGCGGGG - Intergenic
1072966919 10:99981781-99981803 GGCAGGAGGTCTGAAGGCAGAGG + Intronic
1073132649 10:101200160-101200182 GGCAGGAGGTGGGTGAAGAGAGG - Intergenic
1073148872 10:101298305-101298327 GGCAGCAGGCAGGGGAGGAGAGG + Intergenic
1073352662 10:102831020-102831042 GGCAGGAGGGAGGAGAGGCATGG + Intronic
1073553581 10:104426408-104426430 GGAAGGAGGTGTGGGAGGAGGGG - Intronic
1073605825 10:104894787-104894809 GGGAGGAAGTGGGGGAGGAGAGG + Intronic
1074051210 10:109882770-109882792 GGCAGGATTTGGGAAAGGAGTGG - Intronic
1074088198 10:110224685-110224707 GGCTGGAGGCCGGAGTGCAGTGG + Intronic
1074130349 10:110568070-110568092 GGCAGGATCTCCGAGAGGTGTGG + Intronic
1074188857 10:111118458-111118480 GGAAGGAGGTGGGAGGGAAGTGG - Intergenic
1074533585 10:114313119-114313141 GGCAGCAGGAAGGAGGGGAGGGG + Intronic
1074916004 10:117955619-117955641 GGCAGAAGCTAGGAGTGGAGAGG - Intergenic
1075031912 10:119029658-119029680 GGCCGGGGGGCGGGGAGGAGTGG + Intergenic
1075087359 10:119422561-119422583 GGGAGGAGGGTGGTGAGGAGGGG - Intronic
1075850653 10:125584047-125584069 GGCAGCAGCTCGAAGAGGACAGG - Intronic
1076202519 10:128569693-128569715 GGCAGGCTGTCGGGGAGGAGCGG + Intergenic
1076290079 10:129339339-129339361 GGCTGGAGGTGGGTGTGGAGGGG + Intergenic
1076319024 10:129564667-129564689 AGGAGGAGGAAGGAGAGGAGGGG - Intronic
1076618252 10:131770922-131770944 GGCAGGAGGTAGGAGAGGGGCGG + Intergenic
1076713788 10:132353158-132353180 AGCAGGAGGTCGAGGAGGAAGGG + Intronic
1076714681 10:132357644-132357666 GGGAGGGGGGCGCAGAGGAGGGG + Intronic
1076732854 10:132446993-132447015 GGCAAGAGGAGGGACAGGAGAGG + Intronic
1077048149 11:555192-555214 GGGAGGAGAGCGGAGGGGAGGGG + Intronic
1077164349 11:1128583-1128605 GGCAGGAGGCTGGGGAAGAGCGG - Intergenic
1077248288 11:1549573-1549595 GACAGAGGGTGGGAGAGGAGGGG - Intergenic
1077340672 11:2025015-2025037 GGCAGGGAGAGGGAGAGGAGGGG - Intergenic
1077371986 11:2186640-2186662 AGCAGAAGGACGCAGAGGAGGGG - Intergenic
1077557128 11:3231167-3231189 TGCAGGAGGTGAGATAGGAGAGG - Intronic
1078159600 11:8829233-8829255 AAGAGGAGGTGGGAGAGGAGTGG + Intronic
1078548907 11:12267145-12267167 GGCAGGTGGTGGGAGGGAAGGGG - Intergenic
1078604172 11:12760472-12760494 GGCAAGAGGTAGGAGAGGAAGGG - Intronic
1078605841 11:12774879-12774901 GGTAGGAGGAGGGAGAGGATTGG + Intronic
1078726992 11:13940508-13940530 GGCAGGGGGTCAGAGAGCACAGG + Intergenic
1078807970 11:14725539-14725561 GGCAGGAGGAGGGAGAGGGGAGG - Intronic
1078866474 11:15302560-15302582 GGCAGGGGAGCTGAGAGGAGAGG - Intergenic
1079812541 11:25013232-25013254 GGGAGGAGGATGAAGAGGAGTGG + Intronic
1080454939 11:32409832-32409854 TGAAGGAGGTGGGAGAGAAGGGG - Intronic
1080497046 11:32830188-32830210 GGCAGGACCTCGGCGGGGAGGGG + Intronic
1080862938 11:36166013-36166035 GAGAGGAGGGAGGAGAGGAGAGG - Intronic
1081031397 11:38088708-38088730 GGCTGGAGGCTGGAGAGCAGTGG - Intergenic
1081391962 11:42539916-42539938 GGTAGGAGGTAGGAGGGGAGTGG + Intergenic
1081634846 11:44714197-44714219 GGCAGGGGGTCGGGGAGGTAGGG + Intergenic
1081763178 11:45591370-45591392 GGCTGGAGGATGGAGAGGAAGGG - Intergenic
1081805652 11:45888737-45888759 GGCTGGAGGTTGGAGTGCAGTGG + Intronic
1081864821 11:46353711-46353733 GGTGAGAGGTCTGAGAGGAGAGG + Intronic
1082761163 11:57128218-57128240 GGTAAGAGGAGGGAGAGGAGTGG - Intergenic
1083194060 11:61072525-61072547 GGCAGAAGATCAGGGAGGAGGGG - Intergenic
1083224598 11:61276886-61276908 GGGAGGGGGAGGGAGAGGAGAGG + Intronic
1083260041 11:61517956-61517978 GGCCGGGGGTGTGAGAGGAGAGG - Intronic
1083799560 11:65038665-65038687 GGCAGGAGGAGGAAGAGGATGGG + Exonic
1083804718 11:65066938-65066960 AGCAGGAGGTGGGAGGGGTGGGG - Intronic
1083876267 11:65525766-65525788 GGCAGGAGGGGAGACAGGAGTGG - Intronic
1083906213 11:65673072-65673094 GACAGCAGGTTGGAGAGGACAGG - Intergenic
1084042010 11:66547728-66547750 GGCCATAGGTCGGGGAGGAGGGG + Intronic
1084091567 11:66882391-66882413 GGCAAGAGGCCGCAGAGGAAGGG + Intronic
1084104914 11:66975056-66975078 GGAGGGAGGGGGGAGAGGAGGGG + Intergenic
1085038863 11:73315386-73315408 GGGAGGGGGTCTGAGTGGAGAGG - Intronic
1085277961 11:75312096-75312118 TGCAAGAGATGGGAGAGGAGAGG - Intronic
1085302508 11:75466843-75466865 GTCAGCAGGTAGGGGAGGAGTGG + Intronic
1085323888 11:75592157-75592179 GGGAGGAGGTGGGAGCTGAGCGG - Intronic
1085502666 11:77037988-77038010 GGGAGGAGGAGGGGGAGGAGGGG + Intronic
1085672170 11:78477350-78477372 GGCAGGAGCTTTGAGAGGAAGGG - Intronic
1085870790 11:80347125-80347147 GGCTAGATGTCGGAGAGAAGTGG - Intergenic
1086080890 11:82901319-82901341 GGCAGGAGGCAGGAGGGGGGTGG - Intronic
1087094625 11:94307211-94307233 GCCAGGAGGACTGTGAGGAGTGG + Exonic
1087906997 11:103709945-103709967 GTCAGGAGGTGGGGGTGGAGGGG - Intergenic
1088466708 11:110147446-110147468 GTCAGGGGGTCGGAGGGAAGGGG + Intronic
1088745907 11:112804663-112804685 GGCAGAAGGTTGGAGAGATGGGG + Intergenic
1088990360 11:114948386-114948408 CACAGGATGTGGGAGAGGAGGGG + Intergenic
1089145605 11:116327803-116327825 GGGAGGAGATGGGAGAGGAGAGG - Intergenic
1089302042 11:117504656-117504678 GGGCGGAGATGGGAGAGGAGAGG + Intronic
1089321885 11:117631935-117631957 AGGAGGAGGTCTTAGAGGAGCGG + Intronic
1089509163 11:118985004-118985026 GGCAGGAGGGAAGAGCGGAGAGG - Intergenic
1089667265 11:120028462-120028484 GGCGGGAGATGGAAGAGGAGAGG + Intergenic
1089763165 11:120743432-120743454 GGTAGGAGAAGGGAGAGGAGTGG + Intronic
1090128667 11:124116632-124116654 GGCAGGTGTGAGGAGAGGAGAGG - Exonic
1090299950 11:125626419-125626441 GGAAGGAGGAGGGAGAGGTGGGG - Intronic
1090364289 11:126193006-126193028 GGCTGGAGGTCTGGGATGAGGGG + Intergenic
1090726321 11:129530416-129530438 AGCTGGAGGGGGGAGAGGAGAGG + Intergenic
1090867329 11:130713274-130713296 GGGAGGCGGTGGGACAGGAGAGG - Exonic
1091225143 11:133952461-133952483 GGCTGCAGCACGGAGAGGAGTGG + Intronic
1091251162 11:134145460-134145482 GGTGGGAGGTGGGGGAGGAGAGG + Intronic
1202823657 11_KI270721v1_random:80204-80226 GGCAGGGAGAGGGAGAGGAGGGG - Intergenic
1091828744 12:3534453-3534475 GGAAAGAGGTGGTAGAGGAGAGG - Intronic
1092072328 12:5641637-5641659 GGCAGGAGCTGGGAGCAGAGTGG - Intronic
1092103165 12:5902667-5902689 GGGAGGAGGGGGGAGGGGAGGGG + Intronic
1092103177 12:5902687-5902709 GGGAGGAGGGGGGAGGGGAGGGG + Intronic
1092167945 12:6354562-6354584 GGGAGGAGGGTGGAGAGGAGAGG + Intronic
1092217590 12:6694007-6694029 GGAAGGAGGGAGGAAAGGAGGGG + Exonic
1092288369 12:7143106-7143128 GCCAGGAGGTGGCAGAGGAAGGG - Intronic
1092860801 12:12717588-12717610 AGCGGGAGGGCGGAGAGGAGAGG - Exonic
1092892229 12:12979589-12979611 CGCAGGAATTCGGAGAGCAGTGG - Intronic
1093608627 12:21126587-21126609 GGAAGGAGGTTGGGGAAGAGGGG + Intronic
1094021414 12:25918043-25918065 GGAAGGAGGGCAGAGAGGGGAGG + Intergenic
1094447757 12:30550212-30550234 AGCAGGAGGAGGAAGAGGAGGGG - Intergenic
1095290376 12:40472816-40472838 GGGAGGAGGAGGAAGAGGAGGGG - Intronic
1095961075 12:47834761-47834783 GACTGGAGGTGGTAGAGGAGTGG - Intergenic
1096154251 12:49332994-49333016 GGCAGGAGGTGGGTGAGGACGGG + Exonic
1096170249 12:49462801-49462823 GTCAGGATGTCGGAGAGAAGTGG - Intronic
1096677896 12:53235314-53235336 GGGAGGAGGTGGGAGAGGAGAGG - Intergenic
1098189392 12:67932035-67932057 CGTAGGGGCTCGGAGAGGAGAGG - Intergenic
1098545631 12:71708024-71708046 GGCAGGAGAGCAGAGCGGAGCGG - Intergenic
1098887866 12:75978398-75978420 GGCTGGGGGTGGGAGTGGAGTGG + Intergenic
1100457577 12:94767402-94767424 GGCAGGGGGTGGGACAGGGGTGG + Intergenic
1100479667 12:94965833-94965855 GGGAGGAGAGGGGAGAGGAGAGG + Intronic
1100868597 12:98886001-98886023 GGCAGGAGGAGGGAAAAGAGAGG + Intronic
1100877432 12:98976588-98976610 TGCAGGTGCTGGGAGAGGAGAGG + Intronic
1101238504 12:102814128-102814150 GGCAGGGGGTTGGGGAGGAGAGG - Intergenic
1101732651 12:107439547-107439569 GGCAGGGGGAAGGAGAGGTGGGG - Intronic
1101850339 12:108396891-108396913 GGAAGGAGGAAGGAGATGAGCGG + Intergenic
1101913105 12:108875480-108875502 GGAAGGAGGAGGGAGTGGAGGGG - Intronic
1101986381 12:109450671-109450693 GGAAGGAGGCTGAAGAGGAGCGG + Exonic
1102287959 12:111674633-111674655 GGCAGCAGGTCGGGGTGGAGAGG + Intronic
1102479412 12:113211008-113211030 GGCAGAAATTGGGAGAGGAGAGG + Intronic
1102601923 12:114037725-114037747 GGGTGGAGGTGGGAGAGAAGGGG + Intergenic
1102745151 12:115243715-115243737 GGCAGGGGAGCGGAGGGGAGGGG + Intergenic
1102895383 12:116594479-116594501 GGCAGGAGGCAGGGGAGGTGGGG + Intergenic
1102898702 12:116619435-116619457 GGAGGGAGGTCAGAGAGGAAAGG + Intergenic
1103001034 12:117385445-117385467 GGAAGCAGATCAGAGAGGAGAGG - Intronic
1103282465 12:119771378-119771400 TGCAGGAGGAAGGACAGGAGAGG + Intronic
1103290218 12:119839480-119839502 GGCATGAGGGAGGAGAGAAGGGG + Intronic
1103606179 12:122087619-122087641 GGCAGGAGGTAAGATAGAAGAGG + Intronic
1103893766 12:124259740-124259762 GGCAGGCGGCCGGGGAGGGGCGG - Intronic
1104054254 12:125217251-125217273 GGCAGGAGGGTGGGGAAGAGAGG + Intronic
1104302282 12:127575382-127575404 AGCAGAAGGTGGGAGAGGCGAGG - Intergenic
1104651044 12:130534239-130534261 GGGAGGTGGTGGGAGGGGAGTGG + Intronic
1104816586 12:131649715-131649737 AGGAGGAGGACAGAGAGGAGAGG - Intergenic
1104816602 12:131649791-131649813 AGGAGGAGGACAGAGAGGAGAGG - Intergenic
1104915708 12:132263441-132263463 GGCTGCAGGTTGGAAAGGAGAGG + Intronic
1104930628 12:132337600-132337622 GGAAGGAGTTAGGAGAGAAGAGG + Intergenic
1105514181 13:21075990-21076012 GGCCGGAGGGGTGAGAGGAGCGG - Intergenic
1105675852 13:22671118-22671140 GGCAAGAGGTCGGAGAAGATGGG - Intergenic
1106075489 13:26457358-26457380 AGGAGGAAGTGGGAGAGGAGGGG - Intergenic
1106211812 13:27655842-27655864 GGCAGGAGGAAGGAAGGGAGTGG + Intronic
1106415620 13:29543688-29543710 CGCAGGAGGAGGGAGAGGGGTGG + Intronic
1106587047 13:31066718-31066740 GAAAGGTGGTCTGAGAGGAGAGG + Intergenic
1107748886 13:43543089-43543111 TGCATGAGGGCTGAGAGGAGGGG + Intronic
1108559500 13:51628380-51628402 GCCAGGAGGTGGGAGAGGCCAGG + Intronic
1108700525 13:52940341-52940363 GGAAGGGGGTGGGAGTGGAGAGG + Intergenic
1110358313 13:74595360-74595382 GGGAGGAGGGGGGAGGGGAGGGG - Intergenic
1112476009 13:99731107-99731129 GGCGGGGGCTTGGAGAGGAGAGG + Intronic
1112571664 13:100598810-100598832 GAAAGGAGGGAGGAGAGGAGAGG - Intergenic
1112572939 13:100610255-100610277 GGCAGGATGTCCCAGAGAAGAGG - Intronic
1113618248 13:111695959-111695981 GGCAGGAGGTGTGAGACGAGGGG - Intergenic
1113623779 13:111781220-111781242 GGCAGGAGGTGTGAGACGAGGGG - Intergenic
1113811888 13:113147678-113147700 GGGAGGAGGACGGGGAGGGGAGG + Intronic
1113854842 13:113437460-113437482 GGCAGGAGGACGGATTGCAGAGG - Intronic
1113901884 13:113802227-113802249 GGCAGGAGGAGGGAGGGAAGGGG + Intronic
1113964580 13:114145483-114145505 GGCAGGAGGAAGGAGGGCAGGGG + Intergenic
1114519766 14:23325765-23325787 GGCAGGGAGCCGGAGAAGAGGGG - Exonic
1114538993 14:23440997-23441019 GCCATGAGGTTGGAGAGAAGAGG + Intergenic
1114665060 14:24372732-24372754 GGCTGGAGTTGGGGGAGGAGGGG + Intronic
1115469539 14:33754436-33754458 AACATGAGGTCAGAGAGGAGAGG - Intronic
1115498198 14:34027264-34027286 GGGAGGAGGAGGGGGAGGAGAGG + Intronic
1115498208 14:34027286-34027308 GGGAGGAGGAGGGAGAGGGGAGG + Intronic
1117169755 14:53081898-53081920 GGAAGGAGAAGGGAGAGGAGGGG + Intronic
1117342166 14:54801872-54801894 GGTAGGAGGAGGGAGAGGATCGG + Intergenic
1117858041 14:60056069-60056091 GGCAGAAGGTCAGAGAGAAGGGG - Intronic
1117953859 14:61107886-61107908 GGCAGGAGGTCACAGAGCAGAGG + Intergenic
1118774166 14:68963021-68963043 GGCAGGAGGTGAGTGAGGAGTGG - Intronic
1119038004 14:71246743-71246765 GGCAGGAAGTGGGTGAGGGGAGG + Intergenic
1119182415 14:72613960-72613982 GGCAGGGGGAAGGAGGGGAGAGG - Intergenic
1119213723 14:72852062-72852084 GGCAGGAAGTTGAAGAGGAGAGG + Intronic
1119505289 14:75167467-75167489 GGCATGAGGACAGAGAGGAGAGG - Intronic
1119713854 14:76844354-76844376 GGCAGGGGGTGGGAGAGGAAGGG + Intronic
1119738175 14:76997363-76997385 GGTGGGAGGTGGGAGGGGAGAGG - Intergenic
1119872293 14:78028132-78028154 GGGAGGAGAGGGGAGAGGAGGGG - Intergenic
1120699793 14:87686475-87686497 GGGAGGAGGTGTAAGAGGAGGGG - Intergenic
1121052932 14:90831165-90831187 GGGAGGAGGCCTGAGAAGAGGGG - Intergenic
1121055164 14:90846073-90846095 AGCGGGAGCTCAGAGAGGAGAGG - Intergenic
1121258948 14:92552539-92552561 GGCAGGAGGTGAGAGCAGAGGGG - Intronic
1121358012 14:93231283-93231305 GACAGGAGGCAGGAGGGGAGGGG + Intergenic
1121447459 14:93988002-93988024 GGAAGGAGGAGTGAGAGGAGGGG + Intergenic
1121777104 14:96598230-96598252 GAGAGGAGGGGGGAGAGGAGAGG - Intergenic
1121813612 14:96912699-96912721 GGAAGGGGGATGGAGAGGAGAGG + Intronic
1121850550 14:97218468-97218490 AGCAGGTGTTTGGAGAGGAGGGG - Intergenic
1121860238 14:97310532-97310554 GGCAGGGGAGGGGAGAGGAGGGG - Intergenic
1122139100 14:99651688-99651710 GACAGGAGGCTGGAGAGGTGGGG + Intronic
1122417103 14:101555268-101555290 GGAGAGAGCTCGGAGAGGAGAGG - Intergenic
1122633322 14:103118129-103118151 AGAAGGAAGTCGGGGAGGAGAGG - Intergenic
1122651337 14:103228752-103228774 GGCAGGAGGATGCAGGGGAGGGG + Intergenic
1123049608 14:105534677-105534699 GTCAAGAGGTGGGTGAGGAGAGG + Intergenic
1124165133 15:27319603-27319625 GACAGGAGGATGGAGAGGACTGG + Intronic
1124696848 15:31870666-31870688 GGGAGGAGGCGGGGGAGGAGAGG - Intronic
1125242240 15:37588597-37588619 GGCAGGAGGTAAGGGAGAAGTGG - Intergenic
1125335492 15:38622476-38622498 GGTAGGAGGTTGGCGAGGACAGG + Intergenic
1125482336 15:40089202-40089224 GGGTGGAGGTCGGGGGGGAGGGG + Exonic
1125701486 15:41689334-41689356 GGAAGGAGGAGGGAGAAGAGAGG - Intronic
1125760115 15:42090583-42090605 TGCAGGAGGTCAGAGAGAAGAGG + Intronic
1125760483 15:42092957-42092979 TGCAGGAGGTCAGAGAGAAGAGG + Intronic
1126408306 15:48345490-48345512 TGCTGGAGGTAGGAGAGGGGAGG - Intergenic
1127547429 15:60004199-60004221 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
1127565432 15:60183687-60183709 GGCAGGAGGTCAGGGACGTGGGG + Intergenic
1127841925 15:62839222-62839244 GGCAGGAAGAGGGAAAGGAGGGG + Intronic
1127873637 15:63093652-63093674 AGCAGGAGGTCAGAGATGAAAGG + Intergenic
1128146707 15:65335997-65336019 GGCAGAAGGTAGGAGAGAATGGG + Intronic
1128341710 15:66826866-66826888 GCCAGGGGCTGGGAGAGGAGAGG + Intergenic
1128690880 15:69723965-69723987 GGCAGAAGTCCGGAGAGGAGAGG + Intergenic
1128705002 15:69832237-69832259 GGGAGGGGGCAGGAGAGGAGAGG + Intergenic
1128940876 15:71786765-71786787 GGGGGGAGGAGGGAGAGGAGGGG + Intergenic
1129154414 15:73709050-73709072 GGCTGGAGGTTGGGAAGGAGAGG + Intronic
1129254199 15:74324953-74324975 AGGAGGAGGTGGGGGAGGAGGGG - Intronic
1129305335 15:74656854-74656876 GGCTGGATGTCAGAGAGAAGTGG + Intronic
1129341486 15:74889439-74889461 GTGAGGAGGTCAGAGAAGAGAGG - Intergenic
1129450241 15:75647560-75647582 GACAGGCGGAGGGAGAGGAGGGG + Intronic
1129743872 15:78004405-78004427 GGCAGGAGGGCTGGGAGGTGAGG + Intronic
1130579681 15:85124795-85124817 GGCATGAGGTCAGCCAGGAGTGG - Intronic
1130661371 15:85833766-85833788 GGCAGGTGGGCGGAGAGGCTGGG + Intergenic
1130959824 15:88652389-88652411 GGGAGGAGGAGGGGGAGGAGGGG - Intronic
1130995580 15:88902011-88902033 GGCAGGAGGTGGTGGAGCAGGGG - Intronic
1131628239 15:94147425-94147447 GTCAGGAGGCAGGAGAAGAGAGG + Intergenic
1131870317 15:96756962-96756984 AGCAGGAGGAGGAAGAGGAGGGG + Intergenic
1132519647 16:381430-381452 GGGAGGAGGAGGGAGGGGAGGGG + Intronic
1132722673 16:1324476-1324498 GGCAGAAGGGCAGGGAGGAGAGG - Intronic
1132724967 16:1334463-1334485 GGGAGGGGGTCGGTGAGCAGAGG + Intronic
1132734605 16:1379311-1379333 GGCAGGAGAGCGGAGCGGAGCGG - Intronic
1132805998 16:1775392-1775414 GGCCGGAGGTGGAAGAGGTGAGG + Exonic
1133000793 16:2850461-2850483 GACAGGAGCAGGGAGAGGAGAGG + Intergenic
1133714183 16:8431134-8431156 GGCAGGAGAACGGAGGGGAACGG - Intergenic
1134799514 16:17071544-17071566 GGGAGGAGCGGGGAGAGGAGAGG - Intergenic
1135020194 16:18956612-18956634 GAGAGGAGGTGGAAGAGGAGGGG - Intergenic
1135552421 16:23408339-23408361 GGCGGGAGGTAGGGGACGAGTGG + Intronic
1135552430 16:23408362-23408384 GGCGGGAGGTAGGGGACGAGTGG + Intronic
1136111547 16:28066597-28066619 GGCGGGAGGTGCTAGAGGAGGGG + Intergenic
1136234540 16:28905670-28905692 GGCAGGGGGACTGGGAGGAGAGG - Intronic
1136366667 16:29812168-29812190 GGGAGGGGACCGGAGAGGAGGGG + Intronic
1136403040 16:30028839-30028861 GGCGGGGGGACGGGGAGGAGAGG - Intronic
1136485757 16:30571004-30571026 GGGAGGAGCTCGGAGAGGTGAGG - Exonic
1136539915 16:30923542-30923564 GGAAGGAGGAGGGAGGGGAGGGG + Intronic
1136550450 16:30979859-30979881 GGGAGGAGGGCGAAGAGGAGGGG + Exonic
1136904150 16:34071473-34071495 TGCAGTAGATTGGAGAGGAGTGG + Intergenic
1137386474 16:48047398-48047420 AGCAGGAGGAGGGAGTGGAGAGG + Intergenic
1137386500 16:48047484-48047506 AGCAGGAGGAGGGAGAGGAAGGG + Intergenic
1137557052 16:49477285-49477307 GGAAGGAGGAGGGGGAGGAGGGG + Intergenic
1137557062 16:49477306-49477328 GGAAGGAGGAGGGGGAGGAGGGG + Intergenic
1137557072 16:49477327-49477349 GGAAGGAGGAGGGGGAGGAGGGG + Intergenic
1137557087 16:49477357-49477379 GGAAGGAGGAGGGGGAGGAGGGG + Intergenic
1137850110 16:51733313-51733335 AGCATGAGGTCCCAGAGGAGAGG - Intergenic
1138450979 16:57093196-57093218 GGGAGGAGGGCAGAGGGGAGCGG - Intronic
1138623662 16:58232012-58232034 GGAATGAGGTTGGAGAGGTGAGG + Intronic
1139325559 16:66150197-66150219 GACAGGAGCAGGGAGAGGAGGGG - Intergenic
1139364272 16:66424140-66424162 CGCTGGAGATAGGAGAGGAGAGG + Intergenic
1139424980 16:66873834-66873856 GGGAGGAGGGAGGAGAGGAGAGG - Intergenic
1139513932 16:67442484-67442506 GCCAGGGGACCGGAGAGGAGAGG - Intronic
1139516871 16:67457481-67457503 GGCAGGTGGTGGCAGAGGGGTGG + Intronic
1139612191 16:68067175-68067197 GGGAGGAGATGGGAGGGGAGGGG - Intronic
1139612202 16:68067197-68067219 GGGAGGAGATGGGAGGGGAGAGG - Intronic
1139612211 16:68067219-68067241 GGGAGGAGATGGGAGGGGAGAGG - Intronic
1139651759 16:68365761-68365783 AGCAGGAGGTCGGGGCAGAGGGG - Intronic
1139925378 16:70483038-70483060 GGAAGGAGTGGGGAGAGGAGAGG - Intronic
1140473536 16:75227624-75227646 GGAAGGAGGGCAGAGAGGAGTGG - Intergenic
1140595551 16:76405661-76405683 AGGAGGAGGAGGGAGAGGAGGGG + Intronic
1140951582 16:79823603-79823625 GTCAGGAGGAGGGAGAGGAGAGG - Intergenic
1141140264 16:81492775-81492797 GGCAGGATGTGGAAGAGGAGGGG + Intronic
1141181196 16:81754298-81754320 GGAAGGAGGTGGGGGAGGCGAGG - Intronic
1141397522 16:83718145-83718167 AGCAGGAAGTGGGACAGGAGAGG + Intronic
1141422392 16:83925563-83925585 GGTGGGAGGTAGGAAAGGAGAGG - Exonic
1141601686 16:85130597-85130619 AGGAGGAGGAGGGAGAGGAGAGG + Intergenic
1141627949 16:85271309-85271331 GGCAGGAGCGCGGGGAAGAGGGG - Intergenic
1141665081 16:85461832-85461854 GGGAGAAGGTCCGGGAGGAGGGG - Intergenic
1141831111 16:86510451-86510473 GGGAGGAGGGCGAAGGGGAGGGG - Intergenic
1142000420 16:87661189-87661211 GGCAGGAGGTCGGAGAGGAGAGG - Intronic
1142008309 16:87700779-87700801 GGGAGGAGGTTGGAGGGCAGAGG + Intronic
1142022378 16:87791815-87791837 GCCAGGAGGTCAGAGAGGCCAGG + Intergenic
1142137763 16:88459566-88459588 GGGAGGAGGAAGAAGAGGAGGGG - Intronic
1142160384 16:88554543-88554565 GGCAGCAGGTCAGAGAGGAGAGG - Intergenic
1142246141 16:88970923-88970945 GGAAGGAGGTCGGTCGGGAGGGG + Intronic
1142249403 16:88984210-88984232 GGCAGGACGGAGGGGAGGAGAGG - Intergenic
1142251444 16:88993766-88993788 GGGAGGAGGGAGGAGGGGAGAGG - Intergenic
1142319472 16:89371753-89371775 CTCAGGATGACGGAGAGGAGAGG + Intronic
1142809212 17:2387396-2387418 GGCAGCCGGTGGGGGAGGAGGGG + Exonic
1143771857 17:9174015-9174037 GGCACGAGGTCAGAGAAGGGAGG - Intronic
1143869467 17:9947896-9947918 AGCAGGAGGAGGAAGAGGAGGGG - Intronic
1143869761 17:9949792-9949814 GGAAGGAGGGAGGGGAGGAGAGG - Intronic
1144167258 17:12624934-12624956 GGGAGGAGGGGGGAGGGGAGGGG + Intergenic
1144213017 17:13031219-13031241 GGAAGGAGGAAGGAGTGGAGGGG - Intergenic
1144523057 17:15967112-15967134 AGCAGGAAGTGGGAAAGGAGAGG + Intronic
1145289972 17:21535184-21535206 TGCAGGAGATCGGCCAGGAGTGG + Exonic
1145936594 17:28717954-28717976 CGCAGAAGGGTGGAGAGGAGGGG - Intronic
1145973982 17:28973719-28973741 GGCTGGGTGTCGGACAGGAGGGG + Intronic
1146229524 17:31095387-31095409 GGCGGGAGGTGGGAGCGGAGTGG + Intronic
1146252796 17:31364504-31364526 GGCAGGAGGGGGAGGAGGAGAGG - Intronic
1147139210 17:38452156-38452178 GGACGGAGGTGGGAGGGGAGGGG - Intronic
1147242828 17:39101795-39101817 GGCAGGGCATCGGAGTGGAGGGG - Intronic
1147251166 17:39153112-39153134 GGCAGGAGGTCGGAGACAGGGGG - Intronic
1147361526 17:39933809-39933831 GGAAGCAGGTGGGGGAGGAGGGG - Intergenic
1147381434 17:40058520-40058542 AGCAGGAGAGAGGAGAGGAGGGG - Intronic
1147427344 17:40352186-40352208 AGCAGGAGGAGGGAGAAGAGAGG - Intronic
1147443799 17:40462806-40462828 GGCAGGATGACGGGGAGCAGGGG + Intergenic
1147498743 17:40942300-40942322 GGGAGGAGGAAGGGGAGGAGGGG - Intergenic
1147691208 17:42315895-42315917 GGCAGGAGATTGGATAGCAGTGG - Intronic
1147768949 17:42854740-42854762 GGCGGGCAGTCAGAGAGGAGGGG + Intronic
1147907667 17:43833263-43833285 GGGAGGAGGCGGGGGAGGAGCGG + Intergenic
1148209183 17:45798000-45798022 GGCGGGAGCAAGGAGAGGAGAGG + Intronic
1148217634 17:45842025-45842047 GGCAGGAGGGTGGTTAGGAGAGG - Intergenic
1148331904 17:46818396-46818418 GGCTGGAGGGAGGCGAGGAGAGG + Intronic
1148468595 17:47879325-47879347 GGGAGGAGGTGGCAGAGGGGAGG + Intergenic
1148647564 17:49227928-49227950 AGGAGGAGGTGGGAGAGAAGGGG + Intronic
1148793050 17:50184330-50184352 GGAGAGAGGTCGGAGAGCAGAGG + Exonic
1148905871 17:50911799-50911821 GGCAGAAGCTCGGTGGGGAGGGG + Intergenic
1149184576 17:53981940-53981962 GGTAGGAGGTTGGAGAAGATAGG + Intergenic
1151412438 17:73940185-73940207 GGAAGGAGGGAGGAGAGAAGAGG + Intergenic
1151448593 17:74183073-74183095 GGGAGGAGGTGGGAGTGGACTGG - Intergenic
1151451341 17:74200135-74200157 GGCAGGGGGTCGGGGAGAAGAGG - Intergenic
1151598478 17:75091859-75091881 CGCAGGAGGCAGGATAGGAGGGG + Intronic
1152086830 17:78225220-78225242 GGCAGGCGGGCTGAGAGGGGCGG - Exonic
1152161522 17:78671309-78671331 GGCGGGTGGGCAGAGAGGAGAGG + Intergenic
1152266276 17:79296836-79296858 AGCAGGAGGAGGGGGAGGAGGGG - Intronic
1152367126 17:79862819-79862841 TGCAGGCTGTCAGAGAGGAGAGG + Intergenic
1152417275 17:80170817-80170839 GGGAGGAGAGGGGAGAGGAGGGG - Intronic
1152427641 17:80226898-80226920 GGCAGCAGATCAGAGGGGAGGGG - Intronic
1152441553 17:80312919-80312941 GCCAGCAGGGAGGAGAGGAGGGG + Intronic
1152772915 17:82181123-82181145 GGCAGAGGGGCAGAGAGGAGGGG + Intronic
1153448188 18:5196970-5196992 GGGTAGAGGACGGAGAGGAGAGG - Intronic
1153623511 18:7002266-7002288 GGCAGGAGGGCTGTGAGGACAGG + Exonic
1153872011 18:9330432-9330454 GGGAGGAGGGAGGAGAGCAGAGG + Intergenic
1154391243 18:13938149-13938171 GACTGGAGGTGGTAGAGGAGAGG - Intergenic
1155167699 18:23244831-23244853 GGCAGTAGGTCAGAGAACAGTGG + Intronic
1155198258 18:23495261-23495283 GGGAGGAGGGAGGAGAGAAGGGG + Intergenic
1155217163 18:23653591-23653613 GGAAGGAGAGGGGAGAGGAGGGG - Intronic
1155525970 18:26716648-26716670 GGCAGGAGGCAGGAGAGAATGGG + Intergenic
1156450806 18:37265624-37265646 GGCCTGAGGTAGGACAGGAGTGG + Intronic
1157475461 18:48020940-48020962 GAGAGGAGGCAGGAGAGGAGGGG - Intergenic
1157618779 18:49003359-49003381 GAGAGGAGGTGGGGGAGGAGGGG - Intergenic
1157622383 18:49024000-49024022 CGCAGGAGGTTCGGGAGGAGAGG - Intergenic
1157763379 18:50281122-50281144 GGGACGAGGACGGAGAGGAATGG - Intronic
1158363107 18:56698883-56698905 GGTGGGAGGACGGAGAGGATTGG + Intronic
1158403797 18:57143519-57143541 GTCAGGAGCTGGGAAAGGAGAGG + Intergenic
1158475446 18:57775384-57775406 GGAAGGAGGAAGGAGAGGGGCGG + Intronic
1158525516 18:58209380-58209402 AGGAGGAGGTGGAAGAGGAGGGG - Intronic
1158826616 18:61227296-61227318 GAAAGGAGGAGGGAGAGGAGAGG + Intergenic
1159350425 18:67265596-67265618 GGCAGGTGGTAGAAGATGAGGGG - Intergenic
1159511347 18:69401100-69401122 GGCGGGAGCTCGGGGAAGAGCGG + Exonic
1159919727 18:74216530-74216552 GGCAGGAGGTTGGAGAGATGGGG - Intergenic
1160044123 18:75371057-75371079 TGCAGGAGGTCAGAGAGGAGGGG - Intergenic
1160245089 18:77151942-77151964 GCCAGAAGGTGGGAGAGGCGGGG + Intergenic
1160303541 18:77708821-77708843 GGCAGCAGGTCTGAGAAGTGGGG + Intergenic
1160430957 18:78812274-78812296 GGGAGGAGGTGGGAGAAGGGGGG - Intergenic
1160495518 18:79372191-79372213 GGCAGGAGGCAGGGGACGAGGGG - Intronic
1160495527 18:79372213-79372235 GGCAGGAGGCAGGGGACGAGGGG - Intronic
1160495536 18:79372235-79372257 GGCAGGAGGCAGGGGACGAGGGG - Intronic
1160497117 18:79382233-79382255 AGCTGCAGGTGGGAGAGGAGGGG - Intergenic
1160590194 18:79940240-79940262 AGCAGGAGGAGGGAGAGGACCGG + Intronic
1160659002 19:289743-289765 GGCAGGACGGCGGAGAGGGCGGG + Intronic
1160756298 19:758619-758641 AGCAAGAGGTGGCAGAGGAGCGG + Exonic
1160806517 19:994556-994578 ACAAGGAGGCCGGAGAGGAGGGG - Exonic
1160819844 19:1052696-1052718 AGGAGGAGGAGGGAGAGGAGGGG + Intronic
1160916858 19:1500843-1500865 GGGAGGAGGGAGGAGGGGAGGGG + Intergenic
1161022274 19:2015868-2015890 GGAAGGAGGGAGGGGAGGAGAGG + Intronic
1161022291 19:2015906-2015928 GGAAGGAGGGAGGGGAGGAGAGG + Intronic
1161022308 19:2015944-2015966 GGAAGGAGGGAGGGGAGGAGAGG + Intronic
1161022325 19:2015982-2016004 GGAAGGAGGGAGGGGAGGAGAGG + Intronic
1161022342 19:2016020-2016042 GGAAGGAGGGAGGGGAGGAGAGG + Intronic
1161030696 19:2056602-2056624 GGGAGGAGGAAGGAGAGAAGGGG - Intergenic
1161139586 19:2639692-2639714 GGCAGGGAGTGGGGGAGGAGGGG + Intronic
1161269774 19:3383399-3383421 GGCAGGAGCGTGGAGATGAGAGG + Intronic
1161288532 19:3480636-3480658 GGCAGGAGCTGGCAGGGGAGGGG - Intergenic
1161307916 19:3577706-3577728 GGAACGAGGTCGGGGAGGTGGGG - Intronic
1161307945 19:3577797-3577819 GGCAGGAGGATGGCGAGGACGGG - Intronic
1161404006 19:4081812-4081834 GGGAGGAGGGAGGAGAGGAAAGG - Intergenic
1161415664 19:4145246-4145268 GGGAGGAGGAGGGAGAAGAGAGG + Intergenic
1161461894 19:4402680-4402702 GGCGGGAGGGCGAAGAGCAGCGG + Exonic
1161523413 19:4738567-4738589 GACAGGAGGTGGGAGAAGAGGGG + Intergenic
1161649942 19:5478198-5478220 GGCAGGGGGCTGGAGGGGAGGGG + Intergenic
1161771932 19:6235585-6235607 GCCAGGAGTGTGGAGAGGAGAGG - Intronic
1161946074 19:7437978-7438000 GGGAGGAGAGAGGAGAGGAGAGG - Intronic
1162237694 19:9321705-9321727 GGGAGGAGGGCGGGGGGGAGAGG - Intergenic
1162373167 19:10290791-10290813 GGGGGGAGGGCGTAGAGGAGAGG - Intronic
1162395667 19:10416983-10417005 GGGACGAGGTGCGAGAGGAGGGG + Intronic
1162463832 19:10829417-10829439 GGCCGGAGGAGGGAGAGAAGGGG + Intronic
1162746723 19:12802670-12802692 GGAAAGAGGTCGGTGAGGTGTGG + Intronic
1162818142 19:13208246-13208268 GGGAGGAGGGAGGGGAGGAGGGG + Intronic
1162856269 19:13470758-13470780 AGCAAGAGATCAGAGAGGAGGGG + Intronic
1162967599 19:14163427-14163449 GGGAGGAGGTAGGAGAGAAGGGG + Intronic
1163160278 19:15460136-15460158 TGCAGGAGGTGGAGGAGGAGGGG + Intronic
1163162235 19:15471625-15471647 GGCGGGATCTGGGAGAGGAGCGG - Intronic
1163213911 19:15862450-15862472 GGGAGGAGGAGGGAGAGGGGAGG + Intergenic
1163612293 19:18307883-18307905 AGGAGGAGGTAGGAGAGGCGTGG + Intronic
1163751964 19:19083522-19083544 GGCAGGAGGCCAGAGAGCCGAGG - Intronic
1163779575 19:19239451-19239473 GGAAGGAGGAGGGAGAGGAGGGG - Intronic
1163779595 19:19239514-19239536 GGAAGGAGGAAGGGGAGGAGAGG - Intronic
1163826848 19:19528832-19528854 GGCGGGAGGGAGGAGAAGAGGGG + Intronic
1163915008 19:20233507-20233529 GAAAGGAGGTGGGAGAGGAATGG - Intergenic
1164871183 19:31644995-31645017 GGGAAGAGGTAGGAAAGGAGAGG - Intergenic
1165079792 19:33300729-33300751 GGAGGGAGGTGGGAGAGGCGTGG + Exonic
1165331977 19:35145097-35145119 GGCAGGAGGTGCAAAAGGAGGGG + Intronic
1165333661 19:35154892-35154914 GGATGGGGGGCGGAGAGGAGCGG - Exonic
1165435056 19:35790888-35790910 GGGAGGAGGTGGGGGTGGAGAGG - Intergenic
1165700905 19:37936874-37936896 GGCAGGAAGCAGGAGTGGAGGGG - Intronic
1165845133 19:38813124-38813146 TGCAGGAGGGCGTAGGGGAGGGG - Exonic
1165968420 19:39604505-39604527 TGCAGGAGGTTGGAGATGAAAGG - Intronic
1166079239 19:40433597-40433619 GGAAGGAGGTCCGAGAAGTGAGG + Intergenic
1166146778 19:40843680-40843702 GGCAGGATGGCGGAAAGGAAGGG - Exonic
1166658148 19:44627264-44627286 GGCAGGAGAGCAGGGAGGAGAGG + Intronic
1166763014 19:45236113-45236135 GGGATGAGGTTGGAGAGGTGGGG + Intronic
1166824067 19:45598514-45598536 GCCAGCAGGTTGGGGAGGAGGGG - Intronic
1166880891 19:45929349-45929371 GGCAGAGGGACAGAGAGGAGGGG + Intergenic
1166997182 19:46725222-46725244 GGCAGGAGGCAGGACAGCAGGGG - Intronic
1167003473 19:46759750-46759772 GGCTTGAGGTTGGAGAGGACCGG + Intronic
1167360675 19:49028746-49028768 GGCAGATGGACGGAGGGGAGGGG + Intronic
1167362979 19:49040060-49040082 GGCAGATGGACGGAGGGGAGGGG - Intergenic
1167365591 19:49053533-49053555 GGCAGATGGACGGAGGGGAGGGG + Intergenic
1167369673 19:49072887-49072909 GGCAGAAGGACGGAGAGAAAGGG - Exonic
1167384558 19:49156277-49156299 GGCAGGAACTCAGAAAGGAGGGG - Intergenic
1167465859 19:49650956-49650978 GGGAGGAGGATGCAGAGGAGGGG - Exonic
1167512085 19:49900711-49900733 GGCAGGTGGAGGGAGCGGAGGGG + Intronic
1167601877 19:50459365-50459387 GGGAGGAGGTAAGAGATGAGGGG + Intronic
1167601886 19:50459391-50459413 GGAAGGAGGTGGGAGATGAAGGG + Intronic
1167608256 19:50493195-50493217 GGAAGGGGGTCACAGAGGAGAGG + Intergenic
1167615582 19:50531137-50531159 GGCAGGAGGTGGGCATGGAGGGG - Intronic
1167633480 19:50639761-50639783 GGCAGGAGGAGGGGGAGGAGCGG + Intronic
1167661720 19:50799363-50799385 GGCAGGAGGGCACAGGGGAGGGG + Intronic
1167686507 19:50960040-50960062 AGGAGGAGGAGGGAGAGGAGGGG + Intronic
1167741553 19:51327266-51327288 GGCAGGGGGACGGAGCGGGGCGG + Intronic
1167924935 19:52813623-52813645 GGCAGGGGGCCAGAGAAGAGGGG - Intronic
1168098924 19:54130674-54130696 GGTAGGAGGTGGGACAGGGGAGG + Intronic
1168246538 19:55115536-55115558 GGCAGGGGGTGGGAGGGAAGGGG - Intronic
1168257293 19:55173819-55173841 GGGAGGGGGTGGGAGACGAGAGG + Intronic
1168352947 19:55686857-55686879 GGCAGTAGCTCGGAGGAGAGTGG + Intronic
1168483474 19:56740957-56740979 GGGAGGAGAGGGGAGAGGAGGGG - Intergenic
925079641 2:1053912-1053934 GGCGGGAGGGAGGAGAGGAGGGG - Intronic
925329674 2:3048815-3048837 GGCAGGAGGCCCCAGGGGAGGGG + Intergenic
925406233 2:3606854-3606876 CGCTGGAGGTCAAAGAGGAGAGG + Intronic
925755104 2:7126337-7126359 GTCAGGAGGTCGGGGGGTAGGGG - Intergenic
925918762 2:8625283-8625305 GGCAGGTGGTTGGGGAGGGGAGG + Intergenic
926083038 2:10004195-10004217 TGAAGGAGGTTGGAGAGTAGGGG - Intergenic
926105446 2:10146731-10146753 AGGAGGAGGAGGGAGAGGAGAGG + Intronic
926267892 2:11343709-11343731 GGCAGGCGGAAGGAGAAGAGGGG + Intronic
926307826 2:11651963-11651985 GGCAGGATGTGGCAGTGGAGAGG + Intergenic
926919914 2:17930177-17930199 AGGAGGAGGTGGGAGTGGAGCGG + Intronic
927654339 2:24932796-24932818 GGAAGGAGGTCGGATAGGGATGG + Intergenic
927694163 2:25229245-25229267 GTCAGGAGGACCGGGAGGAGAGG - Exonic
928198796 2:29233588-29233610 GGCAGGAGGCGGAGGAGGAGGGG - Exonic
928402278 2:30987730-30987752 GGCAGCAGGTGGGGGAGGAGGGG - Intronic
928885613 2:36144622-36144644 GGCAGAAGGTGGGAAAGGGGTGG - Intergenic
929246684 2:39710001-39710023 GGCAGGTGGGCACAGAGGAGAGG + Intronic
929298110 2:40271236-40271258 GAGGGGAGGTGGGAGAGGAGTGG - Intronic
929444521 2:41991998-41992020 GGCAGGAGAGGGGAGGGGAGAGG + Intergenic
929778284 2:44942004-44942026 ACCAGGAGGAGGGAGAGGAGAGG - Exonic
930100001 2:47596213-47596235 GCCAGGAGGTGGGAGTGGGGTGG - Intergenic
930696547 2:54417187-54417209 GGAAGGAGATGGGAAAGGAGGGG + Intergenic
931596390 2:63949664-63949686 AGGAGGAGGAGGGAGAGGAGAGG + Intronic
931938933 2:67230777-67230799 GGCTGGATGTCAGAGAGAAGTGG + Intergenic
932811062 2:74826683-74826705 GGCAGAAGGACAGAGAAGAGGGG - Intergenic
932851854 2:75195328-75195350 GGAAGGGGATAGGAGAGGAGGGG - Intronic
933453125 2:82482971-82482993 GGGAAGAGGGGGGAGAGGAGGGG - Intergenic
933454827 2:82507803-82507825 GGCAGGAGCAGGGAGAGGAGAGG - Intergenic
933898585 2:86833496-86833518 GGGAGGAGAGCGGAGGGGAGGGG - Intronic
933898593 2:86833516-86833538 GGGAGGAGAGCGGAGGGGAGGGG - Intronic
933949671 2:87317791-87317813 TACAGGAGGTCAGTGAGGAGAGG - Intergenic
934475227 2:94588932-94588954 GGCTGGAGGAGGGAGAGCAGGGG - Intronic
934562643 2:95321000-95321022 GGCTGGGGGTCAGGGAGGAGAGG - Intronic
934729781 2:96649335-96649357 TGCAGGAGGGTGGGGAGGAGAGG - Intergenic
935556024 2:104510404-104510426 GGGAGGAGGAAGAAGAGGAGTGG + Intergenic
936042566 2:109160962-109160984 GGCAGGGGCTCAGAGAGGTGGGG + Intronic
936250695 2:110866247-110866269 AGCTGGAGGCAGGAGAGGAGGGG + Intronic
936330520 2:111543806-111543828 TACAGGAGGTCAGTGAGGAGAGG + Intergenic
936370407 2:111898405-111898427 GGGAGGGGGTTGGAGAGAAGGGG - Intergenic
936663417 2:114567444-114567466 GGCAAGAAGTCAGAGAGCAGAGG + Intronic
937027618 2:118712317-118712339 GGGAGGAGGTGGGAGGGGAGAGG + Intergenic
937083307 2:119155868-119155890 GGGTGGAGGTCAGAGGGGAGGGG - Intergenic
937111062 2:119367408-119367430 GGCAGGACGTCGCGGCGGAGTGG + Intronic
937650955 2:124318771-124318793 AGTGGGAGGTAGGAGAGGAGGGG - Intronic
937690427 2:124749332-124749354 GGAAGGAGGAGGGAGGGGAGGGG - Intronic
937904313 2:127045457-127045479 GGCAGGAGGGCGGGGAGCAGGGG + Intergenic
939073180 2:137568201-137568223 GGGAGGCGGGAGGAGAGGAGGGG + Intronic
939914318 2:148020985-148021007 GGCAGGAGGAGGGGGAGGGGAGG - Intronic
940176401 2:150882011-150882033 GTCAGGAAGTCAGAGAGGGGAGG + Intergenic
940466767 2:154039614-154039636 GGTAGCAGGGAGGAGAGGAGAGG + Intronic
940559875 2:155281610-155281632 GCCAGGAGTTGGGAGAGGGGTGG + Intergenic
940947601 2:159636302-159636324 GTCAGGAGGTGGGAGCGGGGAGG - Intergenic
941034975 2:160558668-160558690 GGCAAGAGGAGGGAGAGCAGCGG + Intergenic
941205138 2:162562666-162562688 GACAGGAGGTAGGAGAAGGGTGG + Intronic
941211964 2:162651347-162651369 GGTGGGAGGAGGGAGAGGAGTGG - Intronic
941595507 2:167471908-167471930 GCCAGGTGGTAGGAGAGCAGAGG + Intergenic
942800744 2:179872617-179872639 GGGAGGAGGAGGGAGAGGAGGGG + Intergenic
943526716 2:189025606-189025628 GGCTGGAATTTGGAGAGGAGAGG - Intergenic
944223224 2:197323172-197323194 GGCAGGATGTGAGAGATGAGAGG - Intergenic
946199638 2:218064358-218064380 GGCAGGGAGTTGGAGAGGAGTGG - Intronic
946306536 2:218859769-218859791 GGGCGGAGGTGGGAGGGGAGCGG - Intergenic
946758947 2:222974126-222974148 GGTAGGAGGTGGGAGAGCTGAGG - Intergenic
946776759 2:223150492-223150514 GGCTGGAGGTGGAAGGGGAGTGG + Intronic
946904623 2:224404721-224404743 GGCAGGAGGCCAGGGAAGAGGGG + Intergenic
946923696 2:224604685-224604707 CGGAGGAAGTCGGAAAGGAGAGG + Intergenic
947119430 2:226799874-226799896 GGCTGGGGGGCGGAGAGGGGCGG - Intergenic
947395312 2:229680957-229680979 GGCAGGAGATGGGAGTGGAGAGG + Intronic
947476911 2:230458388-230458410 AGAAGGAGGAAGGAGAGGAGGGG + Intronic
947628709 2:231637656-231637678 GGAAGGAAGTGGGGGAGGAGGGG + Intergenic
948437162 2:237961492-237961514 GGCAGGAGGGAAGAGTGGAGTGG + Intergenic
948453670 2:238093990-238094012 GGCAGGTGCCCAGAGAGGAGGGG + Intronic
948612983 2:239181274-239181296 GGAAGGAGGGAGGAGAGGAGGGG + Intronic
948670247 2:239563917-239563939 GAAAGGAGGCAGGAGAGGAGAGG - Intergenic
948779490 2:240310152-240310174 GACAGGAGGGGGGACAGGAGGGG - Intergenic
948921930 2:241069889-241069911 GGCAGGAGCAGGGAGAGGTGAGG - Intronic
1169141087 20:3227956-3227978 GGTAGGCGGGCGGGGAGGAGAGG - Intronic
1169194379 20:3675343-3675365 GGGAGGACGCCGGGGAGGAGTGG + Intronic
1169339496 20:4785607-4785629 GGGAGGAAGGGGGAGAGGAGAGG + Intronic
1169571617 20:6912679-6912701 GACAGGAGGTGGGATAGCAGGGG + Intergenic
1169905904 20:10603762-10603784 GGCTGGAGGCCTGTGAGGAGGGG - Intronic
1169914717 20:10673777-10673799 GCCGGGAGGTGGAAGAGGAGGGG - Exonic
1170101807 20:12709574-12709596 GGCAGGAGGAAGGGGAGGAATGG - Intergenic
1171013475 20:21521309-21521331 GGGAGGAGGTTGGGGCGGAGGGG + Intergenic
1171123872 20:22585572-22585594 GGCAGGAGGTGGGGAGGGAGGGG + Intergenic
1171347822 20:24479263-24479285 GGGAGAAGGTCTCAGAGGAGCGG - Intronic
1171418130 20:24997464-24997486 GGGAGGAGGAGGGAGGGGAGGGG - Intergenic
1171536670 20:25898760-25898782 GCCAGGAGGTGGGAGAGGCCAGG - Intergenic
1171988271 20:31675922-31675944 GGGAGGAGGTGGAGGAGGAGAGG - Intronic
1172841293 20:37904004-37904026 GGCAGATGGGCAGAGAGGAGTGG - Intronic
1173192581 20:40887546-40887568 GGCAGGAGACCAGAGAGGAAGGG - Intergenic
1173749655 20:45467279-45467301 GGGAGGAGATGGGAGGGGAGGGG + Intergenic
1173837550 20:46135900-46135922 GGGATGAAGTCAGAGAGGAGGGG - Intergenic
1174115325 20:48222999-48223021 AGCAGGAGGTCAGTGAGGAGGGG + Intergenic
1174423897 20:50418553-50418575 GGGAGGGGGGAGGAGAGGAGAGG + Intergenic
1174478010 20:50810946-50810968 GGCAGGAGGACCGGGAGTAGGGG + Intronic
1174553284 20:51376498-51376520 GGCAGGAGGCATGAGGGGAGGGG + Intergenic
1174576093 20:51538567-51538589 GGCAGTAGCTCAGAGAGGACAGG + Intronic
1174818740 20:53709521-53709543 GCCAGGAGGTGGGAAAGGGGCGG - Intergenic
1175120245 20:56711062-56711084 GAGAGGAGGAGGGAGAGGAGGGG - Intergenic
1175426707 20:58871969-58871991 GACAGGAGTACGGGGAGGAGAGG + Intronic
1175457829 20:59128521-59128543 GGCAGCATGGCAGAGAGGAGTGG + Intergenic
1175651146 20:60724437-60724459 GGGAGAAGGGAGGAGAGGAGAGG + Intergenic
1175670951 20:60902539-60902561 GGCGGGAGGTGAGAGAGGTGGGG + Intergenic
1175801631 20:61804392-61804414 GGCTGGACGGCGGAGAGGGGTGG - Intronic
1175877060 20:62235356-62235378 GGGAGGAGGTAAGAGTGGAGCGG + Intronic
1175934169 20:62507483-62507505 GGCAGCAGGAAGGAGAGGGGCGG + Intergenic
1177483782 21:21728612-21728634 GGCAGGAAGACAGAGAGGAAAGG - Intergenic
1177775500 21:25562031-25562053 GGCAGGAGGGGGGAGAAGGGGGG + Intergenic
1178170550 21:30035162-30035184 GAAAGGAGATAGGAGAGGAGAGG - Intergenic
1178198160 21:30372075-30372097 GGCAGGTGCTGGGAGAGCAGAGG + Exonic
1178202694 21:30425774-30425796 GGCAGGTGCTGGGAGAGCAGAGG + Exonic
1178203062 21:30430377-30430399 GGCAGGTGCTGGGAGAGCAGAGG - Exonic
1178203556 21:30436828-30436850 GGCAGGTGCTGGGAGAGCAGAGG + Intergenic
1178337877 21:31759927-31759949 GGAAGGAAGGAGGAGAGGAGAGG - Intergenic
1178387203 21:32162403-32162425 GGCAAGAGATGGGAGAGGAAAGG - Intergenic
1179081833 21:38178624-38178646 GGGAGGAGGAGGGGGAGGAGGGG + Intronic
1179161830 21:38905670-38905692 TGCGGGAGGTGGGAGGGGAGGGG - Intergenic
1179338966 21:40486494-40486516 GGAAGGAGAGAGGAGAGGAGAGG + Intronic
1179450640 21:41466330-41466352 GGCAGGAGCTCCGGAAGGAGCGG + Intronic
1179462692 21:41548375-41548397 GTCAGGAGGTGGAAGTGGAGGGG - Intergenic
1179634100 21:42696456-42696478 AGAAGAAAGTCGGAGAGGAGTGG + Intronic
1179634234 21:42697044-42697066 GGCACGTGGTGGGAGATGAGAGG + Intronic
1179963298 21:44784213-44784235 GAGAGGAGGGAGGAGAGGAGAGG + Intronic
1179965914 21:44805385-44805407 GCCAGGAGGTCTCTGAGGAGAGG + Intergenic
1180161554 21:46000618-46000640 GGCAGGAGGCCGGGGAAGGGGGG + Intronic
1180236509 21:46463116-46463138 GGCAGGGGGTCTAAGAAGAGTGG - Intronic
1180677352 22:17596475-17596497 GGCAGAAGGTGGAAGGGGAGTGG - Intronic
1180877008 22:19179183-19179205 GGCGGGAGGCCGGTGAGAAGGGG + Intergenic
1180959327 22:19755524-19755546 GTCAAGAGGTGGGAGTGGAGAGG + Intergenic
1181928976 22:26384006-26384028 GGCAGGAAGGAGGGGAGGAGAGG + Intergenic
1182012271 22:27010872-27010894 GGGAGGAGGCTGGACAGGAGAGG - Intergenic
1182351895 22:29704235-29704257 GTTAGGAGGTGGGAGGGGAGGGG - Intergenic
1182351912 22:29704272-29704294 GTCAGGAGGTGGGAGGGGAGGGG - Intergenic
1182556680 22:31133129-31133151 GGCTGGAGGTGGCAGATGAGTGG + Exonic
1182604083 22:31489859-31489881 GGGAGGGGGCCGAAGAGGAGGGG - Intronic
1183281357 22:36934329-36934351 GGAAGGAGGCCTGAGTGGAGTGG - Intronic
1183317378 22:37144120-37144142 GGCAGGAGGAGGATGAGGAGGGG + Exonic
1183383249 22:37501111-37501133 GGCAGACAGGCGGAGAGGAGAGG - Intronic
1183409572 22:37646952-37646974 GGCAGGAGGTTGGGGGGGAGGGG + Intronic
1183622727 22:38983909-38983931 GGCAGGAAGACTGAGGGGAGAGG - Intronic
1183629144 22:39022657-39022679 GGCAGGAAGACTGAGGGGAGAGG - Intronic
1183647216 22:39133737-39133759 GGCAGGTGGTGGGAGAGTAGTGG + Exonic
1183676396 22:39301227-39301249 GGCAGGAGGCCAGAGGGGATTGG + Intergenic
1183731801 22:39622481-39622503 GGCATGAGGCTGGAGAGGACAGG + Intronic
1184034892 22:41913688-41913710 GGCAGGAGGTGGAAGAGGGGAGG + Intronic
1184046497 22:41975775-41975797 GGCAGAAGGATGGAGAGGAGGGG - Intergenic
1184235053 22:43178939-43178961 AGCAGCAGATGGGAGAGGAGGGG + Intronic
1184473169 22:44707275-44707297 AGGAGGAGGTGGGACAGGAGTGG + Intronic
1184521582 22:44997744-44997766 GGGATGAGGCAGGAGAGGAGGGG - Intronic
1184561837 22:45268323-45268345 GTCAGGAGGAGGGAGGGGAGAGG - Intergenic
1184685099 22:46093047-46093069 AGCTGGGGCTCGGAGAGGAGAGG + Intronic
1184700866 22:46171734-46171756 GTCAGGAGGTCCCAGGGGAGAGG + Intronic
1185048239 22:48539903-48539925 GGCAGAAGGTGGGAGGGGATGGG + Intronic
1185103186 22:48852665-48852687 GGCAGGAGGTGGGTTAGGGGTGG - Intergenic
1185106945 22:48877184-48877206 GGAAGGAGGAAGGGGAGGAGAGG - Intergenic
1185176164 22:49328228-49328250 TGGAGGAGCTCTGAGAGGAGGGG - Intergenic
1185281472 22:49971772-49971794 GGCAGGAGGAGGGAGGGGAGAGG + Intergenic
949337526 3:2992091-2992113 GTCAGCAGGTAGGGGAGGAGAGG + Intronic
950048217 3:9964356-9964378 GGCAGGAAGAGGGGGAGGAGAGG - Intronic
950270520 3:11611115-11611137 GGGAGGAAGGCGGAGAAGAGAGG + Intronic
950423921 3:12914538-12914560 GGCTGGAGGTGGGAGGGGACTGG + Intronic
950518350 3:13481440-13481462 GGGATGAGGACGGAGAGGACAGG - Intronic
950644266 3:14367710-14367732 GGGAGGAGAGGGGAGAGGAGGGG + Intergenic
950647260 3:14384559-14384581 GGCAGGAGGAAGGAGAGGATGGG - Intergenic
950761167 3:15228714-15228736 GATAGGAGGAGGGAGAGGAGCGG + Intronic
951285683 3:20810197-20810219 GGCTGGAGGCTGGAGAGCAGTGG - Intergenic
951319322 3:21225903-21225925 GGCTGGACGTCGGAGAGAAGTGG + Intergenic
951418747 3:22458057-22458079 GGAAGGAGGTGGGGAAGGAGGGG + Intergenic
951659320 3:25045083-25045105 ATCAGGAGGTTTGAGAGGAGCGG + Intergenic
952329396 3:32350191-32350213 GGTTGGGGGTGGGAGAGGAGCGG - Intronic
952886721 3:38016875-38016897 GGCAGGAGGTTGGACAAGTGGGG + Intronic
952951916 3:38532561-38532583 GGCTGGAGGAGGGAGAGGATGGG - Intronic
952983418 3:38756659-38756681 AGCAGGAGGTTTGTGAGGAGTGG - Exonic
953230621 3:41062003-41062025 GGCGGGAGGAGGGAGAGGATGGG - Intergenic
953317650 3:41943610-41943632 GTTAGGAGGTAGGAGAGGAGAGG - Intronic
953607528 3:44421379-44421401 TGCAGAAGGGCTGAGAGGAGAGG + Intergenic
954384279 3:50236243-50236265 GGCTGGTGGTGGGAGCGGAGTGG + Exonic
954713690 3:52516920-52516942 GGCCGGAGGCAGGACAGGAGAGG - Intronic
954897793 3:53991745-53991767 GGCAGAAAGTGGAAGAGGAGTGG + Intergenic
954912735 3:54122518-54122540 GCGGGGAGGGCGGAGAGGAGAGG - Intergenic
955035927 3:55267735-55267757 GACAGGAGGGCTGAGAGGAAAGG - Intergenic
955114256 3:55981598-55981620 GGAAGGAGGAGGGGGAGGAGAGG + Intronic
955592391 3:60551582-60551604 GGGAGGAGAGAGGAGAGGAGAGG + Intronic
956192614 3:66621954-66621976 GGTAGGAGTTGGGAGAGGTGGGG + Intergenic
956838991 3:73119700-73119722 GGCCGGAGGTCTGGGTGGAGGGG + Intergenic
956843519 3:73161366-73161388 GGCAGGAGGGAGGAGAGAATGGG - Intergenic
957569787 3:81931828-81931850 GGAAGGAGGTGGGAGAGGTGGGG - Intergenic
960354653 3:116636451-116636473 GTCAGGAGGAGGCAGAGGAGAGG + Intronic
961038271 3:123658717-123658739 TGCTGGAGGTGGGAGAGTAGCGG - Intronic
961050639 3:123742952-123742974 GCCAGGAGCTGGGGGAGGAGGGG + Intronic
961484730 3:127208756-127208778 GGCTGGAGGTCAGGGAGCAGTGG + Intergenic
961532485 3:127547861-127547883 GGGAGGGGGGCGGAGGGGAGGGG - Intergenic
961536551 3:127574168-127574190 GGGACGAGGTCAGAGTGGAGTGG - Intronic
961940992 3:130637010-130637032 GGGAGGGGGAAGGAGAGGAGGGG - Intronic
962072267 3:132044806-132044828 GGGAGGAGGAGGGAGGGGAGGGG + Intronic
962210499 3:133473409-133473431 GGCCGGAAGTGGGAGAGAAGAGG + Intronic
962622258 3:137191538-137191560 GGCAGGAGGTGAGATAGGAGTGG - Intergenic
962857748 3:139364317-139364339 GTCATGAGGTGGGAGAGGGGAGG - Intronic
963108384 3:141665517-141665539 GGAAGGAGAGGGGAGAGGAGGGG + Intergenic
963114498 3:141714755-141714777 GGAAGGAGAGGGGAGAGGAGGGG + Intergenic
963846675 3:150165876-150165898 GGCAGAAGATGGGAAAGGAGAGG + Intergenic
963847199 3:150171419-150171441 GCCAGGAGGAGGGTGAGGAGAGG - Intergenic
964323288 3:155519990-155520012 GGCAGGAGATGGTAGAGGACAGG - Intronic
964429359 3:156588580-156588602 GGCTGGAGGTGGGATGGGAGAGG - Intergenic
964525992 3:157615822-157615844 GGCAGGGGGTGGGAAAGAAGAGG - Intronic
964570856 3:158106134-158106156 GACAGGAGGTGGGGGAGGAGAGG + Exonic
965805948 3:172541871-172541893 GGCAGGGTGTTGGAGAGGGGAGG + Intergenic
966060522 3:175749170-175749192 GGGAGGAGAAGGGAGAGGAGGGG + Intronic
966683529 3:182669188-182669210 AGTAGGAGGGAGGAGAGGAGAGG - Intergenic
967138550 3:186533052-186533074 GGGAGGAGGTTGGGGAGGGGAGG - Intergenic
967812897 3:193775394-193775416 GGCTGAAGGTTGGAGAGAAGAGG + Intergenic
967857045 3:194125977-194125999 GGCAGGAGGTCGGGGGACAGTGG - Intergenic
967893114 3:194377133-194377155 TTCAGGAGCTGGGAGAGGAGTGG + Intergenic
968007307 3:195251704-195251726 GGCAGGAGGTAGTAGAGGCTTGG - Intronic
968426445 4:526548-526570 GGGAGGAGGCAGGAGAGGGGAGG + Intronic
968515895 4:1015473-1015495 AGCAGGGGATGGGAGAGGAGGGG + Intronic
968628529 4:1638575-1638597 GGTAGGAGGTGAGAGAGGTGGGG + Intronic
968677238 4:1889991-1890013 GCCAGGGGCTGGGAGAGGAGAGG - Intronic
968952011 4:3700231-3700253 GGGGGGAGGTAGGGGAGGAGTGG + Intergenic
969008426 4:4040671-4040693 GGCAGGAGATAGGAGAGGGCTGG - Intergenic
969370397 4:6727812-6727834 GGGAGGGGGTGGGGGAGGAGGGG - Intergenic
969370409 4:6727832-6727854 GGGAGGGGGTGGGGGAGGAGGGG - Intergenic
969370421 4:6727852-6727874 GGGAGGGGGTGGGGGAGGAGGGG - Intergenic
969495270 4:7522889-7522911 GGGAGGAGGGAGGAGAGAAGAGG - Intronic
969544757 4:7818423-7818445 GGCAGGAGGTTAGAGAGGGAGGG + Intronic
970574146 4:17411535-17411557 GGAAGGAGATGGGAGGGGAGGGG + Intergenic
970756163 4:19429222-19429244 GGCTGGATGTTGGAGAGAAGTGG - Intergenic
971076087 4:23151541-23151563 GGCTGGATGTAGGAGAGAAGTGG + Intergenic
971412069 4:26384837-26384859 GGCAAGAGGCGGGAGGGGAGAGG - Intronic
972127751 4:35790218-35790240 GGGAGGATGGGGGAGAGGAGGGG + Intergenic
972279091 4:37585557-37585579 GGAAGGAGAGGGGAGAGGAGAGG + Intronic
972349827 4:38226280-38226302 GGCTGGAGGTGGGAGAGTAGTGG - Intergenic
973529811 4:51825047-51825069 GGTAGGAGGTTGGAGAGGACTGG - Intergenic
974192278 4:58521354-58521376 GGCAGCAGGAGAGAGAGGAGAGG - Intergenic
974229272 4:59088938-59088960 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
976128560 4:81858994-81859016 AACAGGAGGTAGGTGAGGAGAGG + Intronic
976207584 4:82637578-82637600 GGCAAGAGGGCGGTGAGCAGTGG - Intronic
976633958 4:87268703-87268725 GGCAGGAGGGGGGGGAGAAGGGG - Intergenic
977249975 4:94678858-94678880 GCAAGGAGGTTGGGGAGGAGAGG + Intergenic
977912909 4:102558461-102558483 GGCAGGTAGTGGGTGAGGAGTGG - Intronic
977937968 4:102827570-102827592 GGCAGGAGGAGGGGGAGGGGCGG - Intronic
978644714 4:110916069-110916091 AGGATGAGGTGGGAGAGGAGTGG + Intergenic
978739256 4:112119057-112119079 GGGAGGAGAGGGGAGAGGAGAGG + Intergenic
979541803 4:121892076-121892098 AGCAGGAGCTGGGAGAGGAAGGG + Intronic
979547303 4:121952079-121952101 GGCGGGAGGGGGAAGAGGAGGGG + Intergenic
980309663 4:131109671-131109693 GGTAGGGGGAAGGAGAGGAGAGG + Intergenic
980701523 4:136438162-136438184 AGGAGGAGGTGGAAGAGGAGGGG - Intergenic
980973689 4:139590120-139590142 GGCAGGAGTCAGGAGAGGCGGGG - Intronic
981964293 4:150582041-150582063 AGAAAGAGGTCGGAGGGGAGAGG + Exonic
983126628 4:163960664-163960686 GGTGGGAGGAGGGAGAGGAGTGG + Intronic
983238787 4:165208004-165208026 GGCGGGAGGTGGGAGATGCGGGG + Intronic
984203184 4:176753067-176753089 GGCTAGAGGTAGGAGAGGCGGGG - Intronic
984629058 4:182040277-182040299 GGGAGGAGAGGGGAGAGGAGAGG + Intergenic
984888970 4:184474621-184474643 GGGAGGAGGGCGGAGAGGGGAGG - Intergenic
985104215 4:186485487-186485509 GGAAGGAGAAGGGAGAGGAGGGG - Intronic
985626961 5:994080-994102 GGGAGGAGGGGAGAGAGGAGAGG + Intergenic
985666965 5:1186426-1186448 GGCAGGAGGCCGGGGGGCAGGGG - Intergenic
985675680 5:1230191-1230213 GGCTGGAGGTGGGGGAAGAGGGG + Intronic
985675689 5:1230227-1230249 GGCTGGAGGTGGGGGAAGAGAGG + Intronic
985913078 5:2897930-2897952 GCCAGCAGGTGGGAGAGGTGTGG - Intergenic
986089888 5:4493603-4493625 GGCAGGAGGAGAGAGAGGAAGGG - Intergenic
986566774 5:9123488-9123510 GGGAGGAGGGCTGAGAAGAGAGG + Intronic
986663102 5:10076513-10076535 GGGAGGAGCTCCCAGAGGAGGGG - Intergenic
986943451 5:12985495-12985517 AGAAGGAGGAGGGAGAGGAGGGG - Intergenic
988231369 5:28483917-28483939 GGTTGGACGTCGGAGAGAAGTGG - Intergenic
988913751 5:35871802-35871824 GGGAGGAGGTGGCAGAAGAGTGG + Intronic
989321318 5:40137463-40137485 GGAAGGGGGGAGGAGAGGAGAGG - Intergenic
989565155 5:42894376-42894398 GGAAGGAACTCGGAAAGGAGAGG + Intergenic
990176562 5:53114592-53114614 GGCTGGATGTCAGAGAGAAGTGG - Intergenic
990592752 5:57282809-57282831 GCCAGGGGTTGGGAGAGGAGTGG - Intergenic
992066834 5:73117188-73117210 GAGAGGAGGTCAGAGAGGAAAGG - Intergenic
992090619 5:73312860-73312882 GGCAGGAGGCAGAGGAGGAGGGG - Intergenic
992412019 5:76514490-76514512 GGCAGGAGGTAGGACAGGCTGGG - Intronic
992750639 5:79857556-79857578 GGCAGAAGAATGGAGAGGAGGGG - Intergenic
993931298 5:93944601-93944623 GGCAGGAGAGGGGAGGGGAGGGG + Intronic
995525671 5:113049000-113049022 GGCAGCAGGGCGGTGAGGTGTGG + Intronic
996087361 5:119318691-119318713 GGCAGGAAGAGGGACAGGAGAGG - Intronic
997265487 5:132492351-132492373 GTCAGGAGCTAGGAGAGGAAAGG + Intergenic
997702242 5:135910962-135910984 GCCAGAAGTTCGGAGAGGGGAGG - Intergenic
998011601 5:138699721-138699743 AGCAGGAGGGTGGGGAGGAGAGG + Intronic
998129095 5:139642330-139642352 GGGAGGGGCTCGGAGAGGTGGGG + Intergenic
998405197 5:141870329-141870351 GGCAGCAGGAGGGAGAGGAGAGG - Intronic
998490087 5:142539409-142539431 GGGAGGAGGGAGGGGAGGAGGGG - Intergenic
998991566 5:147823181-147823203 GGCAGGGGGAGGAAGAGGAGGGG - Intergenic
999110863 5:149120382-149120404 GGTGGGAGGTGGGAGAGGATCGG + Intergenic
999323796 5:150630707-150630729 GGATGGAGGAGGGAGAGGAGAGG - Intronic
999422742 5:151458885-151458907 GGTAGGAGCCCGGGGAGGAGAGG - Exonic
1000334162 5:160229525-160229547 GGCTGGAGGCCAGAGAGCAGAGG - Exonic
1000990635 5:167908332-167908354 GGGAGGAGAGGGGAGAGGAGAGG - Intronic
1001084728 5:168692294-168692316 GGAAGTTGGTAGGAGAGGAGAGG + Intronic
1001422163 5:171596386-171596408 GGCCGGGGGTGGGGGAGGAGGGG - Intergenic
1001600168 5:172923357-172923379 GGGAGGAGGAGGGGGAGGAGGGG + Intronic
1001768343 5:174272825-174272847 GGCAGGAGGAAAGAGAGGTGGGG + Intergenic
1001843176 5:174898120-174898142 GGCAGCAGGTGGTTGAGGAGTGG - Intergenic
1001935307 5:175699402-175699424 CGGAGGAGGTTGGGGAGGAGAGG - Intergenic
1002029220 5:176416051-176416073 GGCAGGAGCTGGGAGACGTGGGG - Intronic
1002065656 5:176650463-176650485 GGAAGGAGCTCGGGGAGGAATGG + Intronic
1002193667 5:177491299-177491321 GACAGGAGGGCGAAGTGGAGAGG + Intronic
1002327620 5:178420357-178420379 GGGAGGAGGAAAGAGAGGAGGGG - Intronic
1002390982 5:178911466-178911488 AGGAGGAGGAAGGAGAGGAGAGG - Intronic
1002741574 5:181438438-181438460 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1002931274 6:1636840-1636862 GGCAGCAGGGAGGAGAGGTGAGG + Intronic
1003244011 6:4369197-4369219 GGCAGGAGATTGGAGTGAAGGGG - Intergenic
1003545233 6:7052591-7052613 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1003635356 6:7826913-7826935 GACAAGAGATAGGAGAGGAGTGG - Intronic
1003765748 6:9234453-9234475 AGGAGGAGGAAGGAGAGGAGGGG - Intergenic
1004137225 6:12979094-12979116 GGTTGGAGGTGGGAGTGGAGTGG - Intronic
1004459119 6:15819450-15819472 GGCAGGCGGTGGGAGGGGTGGGG + Intergenic
1004780723 6:18905615-18905637 GGTAGGAGGTTGGAGGGGAGTGG + Intergenic
1005076902 6:21917546-21917568 GGAAGCATGTCTGAGAGGAGTGG - Intergenic
1005876234 6:30011794-30011816 GGCAGGAGTACACAGAGGAGAGG + Intergenic
1005972580 6:30773022-30773044 GCCCAGAGGTGGGAGAGGAGAGG - Intergenic
1006092499 6:31636365-31636387 GGCAGAAAGCCGGAGAGTAGAGG - Exonic
1006444382 6:34070611-34070633 GGCAGGAGCTCGGAGGACAGGGG + Intronic
1006501544 6:34462566-34462588 GGGAGGAGGTGGGTGGGGAGAGG - Intergenic
1006796397 6:36735033-36735055 GGCAGGAGCTCTAAGAGAAGAGG + Intergenic
1006903487 6:37517675-37517697 GGCAGCAGGATGGAGGGGAGGGG + Intergenic
1006916754 6:37599711-37599733 GGCAGGTGGTGGGGGAGGAGGGG - Intergenic
1007099022 6:39231761-39231783 GACCGGAGGTGGGAGAGGAATGG - Intergenic
1007113164 6:39325239-39325261 GCCAGGAGGTCAGCCAGGAGTGG - Intergenic
1007113441 6:39326964-39326986 GCCAGGAGGTCAGCCAGGAGTGG - Intergenic
1007305021 6:40897175-40897197 GGCAGGAGGATGGAGAGAAATGG - Intergenic
1007380801 6:41488878-41488900 GTCAGCAGGTGGGGGAGGAGAGG + Intergenic
1007626878 6:43251693-43251715 GGCTGGAGGGGGGAGACGAGAGG + Intronic
1007741070 6:44009697-44009719 GGAGGGAGGGCGGAGGGGAGGGG + Intergenic
1007924954 6:45643124-45643146 GGGAGGGGATAGGAGAGGAGGGG - Intronic
1007935332 6:45727546-45727568 AGCAGGAGCTCTGGGAGGAGAGG + Intergenic
1009618314 6:66039079-66039101 GCCAGGAGATGGGAGAGGGGTGG - Intergenic
1009696075 6:67104721-67104743 GGCAGTAGTTGGGAAAGGAGTGG + Intergenic
1009989074 6:70818549-70818571 GGCAGGATGTTGAAGTGGAGAGG + Intronic
1010433173 6:75801339-75801361 AGGAGGAGGGAGGAGAGGAGAGG + Intronic
1010773929 6:79863567-79863589 GGCATGGGGTGGGAGTGGAGGGG + Intergenic
1011673289 6:89705026-89705048 GTTAGGAGGTTGGAAAGGAGAGG - Intronic
1012211300 6:96521803-96521825 GACAGGCGGTGGGAGAAGAGAGG - Exonic
1012401162 6:98843721-98843743 GGAAGCTGGCCGGAGAGGAGTGG + Intergenic
1012442689 6:99276327-99276349 GGCTGAAGGTGGGAGAGAAGAGG - Exonic
1013803358 6:113971041-113971063 GGCCGGTGGGAGGAGAGGAGGGG + Exonic
1014082185 6:117300527-117300549 GGGAGGAAGTTGAAGAGGAGAGG + Intronic
1014760853 6:125355388-125355410 GGGAGGAGGTTAGAGAGGTGGGG + Intergenic
1014913294 6:127118575-127118597 GGCAGGGAGGGGGAGAGGAGGGG - Intergenic
1015156434 6:130101621-130101643 GGCAGGGGGACTGAGAGCAGTGG + Intronic
1017006600 6:150032083-150032105 AGCAGGAGGTGGGAGAGGGGAGG - Intergenic
1017259649 6:152371617-152371639 GGGAGGAGAGGGGAGAGGAGGGG + Intronic
1017689792 6:156952580-156952602 GGCAGCAGGCCGGTGAGCAGTGG + Intronic
1017960509 6:159217018-159217040 GGCTGGAGGTGGGAGCGGTGGGG + Intronic
1017975207 6:159350906-159350928 AGCAGGAGGGTGGAGAGAAGTGG - Intergenic
1018374884 6:163201557-163201579 GGCAGGAGGTGGATGAGTAGGGG - Intronic
1018844645 6:167547293-167547315 GGCAGGAGGAGGGAGGAGAGAGG - Intergenic
1018850601 6:167587752-167587774 GAGAGGAGGCAGGAGAGGAGAGG + Intergenic
1018910837 6:168100276-168100298 GGCAGGGGGTGGGGGAGGTGGGG + Intergenic
1018936255 6:168275819-168275841 GGCAGGAGTGCAGAGATGAGAGG - Intergenic
1019057276 6:169232573-169232595 AGCAGGAGGAAGGAGAGGAAGGG - Intronic
1019144185 6:169966369-169966391 GGCAGCAGGTCGCAGGGGAGGGG - Intergenic
1019210893 6:170403864-170403886 GGCAGAAGGTGTGAAAGGAGAGG - Intronic
1019246712 6:170714203-170714225 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1019258147 7:64712-64734 GGGAGGGGGGCTGAGAGGAGGGG - Intergenic
1019292973 7:259248-259270 GGCAGGAGGATGGGGAGGTGAGG - Intronic
1019335725 7:481634-481656 GGGAGGAGGTTGGGGAGGGGAGG - Intergenic
1019494961 7:1333446-1333468 GGAGGGAGGAGGGAGAGGAGGGG - Intergenic
1019517431 7:1446202-1446224 GGGGGGAGGAGGGAGAGGAGGGG + Intronic
1019517440 7:1446221-1446243 GGGGGGAGGAGGGAGAGGAGGGG + Intronic
1019517449 7:1446240-1446262 GGGGGGAGGAGGGAGAGGAGGGG + Intronic
1019517488 7:1446346-1446368 GGGGGGAGGAGGGAGAGGAGGGG + Intronic
1019801395 7:3090913-3090935 AGCAGGAGGTCAGAGTGGAAAGG + Intergenic
1020001888 7:4760975-4760997 GGCAGCAGGTCGGACAAGTGGGG - Intronic
1020005643 7:4782645-4782667 TGCAGGAGGTCTGTGAGGTGAGG - Intronic
1020080083 7:5282385-5282407 GGGAGGAGGGTGGAGGGGAGGGG + Intronic
1020328893 7:6998463-6998485 GGCAGGAGATAGGAGAGGGCTGG - Intergenic
1020445298 7:8261880-8261902 GGCCGGAGGGAGGAGGGGAGGGG + Intronic
1021164672 7:17322145-17322167 GAAAGGAGGTAGGAGTGGAGAGG + Intronic
1021167638 7:17360292-17360314 GGCAGGAGAGCAGAGAGGAGCGG - Intergenic
1021467252 7:20958921-20958943 GGCAGGTGACAGGAGAGGAGAGG - Intergenic
1022112216 7:27238833-27238855 TCCAGGAGGGTGGAGAGGAGGGG + Intergenic
1022342950 7:29486013-29486035 GGCAGGAGGTGGAAGGGGGGTGG - Intronic
1022437339 7:30401857-30401879 GGAAGGAGAGAGGAGAGGAGAGG - Intronic
1022575499 7:31493195-31493217 GGCAGGAGGAGGGACAGGTGAGG - Intergenic
1022776159 7:33529606-33529628 GGAAGGGGATGGGAGAGGAGGGG - Intronic
1022911151 7:34900524-34900546 AGCAGGAGGTCGGAGTGAGGTGG + Intergenic
1023293641 7:38692490-38692512 GGCATGGGGTCGGGCAGGAGAGG - Intergenic
1023881757 7:44325012-44325034 GCGGGGAGGTCAGAGAGGAGGGG - Intronic
1023917026 7:44597134-44597156 GGGAGGAGGGGGGAGAGGGGAGG + Intergenic
1023991712 7:45132605-45132627 GGGAGGAGGTGGGAGAGGGAGGG + Intergenic
1024133188 7:46377638-46377660 CCCAGGAGGTTCGAGAGGAGTGG + Intergenic
1024352804 7:48384391-48384413 GGCAGGAGCTGCTAGAGGAGAGG + Intronic
1025198689 7:56949383-56949405 GGAAGGAGAGGGGAGAGGAGGGG - Intergenic
1025198838 7:56949831-56949853 GGGAGGAGGGTGGAGAGGAGGGG - Intergenic
1025673108 7:63627102-63627124 GGGAGGAGGGTGGAGAGGAGGGG + Intergenic
1025673259 7:63627548-63627570 GGAAGGAGAGGGGAGAGGAGGGG + Intergenic
1025835280 7:65087288-65087310 GGCAGGGGGTTGGGGAGGGGAGG + Intergenic
1025905056 7:65776761-65776783 GGCAGGGGGTTGGGGAGGGGAGG + Intergenic
1025912774 7:65841165-65841187 GGCAGGAGCTGGGAAAGAAGAGG - Intergenic
1026104435 7:67409975-67409997 GGGAGGAGGGAGGGGAGGAGAGG - Intergenic
1027233881 7:76286688-76286710 GTCAAGAGGTGGGAGAGGAAAGG + Exonic
1027266605 7:76498285-76498307 GGCTGGAGGTCGGACACGATCGG - Intronic
1027269769 7:76513053-76513075 GGGAGGTGGTGGGGGAGGAGGGG - Intronic
1027317986 7:76996403-76996425 GGCTGGAGGTCGGACACGATCGG - Intergenic
1027320480 7:77006948-77006970 GGGAGGTGGTGGGGGAGGAGGGG - Intergenic
1027539937 7:79453848-79453870 GGGAGGAGGCAGGGGAGGAGGGG + Intergenic
1027566944 7:79807045-79807067 AGCAGGAGGTGGGGGGGGAGGGG - Intergenic
1027572771 7:79891494-79891516 AGGAGGAGGACGAAGAGGAGGGG + Intergenic
1027678160 7:81184835-81184857 GGTGGGAGGAGGGAGAGGAGCGG + Intronic
1028039876 7:86038316-86038338 GGGAGGAGACAGGAGAGGAGAGG - Intergenic
1028046861 7:86130982-86131004 GGCTGGATGTTGGAGAGAAGCGG - Intergenic
1028454892 7:91027890-91027912 GGCAGGGGAGGGGAGAGGAGAGG - Intronic
1029238454 7:99142892-99142914 GGCAGGTGGGCGGAGAGGATGGG + Intronic
1029311937 7:99675631-99675653 GGGAGGGGGGAGGAGAGGAGAGG - Intronic
1029363323 7:100101978-100102000 GGCGGGAGGCGGGTGAGGAGCGG + Intronic
1029388832 7:100261113-100261135 GGGAGGAGTTCGGAGTGGGGGGG + Intronic
1029477718 7:100794896-100794918 GGGAGGAGAGGGGAGAGGAGAGG + Intronic
1029536647 7:101161188-101161210 GGCAGGAGCTGGGAGGGGTGGGG + Exonic
1029727376 7:102416066-102416088 GGCCGGAGGAAGGTGAGGAGAGG - Intronic
1030058934 7:105607766-105607788 GGGAGGAGGAGGGAGGGGAGTGG - Exonic
1031027693 7:116698124-116698146 GGTAGTAGGTTGGAAAGGAGAGG - Intronic
1031910408 7:127511124-127511146 GGCAGGAGGTCAGAGAGAGGAGG + Intergenic
1032077651 7:128843670-128843692 GGCAGGAGGCAGGAAAGGCGTGG - Intronic
1032123807 7:129176129-129176151 GGAAGGGGAGCGGAGAGGAGGGG + Intergenic
1032197662 7:129798756-129798778 GGCTTGAGGTGGGAGAGGAGCGG + Intergenic
1032672897 7:134101224-134101246 GGCAGAAGGTCAGAGAAGAGGGG + Intergenic
1033159136 7:138981373-138981395 GGAGGGAGGCCGGAGAGGCGGGG + Intergenic
1033602176 7:142896397-142896419 GGCAGGAGGGAAGAGAGGTGGGG - Intergenic
1033905565 7:146197975-146197997 GGCAGCAGGAGGGAGAGAAGAGG + Intronic
1034023429 7:147670561-147670583 GGCTGGATGTTGGAGAGAAGTGG + Intronic
1034219253 7:149431631-149431653 GGGAGGAGGGACGAGAGGAGAGG + Exonic
1034279053 7:149838799-149838821 GGGAGGGTGGCGGAGAGGAGCGG + Intronic
1034393876 7:150805194-150805216 GGCAGGAGGTTGGGGAGCTGTGG - Intergenic
1034412334 7:150947910-150947932 GGGAGGAGAACAGAGAGGAGGGG + Intronic
1034448259 7:151124341-151124363 GAAAGGAGGTGGGAGAGGTGAGG - Intronic
1034491741 7:151396510-151396532 GGGAGGAGGTAGGGGAGCAGCGG + Intronic
1034503553 7:151467761-151467783 GGCAGGAAGACGGGCAGGAGAGG - Intronic
1035203279 7:157279769-157279791 GGCCGGAGGTCGGAGGAGGGAGG + Intergenic
1035253911 7:157614114-157614136 AAAAGGAGGACGGAGAGGAGGGG + Intronic
1035264687 7:157684591-157684613 GGGAGGGGGGCGGAGGGGAGGGG - Intronic
1035291215 7:157840534-157840556 GGCAGGGTGTGGGAGTGGAGAGG + Intronic
1035501430 8:93758-93780 GGCAGGAGGTGGGTGGGGACCGG + Intergenic
1035630769 8:1105050-1105072 GGCAGGAAGCCGGAAAGGTGCGG + Intergenic
1035783156 8:2244425-2244447 GGGAGGGGGTGGGAGAGGGGTGG + Intergenic
1035808969 8:2475161-2475183 GGGAGGGGGTGGGAGAGGGGTGG - Intergenic
1035889932 8:3332355-3332377 GTCTGGAGGTGGGTGAGGAGCGG - Intronic
1036200137 8:6763986-6764008 GGAAGGAGATTGGGGAGGAGTGG + Intergenic
1036249714 8:7151353-7151375 GGCAGGAGATAGGAGAGGGCTGG - Intergenic
1036443930 8:8805534-8805556 GGGAGGAGGGGGAAGAGGAGGGG + Intronic
1036561364 8:9902859-9902881 GGCAGGCGGTAGGAAGGGAGAGG - Intergenic
1036677418 8:10846603-10846625 GGCAGCTGGTGGCAGAGGAGAGG + Intergenic
1037098016 8:15008708-15008730 GGGAGGAGGGAGGGGAGGAGGGG + Intronic
1037450743 8:19013840-19013862 GGGCGGAGGGCGGAGAGGCGGGG + Intronic
1037691213 8:21183205-21183227 GGGAGGAGGAGGAAGAGGAGGGG - Intergenic
1037833924 8:22205155-22205177 GTCAGGAGGTAGGAGAGAGGTGG + Intronic
1039063065 8:33587450-33587472 GGAGGGAGGGAGGAGAGGAGGGG - Intergenic
1039400137 8:37262373-37262395 GGCAGGGGGTGGGGGAGGACAGG - Intergenic
1039645528 8:39278189-39278211 GGCTGGATGTCGGAGAGAAGGGG - Intronic
1039971771 8:42326497-42326519 GGCAAGAGGAGGGAGAGGACGGG - Intronic
1039977213 8:42377279-42377301 GGCAGGAGGAAGGAACGGAGCGG - Intergenic
1040523748 8:48199928-48199950 GGGAGGAGGGAGGAGAGGAGGGG - Intergenic
1040550421 8:48433007-48433029 GGCAAGAGGGCGGAGGAGAGGGG + Intergenic
1041024006 8:53665886-53665908 GGGTGGAGGGTGGAGAGGAGGGG - Intergenic
1041263855 8:56045191-56045213 GGAATGAGCTAGGAGAGGAGGGG - Intergenic
1041299375 8:56394777-56394799 GGCAGGAGGTGGTAGAAAAGCGG - Intergenic
1041356996 8:57012025-57012047 GGTGGGAGGAGGGAGAGGAGCGG - Intergenic
1041401354 8:57448728-57448750 GGGAGGAGGAGGGGGAGGAGGGG - Intergenic
1041412378 8:57571090-57571112 GGCAGTGGGGTGGAGAGGAGAGG - Intergenic
1042039598 8:64577988-64578010 GGCAGGAGGTCGTGGAGATGGGG + Intergenic
1042576367 8:70224915-70224937 AGCAGGAGGACAGGGAGGAGCGG - Intronic
1043077735 8:75723063-75723085 GGGAGGAGGCAGAAGAGGAGGGG - Intergenic
1043163014 8:76870028-76870050 GGCAGGAGGTAGAAGAGCATCGG - Intergenic
1043386014 8:79748598-79748620 GGCAGGAGGACAGAGAGGGGAGG - Intergenic
1043433060 8:80213092-80213114 GGCAGGAGCATAGAGAGGAGTGG - Intronic
1043952580 8:86326071-86326093 GGGAGGGGGGAGGAGAGGAGAGG - Intergenic
1044398353 8:91741126-91741148 GGCAGTAGGTCTAAGGGGAGAGG + Intergenic
1044553692 8:93539156-93539178 GGCAGGAAAGGGGAGAGGAGAGG + Intergenic
1044916220 8:97115085-97115107 GGAAGGAGGTGTGACAGGAGAGG + Intronic
1045130024 8:99140656-99140678 GGGAGAAGGACGGGGAGGAGGGG - Intronic
1045254443 8:100508052-100508074 GCCAGGAGCTGGGTGAGGAGTGG + Intergenic
1045540125 8:103076187-103076209 TGGAGGAGGTAGGAAAGGAGAGG - Intergenic
1046534480 8:115491530-115491552 CTCAGGAGGTCGAAGAGAAGAGG + Intronic
1046547464 8:115669232-115669254 GGGAGGAGGGGGGAGAGGCGGGG - Intronic
1047363973 8:124195466-124195488 GGCAGGAGGGAGGAGGGGCGTGG - Intergenic
1047526425 8:125638113-125638135 AGAAGGGGGTGGGAGAGGAGGGG + Intergenic
1047698421 8:127426799-127426821 GGGAGGAGCTGGGGGAGGAGGGG - Intergenic
1048048675 8:130796818-130796840 GGGAGGAGGGGAGAGAGGAGAGG - Intronic
1048055140 8:130855789-130855811 GGCAGAAGGGTGGACAGGAGAGG - Intronic
1048209508 8:132443148-132443170 GGGAGGGGGTCGGGGAGGACTGG + Intronic
1048391025 8:133964637-133964659 GGGAGCAGATGGGAGAGGAGAGG - Intergenic
1048659097 8:136575749-136575771 GGCAGGAGGGCCCAGAAGAGGGG - Intergenic
1049000916 8:139825267-139825289 GGCTGCAGGTCCCAGAGGAGTGG - Intronic
1049279773 8:141738322-141738344 GACAGGAGCTGGGAGAAGAGTGG + Intergenic
1049423048 8:142525271-142525293 GGCGGGAGGCAGGAGAGGCGTGG + Intronic
1049604230 8:143521593-143521615 GGCAGGAGGTGGGACAGGCATGG + Intronic
1049656232 8:143799465-143799487 GGGAGGTGGCCGCAGAGGAGGGG + Intronic
1049689206 8:143951377-143951399 GGGAGGAAGTCCGAGGGGAGCGG + Intronic
1049936555 9:505334-505356 GGCTGGAGGGCGGGGAGGCGGGG + Intronic
1050125466 9:2352666-2352688 GGGAGGAGAGAGGAGAGGAGAGG + Intergenic
1050148682 9:2597491-2597513 TGTAGGAGGAAGGAGAGGAGTGG + Intergenic
1050512424 9:6410196-6410218 GGCGGTAAGTAGGAGAGGAGAGG - Intergenic
1050526201 9:6548974-6548996 GGATGGAGGTCGGGAAGGAGAGG - Intronic
1051099321 9:13502885-13502907 AGCAGGATGGCAGAGAGGAGTGG - Intergenic
1051220517 9:14843697-14843719 GGCAGCAGTTCTTAGAGGAGTGG + Intronic
1051328739 9:16000911-16000933 GGGAGGAGGATGGAGTGGAGTGG + Intronic
1051361160 9:16282875-16282897 GGCAGGAGGTGGAAGACGGGAGG + Intergenic
1051394961 9:16609854-16609876 GACAGGAGTCCTGAGAGGAGGGG - Intronic
1051418645 9:16870235-16870257 GGCAGGAGCTCGGGGAAGAGAGG - Intronic
1051459346 9:17294819-17294841 GGGGGGAGGGCGGGGAGGAGGGG + Intronic
1051521665 9:17996217-17996239 GGCAGGAGGTGGGTGGAGAGTGG - Intergenic
1052050915 9:23849258-23849280 GGGAAGAGGGAGGAGAGGAGAGG + Intergenic
1052351560 9:27464205-27464227 GGCAGGAGGTGGTAGGGGTGGGG + Intronic
1052854826 9:33400840-33400862 GGCTGGAGGAGGGAGAGCAGGGG + Intronic
1053451961 9:38201181-38201203 GGCAGGAGGTAGAGGTGGAGAGG - Intergenic
1053578317 9:39376101-39376123 GGCTGGAGGAAGGAGAGTAGGGG - Intergenic
1053622984 9:39839803-39839825 TGTGGGAGGTGGGAGAGGAGTGG + Intergenic
1053682844 9:40497159-40497181 GGCTGGAGGAGGGAGAGCAGGGG + Intergenic
1053881889 9:42603424-42603446 TGTGGGAGGTGGGAGAGGAGTGG - Intergenic
1053890783 9:42690864-42690886 TGTGGGAGGTGGGAGAGGAGTGG + Intergenic
1053932826 9:43125473-43125495 GGCTGGAGGAGGGAGAGCAGGGG + Intergenic
1054099901 9:60934912-60934934 GGCTGGAGGAAGGAGAGTAGGGG - Intergenic
1054121300 9:61210535-61210557 GGCTGGAGGAAGGAGAGTAGGGG - Intergenic
1054220913 9:62410890-62410912 TGTGGGAGGTGGGAGAGGAGTGG - Intergenic
1054229801 9:62498282-62498304 TGTGGGAGGTGGGAGAGGAGTGG + Intergenic
1054280870 9:63127769-63127791 GGCTGGAGGAGGGAGAGCAGGGG - Intergenic
1054295944 9:63332659-63332681 GGCTGGAGGAGGGAGAGCAGGGG + Intergenic
1054393960 9:64637154-64637176 GGCTGGAGGAGGGAGAGCAGGGG + Intergenic
1054428609 9:65142366-65142388 GGCTGGAGGAGGGAGAGCAGGGG + Intergenic
1054501770 9:65879176-65879198 GGCTGGAGGAGGGAGAGCAGGGG - Intronic
1054586442 9:66971973-66971995 GGCTGGAGGAAGGAGAGTAGGGG + Intergenic
1054995383 9:71381923-71381945 GGAAGTAGGTCTGAGAAGAGAGG - Intronic
1055574559 9:77648219-77648241 GGCGGGAGGTAGGCGCGGAGTGG + Exonic
1056242977 9:84668279-84668301 GGCAGGAGCTCGGCGAGGCCAGG + Intergenic
1056271724 9:84953999-84954021 GGAAGGAGGGCGGAGAGGCAGGG + Intronic
1056428960 9:86507546-86507568 GGGAGGAGGACCGAGAGGAAGGG + Intergenic
1056470834 9:86903317-86903339 GGGAGGAGGGAGGAGAGGGGAGG - Intergenic
1056844436 9:90025140-90025162 TGCAGAAGGACTGAGAGGAGAGG + Intergenic
1056972538 9:91219095-91219117 GGAAGGAGGGAGCAGAGGAGAGG + Intronic
1057147505 9:92768182-92768204 GGCTGGATGTTGGAGAGAAGCGG - Intergenic
1057226415 9:93295689-93295711 GACGGGAGGATGGAGAGGAGAGG - Intronic
1058014035 9:100009799-100009821 AGAAGGAGGTTAGAGAGGAGGGG - Intronic
1058947315 9:109869867-109869889 GGCAGGAGGTGGGTGAGGTGGGG + Intronic
1058969159 9:110064358-110064380 GCTAGGAGGTCGGACAGGAGAGG - Intronic
1059386628 9:113969640-113969662 GGCAGGAGAGGGGAGAGGGGTGG + Intronic
1059735293 9:117094175-117094197 GGAGGGAGGGAGGAGAGGAGAGG + Intronic
1060017560 9:120099760-120099782 GGCAGGAGGCATGAGAGGTGAGG - Intergenic
1060223456 9:121776316-121776338 GGCTGGAGGAGGGCGAGGAGCGG + Exonic
1060403179 9:123360266-123360288 GGCAGCAGGTCGAAGGGGAGGGG + Intronic
1060494230 9:124106256-124106278 GGGAGGAGAGAGGAGAGGAGAGG - Intergenic
1060756810 9:126219728-126219750 GAGAGGAGGTCGGAGAAGGGGGG - Intergenic
1060815172 9:126631388-126631410 GGCAGGAGGTCAGGAAGAAGAGG + Intronic
1060885131 9:127146212-127146234 GGCAGGAGGGAGGAGGGGTGTGG - Intronic
1060925422 9:127452143-127452165 GGCTGGACGTCGGAGAGGGAGGG + Intronic
1060941545 9:127545683-127545705 GGCAGGAGGGCTGGGAGGAGAGG + Intronic
1061258030 9:129464104-129464126 TGCAGGGGCTCAGAGAGGAGAGG - Intergenic
1061504964 9:131026582-131026604 GGCTGCAGGTCAGGGAGGAGCGG + Exonic
1061651519 9:132054262-132054284 AGCAGGAGCACTGAGAGGAGCGG - Intronic
1061660732 9:132128443-132128465 GGCAGGAGGGCAGAGAAGGGAGG - Intergenic
1061854918 9:133436803-133436825 GCCAGGAGGAGGCAGAGGAGGGG - Intronic
1061967630 9:134025237-134025259 AGGAGGAGCTGGGAGAGGAGGGG - Intergenic
1062163286 9:135092010-135092032 GGCAGGAGGCCTGTGAGGGGCGG + Intronic
1062196359 9:135276392-135276414 GGCAGGAGGTTGGAGGGGTTGGG - Intergenic
1062352385 9:136145519-136145541 GGGAGGAGGGGAGAGAGGAGTGG - Intergenic
1062366191 9:136210279-136210301 GGCTGGAGGTGGGACTGGAGTGG + Intronic
1062469640 9:136696883-136696905 GGAAGGAGGGCAGGGAGGAGGGG - Intergenic
1062469673 9:136696945-136696967 GGAAGGAGGCCAGGGAGGAGGGG - Intergenic
1062545118 9:137058988-137059010 GGCAGCAGGTGGCAGGGGAGGGG - Intergenic
1062614859 9:137391648-137391670 GGCCGGCGGTCGGCGAGGCGGGG - Intronic
1203607485 Un_KI270748v1:69654-69676 GGCAGGAGGTGGGTGGGGACCGG - Intergenic
1185463149 X:341517-341539 GGCAGGAGGAGGGGCAGGAGGGG - Intronic
1185573765 X:1154355-1154377 GAGAGGAGGTAGGGGAGGAGGGG - Intergenic
1185688336 X:1948468-1948490 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1185688614 X:2133990-2134012 GGGAGGAGGAGGAAGAGGAGGGG + Intergenic
1185713025 X:2319244-2319266 TGCAGGAGTAGGGAGAGGAGGGG - Intronic
1186070238 X:5811533-5811555 AGGAGGAGGTGAGAGAGGAGGGG - Intergenic
1186177646 X:6942053-6942075 GGCAGGAGGAGGGAGGCGAGGGG + Intergenic
1186381412 X:9064087-9064109 AGCAGGAGGAAGAAGAGGAGGGG - Intronic
1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG + Intronic
1187365315 X:18661686-18661708 GCCAGGCTGTCGGAGAAGAGTGG - Intronic
1188599275 X:31941498-31941520 GACAGGAGGATGGAGAGAAGTGG - Intronic
1188679129 X:32979906-32979928 GGAGGGAGGTTGGAGAGAAGTGG + Intronic
1189116808 X:38351374-38351396 GGTAGGAGGAAGGAGAGGAGGGG - Intronic
1189120912 X:38393961-38393983 GGCAGGAGGTTAGAAATGAGAGG - Intronic
1189240194 X:39518984-39519006 GGCAGGAGGTCGGGGGGTTGGGG - Intergenic
1189321056 X:40087717-40087739 GGATGGAGGTGGGGGAGGAGTGG - Intronic
1189511422 X:41665880-41665902 GGCAGGGGAAAGGAGAGGAGGGG + Intronic
1189668123 X:43379139-43379161 GGGAGGAGAGAGGAGAGGAGAGG + Intergenic
1189823978 X:44898527-44898549 GGAGGGAGGTGGGAGTGGAGTGG + Intronic
1190076366 X:47320220-47320242 GACAGGATGTCGGAGATGACAGG - Intergenic
1190221448 X:48514874-48514896 GGCAGGAGATAGGAGTGGGGAGG + Intronic
1191975683 X:66868706-66868728 GGGAGGGGGTAGGAGAGGGGAGG - Intergenic
1192127853 X:68518628-68518650 GGCAGGTGGTGGGAGAGGAGAGG + Intronic
1192201304 X:69068433-69068455 GGCAGAAGGGCAAAGAGGAGGGG + Intergenic
1192286704 X:69746057-69746079 GGAAGGAAGAGGGAGAGGAGGGG - Intronic
1192435409 X:71140584-71140606 GGCATGAGGGAGGTGAGGAGAGG - Intronic
1192473461 X:71419581-71419603 GGCAGGGAGCCGGAGAAGAGGGG + Intronic
1192801298 X:74467101-74467123 GGCAGGAAGATGGAGGGGAGGGG - Intronic
1192978118 X:76307604-76307626 GCCAGGGGGTCAGAGAGGAGTGG + Intergenic
1193380328 X:80809672-80809694 CGGAGGAGGAAGGAGAGGAGAGG + Exonic
1194615933 X:96103516-96103538 GGCTGGATGTTGGAGAGAAGCGG - Intergenic
1194959888 X:100223160-100223182 GGCTGGAGGTGGGTGAGGCGAGG - Intergenic
1195924605 X:110012972-110012994 GCCAGGAGGTCAGACAGGATTGG + Intronic
1196025044 X:111033305-111033327 AGGAGGAGGAGGGAGAGGAGGGG - Intronic
1196890059 X:120283014-120283036 GGCAGGAGGAGGGAGAGAAGAGG + Intronic
1196919788 X:120574080-120574102 GGCAGGTGATGGGGGAGGAGGGG - Intronic
1197712897 X:129684829-129684851 GGCAGGAGGTATGAGAGCAAAGG + Intergenic
1197751070 X:129963859-129963881 GGGAGGAGAGGGGAGAGGAGAGG + Intergenic
1198178072 X:134174582-134174604 GGAAGGAGGACTGGGAGGAGGGG - Intergenic
1198278273 X:135117824-135117846 GGCTGTAGGATGGAGAGGAGGGG - Intergenic
1198292689 X:135254692-135254714 GGCTGTAGGATGGAGAGGAGGGG + Intronic
1198765406 X:140075098-140075120 GGCAGGAGGTGAGTGAGGAGTGG - Intergenic
1198771764 X:140138300-140138322 GGCAGGAGGTGAGTGAGGAGTGG - Intergenic
1199473655 X:148222555-148222577 GGTGGGAGGAGGGAGAGGAGTGG - Intergenic
1200002647 X:153069940-153069962 GGCAGGGGGGCGGGGAGGACTGG + Intergenic
1200005076 X:153080069-153080091 GGCAGGGGGGCGGGGAGGACTGG - Intergenic
1200045909 X:153400991-153401013 GGAAGGAGGGCTGAGGGGAGGGG - Intergenic
1200119613 X:153784134-153784156 AGCAGGAGGCAGGAGAGAAGAGG - Exonic
1200129170 X:153831565-153831587 GGGAGGTGGTGGGAGAGAAGAGG - Intergenic
1200180983 X:154150554-154150576 GGCAGGAGGGCGGAAGGGGGAGG + Intronic
1200186626 X:154187668-154187690 GGCAGGAGGGCGGAAGGGGGAGG + Intergenic
1200192278 X:154224806-154224828 GGCAGGAGGGCGGAAGGGGGAGG + Intronic
1200198033 X:154262610-154262632 GGCAGGAGGGCGGAAGGGGGAGG + Intronic
1200236845 X:154471921-154471943 GGCAGGAGGACATAGAGGTGTGG + Intronic
1201123460 Y:10892225-10892247 GGCAGGAGAGTGGAGAGGAGTGG - Intergenic
1201452975 Y:14136169-14136191 GGAAGGAGGGAGGAGAGGTGAGG - Intergenic