ID: 1142000421

View in Genome Browser
Species Human (GRCh38)
Location 16:87661194-87661216
Sequence AGGGAGGCAGGAGGTCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1190
Summary {0: 1, 1: 0, 2: 8, 3: 144, 4: 1037}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000421_1142000432 3 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000421_1142000431 2 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110
1142000421_1142000430 1 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000421_1142000428 -4 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000421 Original CRISPR AGGGAGGCAGGAGGTCGGAG AGG (reversed) Intronic
900115450 1:1026013-1026035 AGGGAGTGAGGTGGTGGGAGGGG + Intronic
900384019 1:2401227-2401249 AGGGAGGAAGGAGGGAGGAAGGG - Intronic
900466453 1:2827866-2827888 AGGGAGGAGGGAGGTGTGAGGGG + Intergenic
900486465 1:2925024-2925046 GAGGAGGCAGGGGGTCAGAGCGG + Intergenic
900717814 1:4156481-4156503 TGGGAGGCAGGAGGGGGCAGAGG + Intergenic
900766380 1:4508762-4508784 AGAGAGGCAGGAGGTCCCAGGGG - Intergenic
900892677 1:5460926-5460948 AGGGAAGATGGAGGCCGGAGTGG + Intergenic
900913371 1:5617720-5617742 GGGGGGGCAGGGGGTGGGAGAGG - Intergenic
901018570 1:6244985-6245007 AGGGAGGGAGGAGAGGGGAGTGG - Intronic
901101422 1:6722043-6722065 TGGGAGGCCCGAGGTGGGAGAGG - Intergenic
901266422 1:7914203-7914225 AGGGAGGGGGGAGGGGGGAGAGG - Intergenic
901381684 1:8878698-8878720 AGCTAGGCAGGAAGTCGGCGCGG - Intronic
901808177 1:11750710-11750732 AGGGAGGCTGGAGGTTGTGGTGG - Exonic
901906291 1:12414603-12414625 GGGGAGGAAGGAGGAGGGAGTGG + Intronic
902068686 1:13712942-13712964 AGGGAGCCAGGATGTTGGTGTGG - Intronic
902223351 1:14980859-14980881 AGGGAGGCAGGAGGGGGAGGTGG + Intronic
902597991 1:17522116-17522138 AAGGAGGCAGGAGGTGAGAGTGG + Intergenic
902613476 1:17610506-17610528 AGGGAGACAGGAGGTTGCGGAGG + Intronic
902631910 1:17709835-17709857 AGGGATGGAGGAGCTCAGAGGGG + Intergenic
902698777 1:18157575-18157597 TGGGAGGCAGAAAGTCAGAGCGG - Intronic
902799278 1:18819400-18819422 AGGGAGGGAGGCTGTCGGGGAGG - Intergenic
902808765 1:18876479-18876501 AGGGAGGAGGGAGGTCTAAGAGG + Intronic
902940485 1:19797389-19797411 AGGGAGGCAGGGGGTAGAAGTGG + Intronic
903041179 1:20531899-20531921 AAGGAGGCAGAAGGTGGGTGTGG + Intergenic
903222231 1:21875378-21875400 AGGGACGCAGGAGGGGGGAGGGG - Intronic
903394078 1:22985955-22985977 AGGGAAGGAGGAGGTTGAAGTGG - Intergenic
903579706 1:24361622-24361644 GGGGAGGCAGGAGGCAGGAGTGG + Intronic
903733483 1:25515160-25515182 TGGGAGGAAGGAGGTTGGAGAGG - Intergenic
903907831 1:26697947-26697969 AGGAAGGCCGGGGGACGGAGAGG - Intronic
903995949 1:27305673-27305695 AGGGAAGCAGTAGGGCAGAGGGG - Intronic
904028178 1:27518073-27518095 GGGAAGGCAGGAAGTCAGAGAGG - Intergenic
904035596 1:27557062-27557084 AGGGAGGAAGGGGGTGGGCGAGG - Intronic
904087175 1:27917071-27917093 AGGGAGGAAGGAGGAAGGAAGGG - Intergenic
904089953 1:27937789-27937811 ACTGAGGCAGGAGGTGGGACTGG + Intronic
904284188 1:29443507-29443529 AAGGAGGTGGGAGGTGGGAGGGG + Intergenic
904291699 1:29490395-29490417 GGGGAAGGAGGAGGTGGGAGAGG + Intergenic
904311128 1:29630227-29630249 TGGGGGGCAGGAGGTCTGGGCGG - Intergenic
904455376 1:30644818-30644840 AGGGAGGAAGAAGGAAGGAGAGG - Intergenic
904463228 1:30692734-30692756 AGAGAGGGAGGAGGAGGGAGAGG + Intergenic
904483008 1:30805767-30805789 AGGGAGGCAAGAGGGGGAAGTGG + Intergenic
904624630 1:31795517-31795539 AGAGAGAGAGGAGGTGGGAGGGG - Intronic
904663966 1:32105875-32105897 CTGGAGGCAGGAGGCCAGAGAGG + Intergenic
904770087 1:32876248-32876270 GGGGAGGGAGGAGGACGGGGAGG + Intergenic
904807474 1:33142111-33142133 AGGGAGGTGGGAGGTGGGAGAGG - Intergenic
905295490 1:36951841-36951863 AAGGAGGTTGGAGGGCGGAGGGG + Intronic
905319847 1:37108111-37108133 AGAGAGACAAGAGGTGGGAGAGG + Intergenic
905443474 1:38009262-38009284 AGGGAGGGAGGAGGACAGATAGG - Intronic
905674583 1:39816650-39816672 AGGGATGCAGGGGGTGCGAGAGG + Intergenic
905783155 1:40730449-40730471 AGGGAGGCCCGAGGTGGGAATGG + Intronic
906107002 1:43300706-43300728 AAGGAGGCAGGAGGCAGGAAAGG - Intergenic
906192177 1:43905497-43905519 AGGGGAACAGGAGGACGGAGAGG - Intronic
906501239 1:46342877-46342899 AGAGAGGCAGGAGGGAGGTGGGG - Intronic
906591018 1:47024011-47024033 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
906603480 1:47148831-47148853 AGACAGGCAGGAGATAGGAGTGG - Exonic
907240658 1:53079213-53079235 GGGGAGGCAGGAGGTGGGTCAGG + Intronic
907303766 1:53502911-53502933 AGGGAGACAGGAGAGGGGAGGGG + Intergenic
907403327 1:54238935-54238957 TGGGCGGCAGGGGGTGGGAGAGG - Intronic
907494724 1:54836252-54836274 AGGCAGGCGGGAGGGCGAAGGGG - Intronic
907524379 1:55045657-55045679 AGGGAGTCAGGAGGTAGGGAGGG + Intronic
907560789 1:55385672-55385694 AGGAAGGAAGGAGGGAGGAGAGG - Intergenic
907884382 1:58579274-58579296 AGGGTGGACCGAGGTCGGAGAGG - Intergenic
908064238 1:60385343-60385365 AGGAAAGCAGGAGGTCAGAAAGG - Intergenic
908360874 1:63367583-63367605 ACGGAGGCGGAAGGCCGGAGGGG + Exonic
908509178 1:64837545-64837567 AGGGAGGCTGTAGGACAGAGTGG - Intronic
909307036 1:74094376-74094398 AGGGAGGCAGGACATTAGAGAGG + Intronic
909382773 1:75018864-75018886 AGGAAGGAAAGAGTTCGGAGTGG - Intergenic
909716842 1:78718444-78718466 AGGGAGGGAGGATGTAGGAAGGG - Intergenic
911086040 1:93978275-93978297 AAGGAGAAAGGAGGTCTGAGTGG + Intergenic
911439466 1:97907681-97907703 AGGGAGGGAGGAGGAAGCAGGGG - Intronic
912469298 1:109895619-109895641 AGGGGGTGAGGAGGTCGAAGAGG + Intergenic
912497988 1:110103525-110103547 AGGGAGGCAGTATTTTGGAGAGG + Intergenic
912556478 1:110519869-110519891 AGGCAGGCTGGGGGTGGGAGTGG + Intergenic
912761082 1:112368119-112368141 AGCAAGGTAGGAGGTGGGAGGGG - Intergenic
912927081 1:113922686-113922708 AGGGAGGAAGGATGTCAGGGAGG - Intergenic
913985847 1:143565361-143565383 AGAGAGGTACGAGGTCTGAGAGG + Intergenic
914846536 1:151286807-151286829 AGGGAGGCAGCGGATCTGAGTGG - Exonic
914900916 1:151710599-151710621 AGGGAGGCAGGAGAAGGGATGGG - Intronic
915016495 1:152738755-152738777 AGAGCAGCAGGAGGTGGGAGGGG + Intronic
915076196 1:153309699-153309721 GGGGAGGGAGGAGCCCGGAGAGG + Intronic
915117589 1:153610413-153610435 AAGGAGGCAGGTGGTGGGAGAGG - Intronic
915145596 1:153794316-153794338 AGGGATGGAGGTGGCCGGAGTGG + Intergenic
915329838 1:155104000-155104022 AGGGAGGGAGGAGGGAGGAAGGG + Intergenic
915878511 1:159640489-159640511 AAGAAGGCAGGAGGTAGGATGGG - Intergenic
915943690 1:160135072-160135094 AGAGAGGCAGGGGGCAGGAGGGG + Intronic
915978458 1:160405767-160405789 AGTGAGGAAGGAGGAAGGAGAGG + Intronic
916499807 1:165376796-165376818 AGGGAGGCAGGGAGGTGGAGAGG - Intergenic
916531553 1:165661121-165661143 AGGAGGGCAGAAGGTCAGAGAGG + Intronic
916588094 1:166165837-166165859 AGGGAGGAGGGAGGTGGGAGAGG + Intronic
916696497 1:167242935-167242957 AGAGAGGCAGGTGGAAGGAGGGG - Intronic
916874898 1:168958755-168958777 AAGGAGGCAGGCTGTCAGAGGGG - Intergenic
917647551 1:177044223-177044245 AGGGAGAGAGGAGGTAGGACAGG - Intronic
917735433 1:177915793-177915815 GGTGAGGCAGGAGGAGGGAGTGG - Intergenic
918094805 1:181325829-181325851 AGGAAGGGAGGAGTTCCGAGAGG - Intergenic
918125796 1:181582294-181582316 TGGGAGGCAGCAGGAAGGAGGGG + Intronic
918211841 1:182358140-182358162 AGGTGGGCAGGAGGAGGGAGTGG + Intergenic
919058842 1:192605796-192605818 AGGGAGGGAGGAGGAGGGAGGGG + Intergenic
919789044 1:201278230-201278252 AAGAAGGCAGGAGGTGGGAGGGG + Intergenic
919842835 1:201622111-201622133 AGGGTGGCAGGAGGTGGCAGAGG + Intergenic
920531265 1:206704302-206704324 ACGGATGGAGGAGGTCGGATGGG + Intronic
920646702 1:207809060-207809082 AAGAAGGTAGGAGGTGGGAGAGG - Intergenic
920728378 1:208459282-208459304 ATGCAGTCAGGAGGTAGGAGAGG - Intergenic
920783098 1:209013540-209013562 AGGGAGGTAGGTGGTGGCAGTGG - Intergenic
920886961 1:209938426-209938448 CGGGAGGCGGGTGGGCGGAGCGG + Intronic
921363457 1:214351827-214351849 AGGGAGGCAGGGAGTAGGAGAGG + Exonic
921546003 1:216475734-216475756 AGGGAGGGAGGGGGAGGGAGGGG + Intergenic
921559379 1:216639133-216639155 TGGGAGGCAGGAGTAGGGAGGGG + Intronic
922279988 1:224114404-224114426 AGGGAGGCAGGAGTTCTGCGGGG - Intronic
922469984 1:225870446-225870468 AGGGAGCCAGGAGGCGGGGGGGG - Intronic
922643450 1:227260469-227260491 AGGGAGGAAGGAGGTTGGATGGG - Intronic
922723279 1:227909780-227909802 GGGGAGGGAGGAGGCAGGAGGGG + Intergenic
922784290 1:228275500-228275522 AGGGGAGCTGGAGGTGGGAGCGG + Intronic
923010309 1:230083189-230083211 AGGGAGCCAGGATGATGGAGCGG + Intronic
923551869 1:234970586-234970608 AGGGAAGGAGGAGGGTGGAGAGG - Intergenic
924064874 1:240210667-240210689 TGGGAGGCAGTAGGAGGGAGAGG + Intronic
924150755 1:241126670-241126692 TGGGGGGCTGGAGGTAGGAGGGG - Intronic
924202563 1:241675058-241675080 AGGGAGGCAGGAAGGAGGAAGGG - Intronic
924458199 1:244234902-244234924 AGTGAGGGAGGAGGCAGGAGAGG + Intergenic
924615927 1:245611986-245612008 AAGGAGGCAGGAGGGTGGAGTGG - Intronic
1062824490 10:557836-557858 AGGCAGGCAGGAAGGGGGAGGGG + Intronic
1062833593 10:622289-622311 AGGGAGGGAGGAGGGGGGAGAGG + Intronic
1062941325 10:1423374-1423396 CAGGAGCCAGGAGGCCGGAGGGG - Intronic
1063145250 10:3290068-3290090 GATGAGGCAGGAGGTAGGAGAGG - Intergenic
1063478754 10:6351750-6351772 AGGCAGGCAGGTGGTTGGATGGG + Intergenic
1064407308 10:15075616-15075638 AGGGAGGAGGGAGGTGGGTGTGG - Intergenic
1064414454 10:15136418-15136440 AGGGAGGAAGGAGGAAGGAGAGG + Intronic
1064455939 10:15487648-15487670 AAGGATGCTGGAGGTCGGGGAGG - Intergenic
1065728718 10:28691552-28691574 AGGGAGGGAGGGGGAGGGAGGGG - Intergenic
1066226844 10:33392153-33392175 AGCAAGGCAGGAGGAAGGAGAGG + Intergenic
1066490848 10:35893221-35893243 TGGGAGGCAGGGAGTGGGAGAGG - Intergenic
1067686249 10:48467367-48467389 AGGAAGGCAGGTGGACAGAGAGG + Intronic
1068033501 10:51731998-51732020 AGGGAGGGACGGGGGCGGAGGGG - Intronic
1069132088 10:64718376-64718398 AGGGAAGCAGGAGATCAGAGAGG - Intergenic
1069274042 10:66567073-66567095 AGGGAGGGAGGAGTGGGGAGGGG + Intronic
1069654094 10:70075131-70075153 ACGGAGGCAGGGGGTCAGAGTGG - Intronic
1069779456 10:70945677-70945699 AGGCAGGCAGGAGGTAGTTGGGG - Intergenic
1070140429 10:73734058-73734080 AGGGAGGAAGAAGGTGGGGGGGG - Intergenic
1070234740 10:74611645-74611667 GGGGAGGCAGGAAGTGGGTGGGG - Intronic
1070537731 10:77392161-77392183 AGGGAGGGAGGAGGGAGGAGTGG + Intronic
1070628446 10:78067711-78067733 GTGGAGGCAGGAGGTAGCAGTGG + Intergenic
1070642598 10:78180426-78180448 AGGAATGCAGAAGGGCGGAGGGG - Intergenic
1070683043 10:78462433-78462455 AGGGAGGCAGGATGGGGCAGGGG + Intergenic
1070727916 10:78804587-78804609 AGGGATGCAGGGTGTCGGACAGG + Intergenic
1070916837 10:80160597-80160619 AGGGAGGGAGGAGGACGCAGAGG - Intronic
1071134922 10:82442564-82442586 AGGGTGGCTGGAGTTCAGAGAGG + Intronic
1071271205 10:84009311-84009333 AGAGAGGGAGGAGGAGGGAGAGG - Intergenic
1071492885 10:86148012-86148034 AGGGAGGCAGAAAGGAGGAGGGG - Intronic
1071513139 10:86279246-86279268 CTGGAGGCTGGAGGTCTGAGGGG - Intronic
1072454963 10:95567598-95567620 AGGGAGGGAGGGGATGGGAGGGG + Intergenic
1072484454 10:95841780-95841802 AGGGAGGCAGGATATCGGAGTGG + Intronic
1072608345 10:97001413-97001435 AGGGAGGCAGGAGGAAGAGGAGG + Intronic
1072688065 10:97550482-97550504 AGGGAGGCAGGCGGAGGCAGGGG - Intronic
1072758731 10:98038540-98038562 AGGGAGGCCAGAGGTCAGAGGGG + Intergenic
1073006935 10:100331415-100331437 GGGGAGCCAGGAGTTAGGAGAGG - Intergenic
1073059812 10:100726694-100726716 AGGGAGGCAGTAGGTGGCAAAGG + Intergenic
1073192322 10:101660494-101660516 AGGGAGGCGGGAGGGTGAAGGGG - Intronic
1073612408 10:104957654-104957676 AGGGTGGGAAGAGGTAGGAGAGG - Intronic
1073625338 10:105091054-105091076 AGGGAGGGAGGAGTACAGAGTGG - Intronic
1074272317 10:111966666-111966688 AGGGAGGCAGGAGAGGGAAGTGG + Intergenic
1074432704 10:113407385-113407407 AGGCAGGGAGGGGGTTGGAGAGG - Intergenic
1074461549 10:113642682-113642704 AGGGAAGCAAGGGGACGGAGAGG + Intronic
1074542293 10:114374838-114374860 AGGGAGGGAGGGGGTGGGGGTGG + Intronic
1075002701 10:118809827-118809849 AAGGAGCCAGGAGGGCTGAGAGG + Intergenic
1075600395 10:123763412-123763434 TGGGAGGCAGGAGGGTGGATAGG - Intronic
1076109185 10:127848297-127848319 AGGGAGGAAGGAAGTGGGGGGGG + Intergenic
1076370545 10:129950016-129950038 AGGGAGGAGGGAGGAGGGAGGGG + Intronic
1076402659 10:130194053-130194075 AGGGATGCAGGAGGGAGGAAAGG - Intergenic
1076455785 10:130593834-130593856 TTGGAGGCTGGAGGTGGGAGAGG + Intergenic
1076610970 10:131725737-131725759 AGAGAGGCAGGAGCTGGAAGTGG + Intergenic
1076618249 10:131770917-131770939 GGTGGGGCAGGAGGTAGGAGAGG + Intergenic
1076776466 10:132700581-132700603 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1076778089 10:132709265-132709287 AGGGAGGGAGGGGGGAGGAGGGG + Intronic
1077003195 11:335680-335702 AGGGAAGGAGAAGGTCAGAGAGG - Intergenic
1077019146 11:409811-409833 TGAGGGGCAGGAGGTGGGAGTGG + Intronic
1077080941 11:724494-724516 GGGCAGGCAGGAGGTGGGCGTGG - Intronic
1077158380 11:1101653-1101675 CGGGAGGCTGGAGGCCGAAGTGG - Intergenic
1077163257 11:1123131-1123153 AGGGAGGAAGGAAGGGGGAGGGG - Intergenic
1077422533 11:2459703-2459725 TTGTAGGCAGGAGGGCGGAGGGG - Intronic
1077499539 11:2902956-2902978 AGGGAGGCAGAGGCTCGGAGTGG - Intronic
1077554287 11:3218480-3218502 AGGCGGGGAAGAGGTCGGAGAGG + Exonic
1077888844 11:6404812-6404834 AGGGAGGGTGGAGGCAGGAGGGG - Intronic
1077895679 11:6451456-6451478 GGGGAGGGAGCAGGTAGGAGGGG + Intronic
1078190987 11:9092055-9092077 TGGGAGGTGGGAGGTGGGAGTGG + Intronic
1078426244 11:11253509-11253531 AGGCAGGGAGGAGGTAGAAGAGG + Intergenic
1078486849 11:11731274-11731296 AAGGTGGCAGGAGTTCGGGGAGG - Intergenic
1078859227 11:15231986-15232008 AGGTAGGAAGGAGGTTGGCGAGG - Intronic
1078968121 11:16371170-16371192 AGGGAGGGATGAGATCAGAGTGG - Intronic
1079217214 11:18524683-18524705 AGGTAGGGAAGAGGTGGGAGAGG - Intronic
1079437070 11:20467036-20467058 AAGGTGGCAGGAGGTTGGAGTGG + Intronic
1080050239 11:27851964-27851986 AGGGAGGAAGGAGGGAGGGGAGG - Intergenic
1080592891 11:33738825-33738847 AGTGAGGCATGAGGCTGGAGAGG - Intergenic
1080674201 11:34409704-34409726 AAGGAGGCAGCAGTTAGGAGTGG + Intergenic
1081362155 11:42193334-42193356 ATGGAGGCAGGGGGTTGGAATGG + Intergenic
1081734607 11:45394229-45394251 ATGGAGGCAGGAGGCCGGCCAGG + Intergenic
1081803050 11:45872723-45872745 AGGGAGGCATGGGGGCTGAGGGG + Intronic
1082687784 11:56260759-56260781 TGGGAGCCAGGAGTTAGGAGAGG + Intergenic
1083187122 11:61024228-61024250 AGGGAGGGAGGAGGGCAGACAGG - Intergenic
1083270921 11:61572101-61572123 AGGGAGGAATGAGGTTGGGGGGG + Intronic
1083484256 11:62973531-62973553 AGAAAGGCAGGAGATCAGAGTGG - Intronic
1083485661 11:62981615-62981637 AGGCAGGCTGGAGAACGGAGTGG + Intronic
1083513835 11:63237191-63237213 AGGGAGGAAGGAGGGAGGAAAGG + Intronic
1083595428 11:63916571-63916593 GGAGAGGCAGGAGGTCAGCGTGG + Exonic
1083729161 11:64643594-64643616 AGGGAAGGAGGAGAGCGGAGAGG + Intronic
1083822689 11:65181880-65181902 AGGGAGGGCGGAGGGCGGAGGGG + Intronic
1083850383 11:65362584-65362606 AGGAGGGGAGGAGGTCAGAGAGG + Intergenic
1083906214 11:65673077-65673099 AGGGAGACAGCAGGTTGGAGAGG - Intergenic
1084004128 11:66314327-66314349 AGGGAAGCAGGAGCCCAGAGAGG - Intergenic
1084063492 11:66690357-66690379 AGACAGGCAGGAGGTGAGAGTGG - Intronic
1084192069 11:67503933-67503955 AGAGGGGCAGGAGGGCCGAGTGG - Intronic
1084470082 11:69354205-69354227 AGGGCAGCAGGAGGTCGGCTGGG + Intronic
1084858786 11:72005028-72005050 GGGTAGGCAGGAGCTCAGAGAGG - Intronic
1084935736 11:72585644-72585666 TTGGAGGCAGGAGGTTGGATAGG - Intronic
1084941468 11:72615504-72615526 AGGGAGGCAGGAGCTGAGTGTGG + Intronic
1085011261 11:73142785-73142807 AGGCAGGCAGGAGGCGGGGGCGG - Intergenic
1085193009 11:74645470-74645492 AGGGAGGCAGGATGCCGGGATGG + Intronic
1085318780 11:75562048-75562070 AGGGAGGCAGTAGGACCCAGGGG + Intronic
1085326646 11:75611359-75611381 AGGGATGCAGGAGGCTGCAGAGG - Intronic
1085349719 11:75790658-75790680 AAGGTGGCAGGAGGTCACAGTGG + Exonic
1085658869 11:78343420-78343442 AGGGAGACAGAAGGAGGGAGAGG + Intronic
1085671667 11:78471205-78471227 AGGGAAGCAGAAGGTTAGAGAGG + Intronic
1085746768 11:79121741-79121763 AGGGAGGCAGCAGGTGGTGGTGG + Intronic
1085804106 11:79618891-79618913 AGGGAGACAGGAGGACGTGGGGG - Intergenic
1086414151 11:86571858-86571880 TGGGAGGCAGCAGGCAGGAGAGG + Intronic
1086449312 11:86900304-86900326 AGGGAGGCAGGAGGAGGAAGCGG + Intronic
1087786222 11:102357246-102357268 AGGGAGTAAGGAGGGAGGAGGGG - Intronic
1088268522 11:108009860-108009882 AGGGAGGAAGGGGGGTGGAGTGG - Intronic
1088375746 11:109140233-109140255 AGGGAGGGAGGCGGGCAGAGAGG - Intergenic
1088814223 11:113410448-113410470 AGGGGGACTGGAGGTGGGAGGGG + Exonic
1089280614 11:117371766-117371788 AGGGAGGTAGGAAGCAGGAGAGG - Intronic
1089455374 11:118622614-118622636 AAGGAGGCAGGGAGTCTGAGTGG - Intronic
1089589761 11:119532890-119532912 ATGGAGGCAGGGGGTGGGAGTGG - Intergenic
1089831120 11:121329106-121329128 ATGGAGGCAGGAGGTGAGGGAGG - Intergenic
1090321810 11:125851539-125851561 AGTGGGGCAGGAGGTGGGTGTGG - Intergenic
1090450198 11:126799651-126799673 AGGGAGCCAGGAGGAAGGAATGG + Intronic
1090954509 11:131502496-131502518 GGGGAGGCAGGAGCTGGGAGCGG + Intronic
1091250744 11:134141772-134141794 AGGCAGGCAGGTGGCTGGAGAGG + Intronic
1091335872 11:134765210-134765232 AGGGAGGGAGGAAGTGGGAAGGG - Intergenic
1091618939 12:2071129-2071151 AGGGAGGGAGGAGGGGGAAGCGG - Intronic
1091756332 12:3054710-3054732 AGGGAGGCAGGGAGGCAGAGAGG - Intergenic
1091761652 12:3091426-3091448 AGGGAGGCAGGAGGAGGCAGGGG + Intronic
1091976094 12:4827025-4827047 AGAGAGGGAGGAGGGAGGAGAGG - Intronic
1092049079 12:5455218-5455240 AGAGAGACAGGAGCTGGGAGGGG - Intronic
1092290492 12:7157232-7157254 AGGGAGGCAGGTGTACAGAGAGG - Intronic
1092291174 12:7160236-7160258 TGGGAGGCAGGTGGGAGGAGAGG - Intergenic
1092291194 12:7160293-7160315 TGGGAGGCAGGTGGGAGGAGAGG - Intergenic
1092960367 12:13591222-13591244 AGGGTGGAAGGAGGGCTGAGTGG + Intronic
1094299296 12:28943803-28943825 TGGAGGGCAGGAGGTGGGAGAGG - Intergenic
1094541123 12:31364009-31364031 AGGGAGGCAGGAGGGAGTTGGGG + Intergenic
1095581515 12:43806059-43806081 CGGGAAGCAGGAGCGCGGAGAGG + Intronic
1095875099 12:47071421-47071443 AAGGAGGCAGGAGGGCAAAGGGG + Intergenic
1096071212 12:48776428-48776450 ATGGAGGCAGGAGGCCGGGCTGG - Exonic
1096085978 12:48865378-48865400 AGGGACGCAGGAAGGTGGAGGGG + Intronic
1096801983 12:54116480-54116502 AGGGAGGCAGGCGGAAGCAGGGG + Intergenic
1097293926 12:57943072-57943094 AGGGAGGTAGGAGGAGGAAGGGG + Intronic
1097369460 12:58758950-58758972 AGGGTGGCAGGTGGGGGGAGGGG - Intronic
1097949703 12:65414033-65414055 AGGGTAGCAGGAGGTCATAGAGG + Intronic
1100317080 12:93454343-93454365 AGGAAGGCAGGAGGGATGAGGGG - Intergenic
1101876170 12:108598113-108598135 AGGGAGGAAGGAGGAGGGACGGG - Exonic
1101913108 12:108875485-108875507 AGGAAGGAAGGAGGAGGGAGTGG - Intronic
1102016416 12:109650893-109650915 AGGCAGGCAGGAGGAGGGATGGG - Intergenic
1102287958 12:111674628-111674650 AGAGTGGCAGCAGGTCGGGGTGG + Intronic
1102495843 12:113319225-113319247 TGGAAGGCAGGAGGAAGGAGTGG - Intronic
1102598769 12:114012984-114013006 AGAGAGGGAGGAGGGAGGAGAGG + Intergenic
1102598782 12:114013017-114013039 AGGGAGGAGGGAGGAGGGAGAGG + Intergenic
1102635505 12:114320158-114320180 AGGGAGGCAGGATTTCGGAGGGG - Intergenic
1102650913 12:114441831-114441853 AAGGAGGCAGGAGGAGGGAATGG - Intergenic
1102822208 12:115917399-115917421 ATGGAAGCAGGTGGTGGGAGCGG - Intergenic
1102898701 12:116619430-116619452 AGGGAGGAGGGAGGTCAGAGAGG + Intergenic
1102940401 12:116936505-116936527 AGGGAGGCAGGACGTCAGGGAGG + Intronic
1103019463 12:117522328-117522350 AGGGAGGCAGGAGGGTGGTAAGG + Intronic
1103238954 12:119397873-119397895 AGGGAGGAAGGGGGTGGGGGAGG + Intronic
1103738442 12:123075759-123075781 AAGGACACAGGAGGGCGGAGAGG + Intronic
1103893170 12:124254944-124254966 AGGGAGGGAGGAGGAGGGAGGGG + Intronic
1104092054 12:125525726-125525748 AAGGAAGCAGGAGGCAGGAGTGG - Intronic
1104128603 12:125871430-125871452 AGCAAGGCAGCAGGTCAGAGGGG + Intergenic
1104191090 12:126482475-126482497 AGGGAGGGAGGAAGTGGGGGAGG - Intergenic
1104414823 12:128589392-128589414 AGGGAGGCAGGCGGGGTGAGAGG - Intronic
1104958941 12:132479073-132479095 TGGGCCGCAGGAGGCCGGAGTGG + Intergenic
1104958956 12:132479123-132479145 TGGGCCGCAGGAGGCCGGAGTGG + Intergenic
1105008633 12:132739112-132739134 AGGGAGTGAGGAGGAGGGAGAGG + Intronic
1105325897 13:19370499-19370521 AGGGAGGCAGGACGTGGCCGAGG + Intergenic
1105437585 13:20391235-20391257 AGGGAGGCGGGGGGTTGGGGGGG + Intergenic
1105437701 13:20391533-20391555 AGGGAGGCGAGGGGTCGGGGTGG + Intergenic
1105714767 13:23052242-23052264 AGGGAGGCAGGAGGAGGGGGAGG + Intergenic
1105867610 13:24474595-24474617 AGGGAGGCAGGACGTGGCCGAGG - Intronic
1106512284 13:30422012-30422034 AGAGAAGGAGGAGGTGGGAGAGG + Intergenic
1106602123 13:31197124-31197146 AGAGAGGCAGCAGGCTGGAGGGG + Intergenic
1106622698 13:31386306-31386328 AGAGAGGCAGGAGAAGGGAGGGG - Intergenic
1107037508 13:35916862-35916884 AGGGAGGTGGAAGGTCTGAGAGG - Intronic
1107375179 13:39796627-39796649 AGGGAGGGAGGGGGGCAGAGAGG + Intergenic
1108475017 13:50807400-50807422 AGAGAAGCAGGAGGAGGGAGGGG - Intronic
1108590846 13:51911856-51911878 TGGGAGGGAGTGGGTCGGAGAGG - Intergenic
1108759686 13:53547618-53547640 AGGGTGGGAGGAGGTTGGTGAGG - Intergenic
1110831893 13:80041405-80041427 AGGGAGGGAGGAGGTGTGAGGGG - Intergenic
1111048513 13:82847073-82847095 AGGGAGGGAGGAGGGAGGAAGGG + Intergenic
1111721428 13:91950342-91950364 TGGGAGGGAGGAGGAGGGAGGGG - Intronic
1112209769 13:97364222-97364244 GGGGAGGTAGGAGGTGGGAGGGG - Intronic
1112388954 13:98965103-98965125 AGGGAGAGATGAGGCCGGAGTGG + Intronic
1112421058 13:99249171-99249193 AGGGAGGGGGAAGGACGGAGGGG - Intronic
1112655949 13:101452755-101452777 AGGGAGGCGGCAGGAGGGAGAGG - Exonic
1113358579 13:109607167-109607189 AGGGTGGGAGGAGGAGGGAGAGG - Intergenic
1113500605 13:110770860-110770882 GTGGAGGCTGGAGGTGGGAGAGG + Intergenic
1113595589 13:111529715-111529737 AGGGAGGGAGGAGGAGGGGGAGG - Intergenic
1113728857 13:112625408-112625430 AGGGAGGCCGGGGGCAGGAGAGG - Intergenic
1113909766 13:113836442-113836464 AGGGAAGGAGGAGGACGGAGGGG + Intronic
1113930248 13:113964590-113964612 AGGGAGGAAGGAGGGGGGAGAGG - Intergenic
1113954370 13:114089299-114089321 AGGGGGGGAGGAGGGGGGAGGGG + Intronic
1113994381 14:16054464-16054486 AGGGAGGGAGGAGCTCCGGGTGG - Intergenic
1115274488 14:31592294-31592316 TGGGAGGCAGGAGGTGGGTGGGG + Intronic
1115445259 14:33482640-33482662 AGGAAGGCAAGAGATCAGAGAGG - Intronic
1117098794 14:52324248-52324270 AGAGAGGCAGGAGGGTGGGGAGG + Intronic
1117309319 14:54506365-54506387 AGGGAAGCAGGTGGTTGTAGCGG + Intergenic
1117341453 14:54795678-54795700 AGGGACGCATCAGGTCAGAGGGG + Intergenic
1117885351 14:60355653-60355675 TGGGGGGTTGGAGGTCGGAGAGG - Intergenic
1117898583 14:60511004-60511026 AGGGACGCAGGAGGTGGTGGGGG + Intronic
1119646770 14:76354054-76354076 AGGGAGGCAGCAGGACCCAGCGG - Intronic
1119738176 14:76997368-76997390 TGGGAGGTGGGAGGTGGGAGGGG - Intergenic
1120193777 14:81462500-81462522 AGGGCGGCTGGTGGGCGGAGGGG + Intergenic
1120407738 14:84109869-84109891 AGTGAGGCATGAGGTTAGAGAGG + Intergenic
1120635328 14:86943924-86943946 AGGGAGGAAGGAGGGGAGAGAGG - Intergenic
1120948587 14:90020627-90020649 AGGGAGGAAGGAAGGCGGGGAGG - Intronic
1121055165 14:90846078-90846100 AGGGAAGCGGGAGCTCAGAGAGG - Intergenic
1121168975 14:91836800-91836822 AGGGAGACAAGCGGTAGGAGGGG + Intronic
1121173153 14:91871009-91871031 TGGGAGGCAGGAGGAGGGAGGGG + Intronic
1121691940 14:95884294-95884316 AAGGGGGCAGGTGGTGGGAGAGG - Intergenic
1122139097 14:99651683-99651705 AGGTAGACAGGAGGCTGGAGAGG + Intronic
1122217332 14:100212983-100213005 AAGGAGACAGGAGGTTGGGGTGG + Intergenic
1122231439 14:100307981-100308003 AGGGAGGCAGGTGTGCGGATGGG + Intergenic
1122246128 14:100404766-100404788 ATGCAGGCAGGAGGAGGGAGGGG - Intronic
1122254792 14:100468857-100468879 AGAGAGGAAGGAGCTCGGACTGG - Intronic
1122424366 14:101597073-101597095 CCGGAGGCAGGAGGGCAGAGAGG + Intergenic
1122516866 14:102314868-102314890 AGGGGTGCAGGAGGGCAGAGGGG + Intergenic
1122547558 14:102532554-102532576 AGACAGGCAGGAGCTCAGAGAGG - Intergenic
1122599914 14:102916048-102916070 AGGAAGGCAAGAGGCAGGAGAGG - Intergenic
1122774921 14:104112905-104112927 AGGGTGGCAGGAAGGGGGAGTGG - Exonic
1122797933 14:104215758-104215780 AGGCAGGCATGAGGTGTGAGGGG - Intergenic
1122886780 14:104713765-104713787 AGGGAGGGATGAGGGCTGAGCGG - Intronic
1122978281 14:105179925-105179947 AGGGAGGCAGGCAGGCAGAGAGG + Intronic
1202883426 14_KI270722v1_random:82702-82724 TGGGAGGCAGGGGGTTGCAGTGG - Intergenic
1123679912 15:22755458-22755480 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
1124119465 15:26876421-26876443 AGAGAGGCAGCAGGACTGAGGGG + Intronic
1124332126 15:28829906-28829928 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
1124855135 15:33380330-33380352 TTGGAGGCAGGAGGTGGGACTGG + Intronic
1124866709 15:33499304-33499326 AGAGTGGCAGGAGGGAGGAGGGG - Intronic
1125316161 15:38433856-38433878 AGGGAGGAGGGAGGAGGGAGGGG - Intergenic
1125333720 15:38606860-38606882 AGGGAGGCAGAAAGTGAGAGTGG + Intergenic
1126704843 15:51397419-51397441 AAGGAGGCAAGAGGTAGAAGGGG - Intronic
1127490033 15:59453803-59453825 AGGGAGGCAAGAGGAGAGAGAGG + Intronic
1127717169 15:61660387-61660409 GGGGAGGCAGGAGAACAGAGAGG - Intergenic
1127772214 15:62241413-62241435 AGGGAGGCAGGAGGATGGAATGG + Intergenic
1128229618 15:66025390-66025412 AGGGAGGAGGGAGGAGGGAGAGG + Intronic
1128240207 15:66096445-66096467 AGGGAGGAAGGAGCTTGGGGTGG + Intronic
1128266218 15:66268875-66268897 AGGTAGGCAAGAGGTCCTAGAGG - Intergenic
1128453908 15:67822344-67822366 AGGGAGGGAGGTGGTGGAAGCGG + Intronic
1128462903 15:67884711-67884733 AGGGATGGGGGAGGGCGGAGCGG - Intergenic
1128793386 15:70449056-70449078 AGGGAGGCAGGGGGGCAGGGAGG + Intergenic
1129008738 15:72396646-72396668 GGGGTGGCAGCAGGGCGGAGGGG - Intergenic
1129179672 15:73866138-73866160 AGGGAGGCAGGGAGACGGCGGGG - Intergenic
1129210659 15:74066045-74066067 AGGGAGGCAGGGGGATGGAACGG + Intergenic
1129245877 15:74278377-74278399 GGGGGAGCAGGAGGTGGGAGCGG + Intronic
1129336966 15:74858135-74858157 AGGGAGGGAGGAGGAGGGACTGG + Intronic
1129403352 15:75299284-75299306 AGGGAGGCAGGGGGATGGAACGG - Intergenic
1129656588 15:77528871-77528893 AAGGAGGCAGGTGGCCAGAGAGG - Intergenic
1129674610 15:77625744-77625766 AGGGAGGCAGTATGCAGGAGTGG - Intronic
1129727852 15:77910660-77910682 AGGGAGGCAAGGGGACGGAACGG + Intergenic
1130149549 15:81300719-81300741 TGGGAGGTAGGAGGTGGGACTGG + Intronic
1130230842 15:82095368-82095390 AGGCTGGAAGGAGGTGGGAGGGG - Intergenic
1130258855 15:82338714-82338736 AGGGAGGCAGGGGGACGGAATGG + Intergenic
1130269824 15:82440389-82440411 AGGGAGGCAGGGGGACAGAACGG - Intergenic
1130462163 15:84167690-84167712 AGGGAGGCAGGGGGACAGAACGG - Intergenic
1130490514 15:84427083-84427105 AGGGAGGCAGGGGGACAGAACGG + Intergenic
1130502102 15:84505853-84505875 AGGGAGGCAGGGGGACAGAACGG + Intergenic
1130596067 15:85251227-85251249 AGGGAGGCAGGGGGATGGAATGG - Intergenic
1131069759 15:89458800-89458822 GGTGAGGCATGAGGCCGGAGGGG - Intergenic
1131189327 15:90301268-90301290 AGGGAGGCAGTGGGGCGGAAAGG - Intronic
1131206437 15:90452296-90452318 AGGGAAAAAGGAGGTGGGAGCGG + Intronic
1131366516 15:91846346-91846368 AGGGAGGGAGGAGGATAGAGAGG - Intergenic
1131387389 15:92018644-92018666 AGTGAGGCAGGAGGGAGGACTGG + Intronic
1131509452 15:93041678-93041700 AGGGAGGCAGCAAGGAGGAGCGG - Intronic
1131825561 15:96320766-96320788 AGGAAGGGTGGAGGTGGGAGAGG + Intergenic
1132027120 15:98412901-98412923 AGGGTGGCAGAGGGTGGGAGAGG + Intergenic
1132053767 15:98633942-98633964 AGGGAGGGAGGAGGAGGGGGAGG - Intergenic
1132154586 15:99486578-99486600 GGGGAGGAAGGAGGTGGGGGCGG + Intergenic
1132282944 15:100635798-100635820 AGCGAGACAGGAGGCCAGAGGGG + Intronic
1132300773 15:100774240-100774262 AGGGCGGCAGCCGGGCGGAGGGG + Intergenic
1132420233 15:101659580-101659602 AGGGAGACAGGAGGTGGTTGGGG - Intronic
1132517540 16:372825-372847 AGGGTGGCAGCAGCTCCGAGGGG - Intronic
1132619341 16:856960-856982 AAGGAGGCCGAAGGTCGGGGAGG - Intronic
1132734606 16:1379316-1379338 AGCGGGGCAGGAGAGCGGAGCGG - Intronic
1132999575 16:2842162-2842184 AGGGAGGCGGGAGGTGGGCTGGG - Intergenic
1133402676 16:5500156-5500178 AGGGAGGCAGGGAGTGGGAGGGG - Intergenic
1133517908 16:6527781-6527803 ACAGAGGCAGCAGCTCGGAGTGG - Intronic
1133593977 16:7272911-7272933 AGGGAGGAAGGAGGGAGGGGAGG - Intronic
1133758694 16:8781283-8781305 AAAGAGGCAGGAGGTAGGTGAGG - Intronic
1134237718 16:12480660-12480682 GAGGAGGCAGGAGGTGGGAAGGG - Intronic
1134451128 16:14364393-14364415 AGAGAGGGAAGAGGCCGGAGAGG + Intergenic
1134743161 16:16566470-16566492 AGGGAGGGGGGAGGTGGGAGGGG - Intergenic
1134924399 16:18145990-18146012 AGGGAGGGGGGAGGTGGGAGGGG + Intergenic
1134978626 16:18590090-18590112 AGGGAGGGAGGAGATGGGGGAGG - Intergenic
1135010867 16:18877430-18877452 AGGGAGGGAGGAGTGGGGAGAGG + Intronic
1135060415 16:19266830-19266852 AGGGAGGCAAGAGGAAGGAGGGG - Intronic
1135302863 16:21345814-21345836 AGGAAGGAAGGAGGGGGGAGGGG - Intergenic
1135331384 16:21562936-21562958 AGGGAGGGAGAAGGAGGGAGAGG - Intergenic
1135504680 16:23026185-23026207 AGGGATGGAGGAGGCCAGAGTGG + Intergenic
1135800342 16:25488675-25488697 AGGGATGGAGGAGGAGGGAGTGG + Intergenic
1136137164 16:28263495-28263517 AGGTAGGCAGGAGCACGGGGAGG + Intergenic
1136314525 16:29444697-29444719 AGGGAGGGAGGAGTGAGGAGAGG + Intronic
1136327967 16:29546465-29546487 AGGGAGGGAGGAGTGGGGAGAGG + Intergenic
1136367352 16:29814876-29814898 AGGGGGCCAAGAGGCCGGAGGGG - Intronic
1136402797 16:30027783-30027805 GTGGGGGCAGGAGGTCAGAGAGG + Intronic
1136442652 16:30286466-30286488 AGGGAGGGAGGAGTGAGGAGAGG + Intergenic
1136605637 16:31331517-31331539 AGGGACCCAGGAGGGCGGGGCGG - Intronic
1136711442 16:32240388-32240410 GGGGAGGCAGCAGGGAGGAGGGG - Intergenic
1136756468 16:32689017-32689039 GGGGAGGCAGCAGGGAGGAGGGG + Intergenic
1136811643 16:33181356-33181378 GGGGAGGCAGCAGGGAGGAGGGG - Intergenic
1136818119 16:33291436-33291458 GGGGAGGCAGCAGGGAGGAGGGG - Intronic
1136824683 16:33347965-33347987 GGGGAGGCAGCAGGGAGGAGGGG - Intergenic
1136829749 16:33446736-33446758 GGGGAGGCAGCAGGGAGGAGGGG - Intergenic
1137057347 16:35752036-35752058 AGGGAGGCCCCAGGTCGCAGTGG - Intergenic
1137378900 16:47979485-47979507 AAAGAGGCAGGAGGAGGGAGGGG - Intergenic
1137386473 16:48047393-48047415 GGGGAAGCAGGAGGAGGGAGTGG + Intergenic
1137783295 16:51115623-51115645 AGGCAGGGAGGAGGTAGAAGGGG + Intergenic
1138025452 16:53518879-53518901 AGGCAGGCAGGATGTGGGAAGGG + Intergenic
1138519506 16:57563047-57563069 AGGGAGGCCAGAGCCCGGAGTGG - Intronic
1138539768 16:57680662-57680684 AGGGAGGCAGCAGGGCAGGGTGG + Intronic
1138610137 16:58116809-58116831 AGGGAGGCAGTACGTCATAGAGG - Intronic
1139289020 16:65840512-65840534 AAGGAGGCAGGAGATGGCAGAGG + Intergenic
1139359208 16:66387111-66387133 AGGGAGGGAGGAGGACAGAGTGG - Intronic
1139671089 16:68492909-68492931 AGGGCTGCAGGAGGTATGAGGGG - Intergenic
1139754544 16:69132276-69132298 AGGGCGGCGGGAGGGCGGCGCGG - Intronic
1139889398 16:70238954-70238976 AGGGAGGGAGGAGTGGGGAGAGG + Intergenic
1140033605 16:71357240-71357262 AGGGAGGCAGGATGACTCAGTGG - Intergenic
1140191262 16:72819201-72819223 AGGGAGGGAGGGAGCCGGAGAGG - Intronic
1140270164 16:73458356-73458378 AGGGAGGAAGGAGGGAGGAAAGG - Intergenic
1140296042 16:73710762-73710784 AGGGAGGCCGGGGGTCGAGGGGG - Intergenic
1140663041 16:77206362-77206384 AGGGAGGCAGGAAGTCCCAGTGG - Intronic
1140732721 16:77871217-77871239 AGGGTGGGAGGAGGTAGGGGAGG - Intronic
1140894357 16:79311929-79311951 AGTGAGGCAGGATGGCGGAGAGG + Intergenic
1140951583 16:79823608-79823630 AGGGTGTCAGGAGGAGGGAGAGG - Intergenic
1141054493 16:80803646-80803668 AGGGGGGCGGGCGATCGGAGCGG - Intronic
1141177139 16:81728522-81728544 AGGGAGGGAGGAGGGAGGAAGGG - Intergenic
1141380130 16:83568853-83568875 AGAGAGGCAGGAGCTGGAAGTGG - Intronic
1141410479 16:83829582-83829604 ATGGAGGGAGGAGGCAGGAGCGG - Intergenic
1141431673 16:83973411-83973433 AGGGATGCAGGAGGCCAGGGTGG - Intronic
1141660520 16:85438917-85438939 AGGCAGGCAGGAGGCCGCGGGGG - Intergenic
1141695551 16:85617429-85617451 AGGGAGGCAGGTGGAGGAAGTGG + Intronic
1141756788 16:85996773-85996795 AGAGAGGATGGAGGTAGGAGAGG + Intergenic
1141804783 16:86335534-86335556 GGGCAGGCAGGAGGCCGGAGTGG - Intergenic
1141989707 16:87602843-87602865 AGGGAGGGAGGGGGCAGGAGCGG - Intronic
1142000421 16:87661194-87661216 AGGGAGGCAGGAGGTCGGAGAGG - Intronic
1142024925 16:87807267-87807289 AGGGAGGGAGGAGGGCAGGGAGG + Intergenic
1142132011 16:88435488-88435510 AGAGAGGCAGTGGCTCGGAGAGG - Exonic
1142149263 16:88505540-88505562 AGGCAGGGAGGAGGTGGGAGGGG + Intronic
1142160385 16:88554548-88554570 AGGCGGGCAGCAGGTCAGAGAGG - Intergenic
1142409340 16:89908135-89908157 AGGGAGGCAGGAGGTGGCAGGGG - Intronic
1202990221 16_KI270728v1_random:4325-4347 GGGGAGGCAGCAGGGAGGAGGGG - Intergenic
1203058612 16_KI270728v1_random:949371-949393 GGGGAGGCAGCAGGGAGGAGGGG + Intergenic
1142554225 17:762349-762371 AGGGAGGGAGCAGGGCGCAGAGG + Intronic
1142616249 17:1137450-1137472 AGGGAGGCTGGAGCGGGGAGAGG + Intronic
1142691996 17:1612289-1612311 AGGGAGGCAGAAGGAAGGTGGGG - Intronic
1142816220 17:2427999-2428021 AGGGAGGGAGGAAGTGGAAGAGG + Intronic
1142875298 17:2848878-2848900 AGGGAGGCAGGAAGGCGTCGGGG - Intronic
1142958185 17:3535262-3535284 AGGGAGGAGGGAGGAGGGAGAGG - Intronic
1143021236 17:3918082-3918104 AGGGAGGAAGGAGGGAGGAAGGG + Intergenic
1143109551 17:4545519-4545541 AGGGAGGCTGGAGGCTGAAGCGG + Intronic
1144024797 17:11268397-11268419 AGGGAAGCAGAAGGTAGTAGGGG - Intronic
1144342497 17:14321491-14321513 AGGGAAGAAGGAGGGCAGAGGGG + Intronic
1144371456 17:14595482-14595504 AGGGAAGCAGGAGGTCCTATTGG + Intergenic
1144574519 17:16420454-16420476 AGGTAGCCAGGAGGCCTGAGGGG - Intronic
1144679022 17:17180528-17180550 AGGGCGGGCGGAGGTGGGAGCGG + Intronic
1144955781 17:19018147-19018169 AGGGAGGGAGGAAGGCGGACAGG + Intronic
1145175671 17:20698746-20698768 AGGGTGGCAGGAGATAGGGGTGG - Intergenic
1145261762 17:21358730-21358752 AGGGAGGTGGGAGGTGGCAGAGG + Intergenic
1145868521 17:28255879-28255901 AGGGAGGCAGGAGGAAGGGAGGG + Intergenic
1145883011 17:28365329-28365351 AGGGAGGCTGGAGGCCGGGTTGG + Intronic
1146003277 17:29144413-29144435 AGGGAGGCAGGAGTTGAGATGGG - Intronic
1146289635 17:31598255-31598277 AGGGAAGAAGGAGGTGGGGGAGG + Intergenic
1146299420 17:31676616-31676638 AAGGAGGGAGGAGGGAGGAGTGG + Intergenic
1146513090 17:33467479-33467501 TGGGAAGGAGGAGGTAGGAGAGG + Intronic
1146528356 17:33585972-33585994 AGGGAAGAAGGATGGCGGAGTGG + Intronic
1146685315 17:34837485-34837507 TGGGAGGCATGGGGTCTGAGTGG + Intergenic
1147037154 17:37690299-37690321 AGGGAGGAAGGAGGTGAGAACGG + Intronic
1147250892 17:39151871-39151893 AGGGAGCCAGGAGCTCAGTGAGG - Intronic
1147263449 17:39222064-39222086 AGGGAGGAAGGAGGGCTGATAGG - Intronic
1147384684 17:40074294-40074316 AGGGGGGCGGGCGGTGGGAGGGG - Exonic
1148150923 17:45396127-45396149 AGGAAGGGAGGAGGACGGAAGGG + Intronic
1148489207 17:48012500-48012522 AGGGAGGGGGGAGGGGGGAGGGG - Intergenic
1148561597 17:48609892-48609914 AGAGAGGCAGGTGGAGGGAGGGG - Intronic
1148571978 17:48677673-48677695 AGGGAGGGAGGAGGGTGGAGAGG - Intergenic
1148644633 17:49212282-49212304 AGGGAGGCAGAAAGATGGAGAGG - Intronic
1148785711 17:50145252-50145274 AGGGAGGCAGCTGGTCAGAGAGG + Intronic
1148864963 17:50623691-50623713 GGGGAGGAAGCAGGTAGGAGGGG - Intronic
1149008259 17:51828180-51828202 AGGGAGTTAGGAGGTCTAAGGGG + Intronic
1149233606 17:54565404-54565426 AGGCAGGCAGGAGATCAGAGAGG + Intergenic
1149295272 17:55256474-55256496 AGGGAGGCAGGGAGTGGGCGAGG - Intergenic
1149424937 17:56545944-56545966 AAGGAGGCAGGAGGGAGGAAGGG + Intergenic
1149589675 17:57819123-57819145 AGGGAGGCAGGACGGGGCAGAGG - Intergenic
1149683534 17:58521710-58521732 AGGGAAGCTGGTGGTGGGAGGGG - Intronic
1149727592 17:58912131-58912153 AGGGAGGGAGGGGGTAGGAGTGG + Intronic
1149865386 17:60148654-60148676 AGAGAGGCAGGAGGGAGGTGAGG - Intergenic
1150182403 17:63138150-63138172 AGAGACGCAGGGGGTGGGAGGGG - Intronic
1150222124 17:63501582-63501604 AGGGAGGGAGGATGAGGGAGAGG - Intronic
1150292332 17:63988877-63988899 AGTGCGGCAGGAGGCCGGGGTGG - Intergenic
1150423755 17:65060073-65060095 TGGAAGGCAGGAGGAGGGAGAGG + Intergenic
1150477908 17:65488350-65488372 AGGGAGGGAGGAAGAGGGAGAGG + Intergenic
1150543392 17:66127621-66127643 AGAGAGTCAGGAGGTCTGGGTGG - Intronic
1151467654 17:74297973-74297995 CAGGAGGCAGCAGGTCTGAGAGG - Intronic
1151560723 17:74868140-74868162 AGAGAGGCAGGAGGTGGGGGAGG - Intronic
1151679360 17:75615475-75615497 AGGGCGGCAGGCGGCCAGAGTGG - Intergenic
1151719371 17:75846718-75846740 AGGGAGGCAGGAGGGCCTACTGG + Exonic
1151978053 17:77493308-77493330 AGGGAGACAGGAGCTGGGATGGG + Intronic
1152695267 17:81741024-81741046 AGGGAGGCTGGGGGAGGGAGGGG - Intergenic
1152771521 17:82172570-82172592 AGGGAGGGAGGAGGACAGACGGG - Intronic
1152859089 17:82685227-82685249 AGGGAGGACGGAGGAGGGAGGGG + Intronic
1153518033 18:5923091-5923113 AGGGAAGCAGGAGAAAGGAGAGG - Intergenic
1153588242 18:6645884-6645906 AGCGAGGCAGTTGGTCGGGGAGG - Intergenic
1153778766 18:8476430-8476452 AGGGAGGGAGGAGGTGGGGAGGG + Intergenic
1153912500 18:9716518-9716540 AAGAAGGCAAGAGGTGGGAGTGG + Intronic
1154149715 18:11896721-11896743 AAGGAGGCAGGGGCTCAGAGGGG + Intronic
1154160925 18:11980844-11980866 TGGGAGGGAGGAGCTAGGAGCGG - Intergenic
1154217070 18:12423201-12423223 TGGGAGGGAGGAGGCTGGAGAGG + Intronic
1155945160 18:31840388-31840410 AGGGAGGCAGGGAGTTGGGGAGG + Intronic
1156459670 18:37314697-37314719 GGGGAGGCTGGAGGACGGAAAGG - Intronic
1156826355 18:41434507-41434529 AGGGAGGGATGATGTGGGAGGGG + Intergenic
1156951436 18:42904489-42904511 AGGGAGGCCTGAGGTCTGGGAGG + Intronic
1157470122 18:47982521-47982543 AGGGAGGGAGGGGGAGGGAGAGG + Intergenic
1157558201 18:48627393-48627415 AGGGAGGCAGGAAGTGAGTGGGG + Intronic
1157587632 18:48814923-48814945 GGGGAGGCAGGAGGCCTGAGGGG + Intronic
1157843703 18:50982818-50982840 AGGGAGAAGGGAGGTAGGAGAGG - Intronic
1158237884 18:55339667-55339689 AGGGAGGGGGGAGGTGTGAGCGG - Intronic
1158582100 18:58692477-58692499 AGGGAGTGGGGAGGTGGGAGAGG - Intronic
1158851033 18:61496022-61496044 AGGGAGGAGAGAGGTGGGAGAGG - Intronic
1159214639 18:65375118-65375140 AGGGAGGAAGGAGGGAGGGGAGG - Intergenic
1159794328 18:72823332-72823354 AGGTAGGTAGTAGGTAGGAGAGG + Intronic
1159813712 18:73047265-73047287 TGGGAGGCCGGGGGTCGGGGGGG + Intergenic
1160044126 18:75371062-75371084 AGGGTTGCAGGAGGTCAGAGAGG - Intergenic
1160046577 18:75392197-75392219 AGGGAGGAAGGCGTTCGGAGGGG + Intergenic
1160123929 18:76153607-76153629 AGAGAGGCAGGTGGTAGCAGAGG + Intergenic
1160356085 18:78229523-78229545 AGGGAGGGAGGAGGGAGGAAGGG - Intergenic
1160564702 18:79779885-79779907 TCGGAGGCCGGAGGTCGGAGGGG + Intergenic
1160698783 19:496725-496747 AGGGACGCAGGAGAGAGGAGGGG + Intronic
1160698897 19:497053-497075 AGGGACGCAGGAGAGAGGAGGGG + Intronic
1160875345 19:1294129-1294151 ATGGAGGGAGGAGGCAGGAGCGG + Intronic
1160977937 19:1802892-1802914 AGGGAGCTAGGAGCTAGGAGGGG - Intronic
1161081518 19:2312844-2312866 AGGGAGGCAGCAGCCCGCAGAGG - Intronic
1161139583 19:2639687-2639709 AGGGAGGCAGGGAGTGGGGGAGG + Intronic
1161273540 19:3403681-3403703 AAGGAGGCAGGAGGAAGGCGCGG - Intronic
1161300309 19:3539284-3539306 AGGGAGGGAGGGGCTGGGAGGGG - Intronic
1161326595 19:3667264-3667286 AGGGAGGCAGCAGGTCAGGGTGG + Intronic
1161422643 19:4184311-4184333 GGGGAGGAAGGAGGTGGGAGAGG + Intronic
1161458288 19:4381058-4381080 AGAGAGGCAGGGGGACAGAGAGG - Intronic
1162129991 19:8520581-8520603 AGGGAGGGAGGAGGTGGGCGCGG - Intergenic
1162153421 19:8661037-8661059 AGGGAGGGAGGGGGACGGAAGGG - Intergenic
1162490888 19:10990911-10990933 AGGCAAGCTGGAGGTCCGAGAGG + Intronic
1162588667 19:11577019-11577041 AGTGGGGCAGGAGGTGGGGGCGG - Intronic
1162931392 19:13959557-13959579 GGGGAGGCAGGAAGTGGGGGTGG - Intronic
1162954529 19:14090856-14090878 AGGGAGGAAGGCGGGCGGCGGGG - Intronic
1163521365 19:17793957-17793979 AGGGATGAAGGAGGAAGGAGGGG + Intergenic
1163849248 19:19654223-19654245 GGGGAGGCAGGAGGGAGGTGGGG - Intronic
1164441878 19:28285054-28285076 AGAGAGGAAGGAGGGTGGAGGGG + Intergenic
1164700332 19:30280232-30280254 AGGGGGGCAGGAGGAAAGAGAGG - Intronic
1165311203 19:35030413-35030435 AGGGAGGGACGAGGGAGGAGAGG - Intergenic
1165432786 19:35781944-35781966 AGGGAGGCAGGAGGTGGCAATGG + Intronic
1165715709 19:38044491-38044513 AGTGAGGCAGGAGGTTGATGAGG + Intronic
1165842659 19:38798060-38798082 AGGGTGGCAGCCGGGCGGAGGGG + Intergenic
1165856174 19:38880425-38880447 AGGGACTGAGGAGGTGGGAGGGG - Intronic
1165937612 19:39398641-39398663 AGGGAAGCAGGGAGTCTGAGGGG - Exonic
1165940061 19:39410433-39410455 GGGGAGGCTGGAAGTGGGAGAGG - Intergenic
1166061700 19:40329639-40329661 AGAGAGGGAGGAGGTCTGATAGG - Intronic
1166378804 19:42343927-42343949 AGGGAGGCAAGGGGACAGAGGGG - Intronic
1166547254 19:43640663-43640685 AGGGAGACAGCAGGGAGGAGAGG - Intergenic
1166689436 19:44813703-44813725 AGGGAGGCAGAGGGTCAGAGGGG - Intronic
1166692745 19:44833524-44833546 AGGGAGGGAGGAGGAAGGAAAGG + Intergenic
1166990537 19:46690079-46690101 AGGGTTGCAGGAGGGAGGAGGGG + Intronic
1167070961 19:47221735-47221757 AGGGTGTCAGGAGGTGGGAGGGG + Exonic
1167096646 19:47378090-47378112 AGTGAGCCAGGAGGCAGGAGGGG - Intronic
1167237768 19:48325483-48325505 AGGGAGGAAGGCGGTGAGAGAGG + Exonic
1167249121 19:48391389-48391411 AGGGAGGCAGGCTGGCGGGGGGG + Exonic
1167250315 19:48395719-48395741 AGGGAGGCCAGAGCTCGGTGGGG + Intronic
1167299857 19:48672177-48672199 AGGAAGGCAGGAGCTGGGACAGG + Intronic
1167360672 19:49028741-49028763 TGGGAGGCAGATGGACGGAGGGG + Intronic
1167362982 19:49040065-49040087 TGGGAGGCAGATGGACGGAGGGG - Intergenic
1167365588 19:49053528-49053550 TGGGAGGCAGATGGACGGAGGGG + Intergenic
1167469043 19:49665315-49665337 AGGGAGGCGGGCAGTCGGAGGGG - Exonic
1167622355 19:50567171-50567193 AGGGCGGAGGGAGGTGGGAGAGG + Intronic
1167702040 19:51054537-51054559 AGGGAGCCAGGAGCTATGAGAGG - Intergenic
1167713163 19:51124679-51124701 AGGGAGGCAGGAGGTGGGGTGGG + Intergenic
1167715762 19:51142074-51142096 AGGGAGGCAGGAGGTGGGGTGGG + Intergenic
1167741550 19:51327261-51327283 TGTGAGGCAGGGGGACGGAGCGG + Intronic
1167799212 19:51729515-51729537 AGGGAAGAAGGAGGAAGGAGAGG + Intergenic
1168249435 19:55133344-55133366 AGGGAGGAAGGAAGAGGGAGTGG + Intronic
1168270288 19:55246050-55246072 AGGGAGGCAGGAGGTGAGGTTGG - Intronic
1168294246 19:55370815-55370837 GGGGAGGCAGGAGGACGGAAAGG + Intergenic
1168433885 19:56302606-56302628 AGGGAGGGAGGAAGAGGGAGAGG - Intronic
1168498213 19:56871932-56871954 AGGGAGGCATGAGATGGGGGCGG - Intergenic
1168627953 19:57933936-57933958 GGGGAGGCAAGAGGGCGGCGAGG - Intronic
1202658840 1_KI270708v1_random:49849-49871 TGGGAGGCAGGGGGTTGCAGTGG - Intergenic
925079644 2:1053917-1053939 AGGGGGGCGGGAGGGAGGAGAGG - Intronic
925314846 2:2913741-2913763 AGGGAGGCAGGAGCTGGCAGCGG + Intergenic
925625892 2:5841925-5841947 AGGAAGGAAGGAGGAGGGAGGGG + Intergenic
925927619 2:8681745-8681767 AGGGAGGCGGGAGGAGGGAGAGG - Intronic
926096065 2:10080902-10080924 AGGGAAGGAGAAGGCCGGAGGGG - Intronic
926630138 2:15128635-15128657 ATGGAGGCAGGAGGCTGCAGGGG + Intergenic
926800089 2:16652608-16652630 AGGGTGGCAGGGGGTAGCAGGGG - Intronic
926919913 2:17930172-17930194 TGGGAAGGAGGAGGTGGGAGTGG + Intronic
926925038 2:17978740-17978762 GGAGAGGCAGGAGAACGGAGAGG - Intronic
927328632 2:21835891-21835913 AGGGTGGCAGAGGGTGGGAGAGG + Intergenic
928103415 2:28452551-28452573 TGGGAGGCAGGTGGGGGGAGCGG - Intergenic
928172923 2:29014833-29014855 AGGAAGGAAGGAGGACGGGGAGG + Intronic
928209825 2:29315259-29315281 CTGGAGGGAGGAGGTGGGAGTGG + Intronic
928261992 2:29776468-29776490 AGTGGTGCAGGAGGTCAGAGTGG - Intronic
928314709 2:30236288-30236310 AGGGAGGAAGGAGCTGGGGGAGG + Intronic
928365873 2:30702080-30702102 AGGGAGGCAGGAGGAAGAAGAGG - Intergenic
928366266 2:30705798-30705820 AGGGAGGCAGGAGCTGGGGAGGG - Intergenic
928402281 2:30987735-30987757 TGGGAGGCAGCAGGTGGGGGAGG - Intronic
929444520 2:41991993-41992015 AGGAAGGCAGGAGAGGGGAGGGG + Intergenic
929454493 2:42056185-42056207 AAGGAGGCAGGAGGGTGGGGTGG + Intronic
929562209 2:42963013-42963035 AGGGAGGGAGGAGGGAAGAGGGG - Intergenic
929603550 2:43219810-43219832 AGGGAGGGAGGAGGACAGCGGGG - Intergenic
929606294 2:43236439-43236461 AGGGAGGCTGGAGTAGGGAGAGG + Intronic
929811586 2:45193380-45193402 AAGGAAGCAGGAGGGAGGAGTGG + Intergenic
930035608 2:47083515-47083537 TGGGAGGAGGGAGGACGGAGTGG - Intronic
930100004 2:47596218-47596240 GGGAAGCCAGGAGGTGGGAGTGG - Intergenic
930706377 2:54508674-54508696 AGCGAGGGAGTAGGTGGGAGTGG + Intronic
931969207 2:67567199-67567221 TGGAAGAGAGGAGGTCGGAGGGG + Intergenic
932192083 2:69749337-69749359 TGAGAGACAGGAGGTAGGAGGGG + Intronic
932206237 2:69885435-69885457 TGAGAGGCAGGACGTTGGAGAGG + Intergenic
932356691 2:71073329-71073351 GGGGTGGCAGGGGGTGGGAGAGG - Intronic
932713126 2:74082328-74082350 AGGAAGGCAGGAGGATGGAGGGG + Intronic
933161776 2:79032853-79032875 AGGGAGGCAGAAAGTCAGAGGGG + Intergenic
934089358 2:88537877-88537899 TGGAAGGCAGGAGGTGGGAGAGG - Intergenic
934116939 2:88807604-88807626 AGGGAGGCAGGATGGGGCAGTGG - Intergenic
934117704 2:88812234-88812256 AGGGAGGCAGGAGGAGTCAGGGG - Intergenic
934676713 2:96254455-96254477 AGGGAAGCAGGAAGGTGGAGAGG + Intronic
934942300 2:98511495-98511517 TGGGAGGTGGGAGGTGGGAGAGG + Intronic
935131516 2:100264644-100264666 ATGGAGGCAGGAGGGAGGGGAGG - Intergenic
935174696 2:100639794-100639816 AGAGAGGCAGGGGGTGAGAGAGG - Intergenic
935303612 2:101716027-101716049 AGGTAGGCAGGGGGTGGCAGTGG - Intronic
935337547 2:102031149-102031171 AGGGAGGGAGAAGTACGGAGGGG + Intergenic
936161371 2:110086300-110086322 AGGGAGGCAGGAGGAGCCAGGGG - Intronic
936183292 2:110285054-110285076 AGGGAGGCAGGAGGAGCCAGGGG + Intergenic
936462695 2:112724209-112724231 AGGGAGGCTGGACGTGGGAGAGG - Intronic
936500079 2:113059810-113059832 AGGGAGGCAGGGGCACAGAGTGG - Intronic
936528029 2:113255249-113255271 AGGGAGGGAGGAGGGAGGGGAGG + Intronic
936528046 2:113255284-113255306 AGGGAGGGAGGAGGGAGGGGAGG + Intronic
937206218 2:120238728-120238750 TGGGAGACAGGTGGTGGGAGGGG + Intergenic
937290658 2:120779799-120779821 GGGGAGGCAGGATGGCGGAGTGG - Intronic
938138448 2:128777574-128777596 AGGGAGGGAGGAGGGAGGTGGGG - Intergenic
938319343 2:130352615-130352637 AGGGAGTAAGGAGGTGGGCGTGG + Intergenic
938982487 2:136539812-136539834 AGGTAGGAAGGAAGTCAGAGAGG - Intergenic
941225185 2:162839009-162839031 AAGGAGGCTGGGGGTCGGCGGGG + Intergenic
942296996 2:174527505-174527527 AGGGAGCCACGTGGTCTGAGGGG + Intergenic
942405229 2:175646784-175646806 AGGGAGGCTGCAGATGGGAGAGG - Intergenic
942452293 2:176116078-176116100 AGCCAGGCAGGAGGACCGAGCGG + Intronic
942482288 2:176402793-176402815 AGGCAGGAAGGAGGAAGGAGGGG - Intergenic
944163351 2:196690226-196690248 GGGGAGGCGGGAGGGAGGAGGGG + Intronic
945110668 2:206357044-206357066 AGGGTGGCAGCCGGGCGGAGGGG + Intergenic
945188735 2:207165739-207165761 AGGGAGAGAGGAGGTGAGAGAGG + Exonic
945624681 2:212188239-212188261 AGGGAGGGAGGGGGTGAGAGGGG - Intronic
946025315 2:216668494-216668516 AGGGAGGCGGCAGGTGGAAGAGG + Intergenic
946523417 2:220491723-220491745 AGGCAGGAAGGAGGAAGGAGAGG - Intergenic
947030051 2:225783018-225783040 AGGGAGGAAGGAGGGAGGAAGGG - Intergenic
947071026 2:226288030-226288052 AGGGAAGCAGGAGAGCGCAGGGG - Intergenic
947643686 2:231722232-231722254 GGGGACTCAGGAGGTAGGAGGGG + Intergenic
947741761 2:232487926-232487948 AGAGATGCAGGAGGAAGGAGGGG - Intergenic
947779350 2:232743548-232743570 TGGAAGGCAGGAGGAGGGAGAGG - Intronic
947844642 2:233234090-233234112 AGGCAGACAGGAGGTGGGTGTGG - Intronic
948505230 2:238423548-238423570 TGGGAGGCTGGAGGTGGGCGTGG + Intergenic
948515016 2:238498295-238498317 GGGGAGGCAGGGGGTTGGGGAGG + Intergenic
948567042 2:238893962-238893984 AAGGAGGCACGTGGTAGGAGAGG - Intronic
948577657 2:238965022-238965044 GGGGAGGCAGGAGGGAGGAGGGG - Intergenic
948577812 2:238965528-238965550 AGGGAGGAAGGAGGCCGGTGGGG - Intergenic
948594983 2:239074000-239074022 AGGGGGGCAGCAGGACTGAGGGG + Intronic
948594991 2:239074036-239074058 AGGGGGGCAGCAGGACTGAGTGG + Intronic
948641648 2:239379138-239379160 AGGAAGGCAGGAGCTGGGGGTGG + Intronic
948839830 2:240643421-240643443 AGAAAGGCAGGTGGGCGGAGTGG - Intergenic
948939608 2:241189322-241189344 GGCGCCGCAGGAGGTCGGAGGGG - Intronic
948989493 2:241545630-241545652 AGAGAGGGAGGAGGGCAGAGAGG + Intergenic
1168816711 20:742837-742859 AGGGAGGAAGGAGGTGGAACAGG - Intergenic
1169027896 20:2385513-2385535 AGAGAGGCAGTGGGTGGGAGTGG + Intronic
1169134832 20:3190914-3190936 AGGCAGGCAGGAGGCCGGAAGGG - Intronic
1169248972 20:4045934-4045956 AGGGAAGCAGGATGTGGCAGAGG - Intergenic
1169386437 20:5154074-5154096 AGGGAGACATGAGGTGGGAACGG - Intronic
1169394764 20:5219692-5219714 ATGGAGGCAGGAGATGAGAGAGG - Intergenic
1170724394 20:18913393-18913415 AGAGTGGCAGAAGGTCAGAGAGG + Intergenic
1170783641 20:19449081-19449103 AGGGAGGCAGGAAATGGGAAGGG + Intronic
1170938274 20:20827983-20828005 AGGGAGGAAGGAGGAAGGAAGGG + Intergenic
1171536671 20:25898765-25898787 ACAGAGCCAGGAGGTGGGAGAGG - Intergenic
1171794728 20:29557985-29558007 AGGGAGGCAGGCGGAAGCAGGGG - Intergenic
1171853730 20:30326280-30326302 AGGGAGGCAGGTGGAAGCAGGGG + Intergenic
1171866003 20:30488066-30488088 AGGGAGGGAGCAGCTCGGGGTGG + Intergenic
1172114051 20:32563240-32563262 AGGGAGGGTGGAGGTCAGGGAGG + Intronic
1172407358 20:34699687-34699709 AGGGGGGCAGGCAGTGGGAGTGG + Intronic
1172717760 20:36976899-36976921 GGGGTGGCAGCAGGGCGGAGGGG + Intergenic
1172758613 20:37306101-37306123 AGGGTGGCAGGAGGTAGGAGAGG + Intronic
1172844866 20:37923849-37923871 AGGGAGGCTGAAGCTCAGAGAGG - Intronic
1172847636 20:37939291-37939313 AGCTACTCAGGAGGTCGGAGGGG + Intronic
1172918574 20:38461745-38461767 GGGGTGGCAGCAGGGCGGAGGGG + Intergenic
1172991613 20:39040919-39040941 AGGGTGGCAGGAGATGGCAGAGG + Intergenic
1173015281 20:39220046-39220068 AGGGAGGTAGGAAGTAGGAAGGG - Intergenic
1173376420 20:42487578-42487600 AGGGAGGCAAGAGGGCAGAGAGG + Intronic
1173542401 20:43863974-43863996 AGGGAGACAGGAGGGAGGACAGG - Intergenic
1174283962 20:49459177-49459199 GGGGAGGCAGGAGATGGTAGTGG + Intronic
1174404582 20:50294966-50294988 TGGGGGGCAGGAGGGCGGAGGGG + Intergenic
1174502599 20:50996650-50996672 AGGGAGGCAGGATGGGGCAGGGG + Intergenic
1175086517 20:56464007-56464029 AACCAGGCAGGAGGTGGGAGAGG + Intergenic
1175105454 20:56611581-56611603 AGGAGGGCAGGAGGGCTGAGTGG - Intergenic
1175108844 20:56631588-56631610 GGGGCAGCAGCAGGTCGGAGCGG - Exonic
1175138810 20:56844395-56844417 AGGGAGGGATGAGCTTGGAGAGG - Intergenic
1175296478 20:57912368-57912390 AGGGAGGAAGTGGGTGGGAGAGG - Intergenic
1175487388 20:59355732-59355754 AGGGAGAGAGGAGGGGGGAGAGG - Intergenic
1175487405 20:59355773-59355795 AGGGAGAGAGGAGGGGGGAGAGG - Intergenic
1175670948 20:60902534-60902556 AGGGAGGCGGGAGGTGAGAGAGG + Intergenic
1175855429 20:62118463-62118485 AGGGGGACAGGAGGCAGGAGGGG + Intergenic
1175891486 20:62317935-62317957 AGGGAAGGAGGAGGATGGAGGGG + Intronic
1176017938 20:62946354-62946376 AGGGATGCAGGAGCTCGGTGAGG - Exonic
1176047637 20:63101044-63101066 AGGGAGGCAAAAGGAGGGAGTGG - Intergenic
1176048245 20:63103441-63103463 GGGGAGGAAGGAGGAAGGAGCGG + Intergenic
1176303981 21:5113988-5114010 AGAGAGCCTGGAGGTCAGAGTGG + Intergenic
1176667949 21:9705195-9705217 AGGAAGGCAGGAGCGCGGCGGGG - Intergenic
1177869220 21:26550311-26550333 AGGGAGGAGGGAGGCCTGAGGGG - Intronic
1178236321 21:30846028-30846050 AGGGAGCCAGGAGGAAGCAGAGG + Intergenic
1178239719 21:30885199-30885221 AGGGAGGCTGGAGGTTTGATAGG + Intergenic
1178424764 21:32470620-32470642 AGGGAGAAAGGAGGAGGGAGTGG - Intronic
1178881865 21:36456165-36456187 AGGGAGGCAGGATGGCGTTGTGG + Intergenic
1179094178 21:38297057-38297079 AGGGAGGGAGGAGGACAGAGAGG + Intronic
1179249600 21:39661910-39661932 AGGGAGGCAGCACGTGGGAGTGG - Exonic
1179603913 21:42499660-42499682 AGGGAGGAGGGAGGGCCGAGGGG + Intronic
1179626762 21:42653528-42653550 AGGGAGGGGGGAGGGGGGAGGGG + Intergenic
1179853049 21:44147962-44147984 AGAGAGCCTGGAGGTCAGAGCGG - Intergenic
1179952153 21:44714365-44714387 AGGGAGGCAGGGGAGGGGAGGGG + Intergenic
1180056217 21:45360400-45360422 AGGGAGGCAGGAGGGCCCGGGGG + Intergenic
1180163674 21:46009285-46009307 AGGGACCCAGGGGGTCTGAGGGG + Intergenic
1180170337 21:46055079-46055101 AGGGAGGCAGGCGGTCTGCGTGG - Intergenic
1180312711 22:11252940-11252962 AGGGAGGGAGGAGCTCCGGGTGG + Intergenic
1180326306 22:11433366-11433388 TGGGAGGCAGGGGGTTGCAGTGG - Intergenic
1180927720 22:19567614-19567636 AGGGAGGCAAGAGGTGGGCTTGG + Intergenic
1180959326 22:19755519-19755541 TGGGAGTCAAGAGGTGGGAGTGG + Intergenic
1180985918 22:19903866-19903888 AGGGAGGCAGGGGTGCGGAGGGG - Intronic
1181082112 22:20422922-20422944 TGGGAGGCAGGAGGCTGGAGGGG + Intergenic
1181902398 22:26167634-26167656 TGGAAGGCAGGAGGAGGGAGAGG + Intergenic
1182044579 22:27264228-27264250 AGGAAGGCAGGTGGAGGGAGGGG + Intergenic
1182299730 22:29330836-29330858 AGGGAAGCAGGAGGGCTGTGCGG - Intronic
1182586245 22:31345848-31345870 GGGGAGGCGGGCGGGCGGAGAGG - Exonic
1183295134 22:37024823-37024845 AAGGGGGCAGGAGGTCGTCGGGG + Intronic
1183325344 22:37188360-37188382 AGGGAGGGAGCAGGGAGGAGGGG - Intronic
1183603916 22:38857680-38857702 AGGGAGGCAGGAGATGGGCGTGG - Intergenic
1183685992 22:39361838-39361860 AGGCAGGGAAGAGGTGGGAGAGG - Intronic
1183950766 22:41351488-41351510 AGGGAGGCAGGGGGTCCACGAGG - Intronic
1184034889 22:41913683-41913705 GGAGAGGCAGGAGGTGGAAGAGG + Intronic
1184060406 22:42077946-42077968 AGAGAAGCAGGAGGTCTCAGGGG - Exonic
1184098551 22:42329659-42329681 AGGGATGCAGGAGGGCTGAGAGG + Intronic
1184175596 22:42787128-42787150 AGGGAGGCAGGGGGACTGAACGG - Intergenic
1184381066 22:44145231-44145253 AGGAAGAAAGGGGGTCGGAGAGG + Intronic
1184403029 22:44284882-44284904 AGGAAGGCAGGAAGGCAGAGAGG - Intronic
1184531086 22:45056206-45056228 AAGGAGCCAGGAGCTTGGAGAGG - Intergenic
1184537109 22:45094684-45094706 AGGGAGGAAGGAGATCTGTGGGG - Intergenic
1184744212 22:46446595-46446617 AGGGTCGCAGGGGGTCGGTGGGG + Intronic
1184764646 22:46565285-46565307 AGAGAGGAAGGAGGGAGGAGAGG + Intergenic
1184972679 22:48037719-48037741 AGGGAGGCAGGAAGGTGCAGGGG + Intergenic
1185037046 22:48484855-48484877 AGGGAGGGAGGAGAGGGGAGGGG - Intergenic
1185279089 22:49962322-49962344 AGGGAGGGAGGAGGGAGGGGCGG - Intronic
949438295 3:4052469-4052491 TGGGAGGCATGAGATGGGAGGGG - Intronic
949510220 3:4760797-4760819 GTGGAGGCAGGAGGCAGGAGAGG - Intronic
949994072 3:9602535-9602557 AGGGAGGCTGGGGGTGGGCGTGG - Intergenic
950113847 3:10438039-10438061 AGGGAGCCAGGAGGTTGCAGGGG + Intronic
950120381 3:10478557-10478579 AGGGGAGCAGGAGGTTGGATGGG - Intronic
950234228 3:11304588-11304610 AGGCAGGCAGGTGGTCAGAACGG - Intronic
950550525 3:13663416-13663438 GGCAAGGCAGGAGGTCCGAGTGG - Intergenic
950647262 3:14384564-14384586 GGGGAGGCAGGAGGAAGGAGAGG - Intergenic
951485033 3:23202155-23202177 AGTGAGGCTGGAGGTTGGAGTGG + Intergenic
952888938 3:38028728-38028750 TGGGAGGCGGGAGGTTGGGGAGG - Intronic
952944197 3:38466211-38466233 AGGTAGGTAGGAGGTCAGATGGG + Intronic
953026771 3:39149856-39149878 AGAAAGGCAGGAGGAAGGAGTGG - Intronic
953342130 3:42143500-42143522 AGGGAGCCATTAGGTCGCAGGGG + Intronic
953550605 3:43899509-43899531 AGGGAAGCAGGAGGTGGGAGAGG - Intergenic
953776073 3:45818736-45818758 ACGGAGGCATGAGGTAGGAAAGG - Intergenic
954148786 3:48647303-48647325 AGGGAGGGTGGAGGGTGGAGGGG + Intronic
955028003 3:55189015-55189037 AGGGAGGACGGAGGTGGAAGAGG + Intergenic
955058282 3:55474798-55474820 GGGGAGGTAGGAGGTGGGGGAGG + Intronic
955640539 3:61078312-61078334 AGAGAGGCAGGAAGTCTCAGGGG + Intronic
956077700 3:65523430-65523452 AGGGAGGCAAGGGGTGGGGGAGG + Intronic
956232407 3:67031515-67031537 AGGGAGGAAGGAAGACAGAGAGG - Intergenic
956410443 3:68973313-68973335 AGGAAGGAAGGAGGTCGGGGAGG - Intergenic
956507574 3:69959007-69959029 AGGGAGGGAGGGGGTGGGATGGG + Intronic
956572170 3:70709005-70709027 AGAGGGGGAGGAGGTGGGAGGGG + Intergenic
957053055 3:75425073-75425095 TGGGAGGTAGGAGGTTGCAGTGG + Intergenic
958769947 3:98414323-98414345 TGGGAGGTAGGAGGAGGGAGAGG - Intergenic
959260931 3:104078477-104078499 AGGGAGGCAGAAGAGAGGAGAGG + Intergenic
959368100 3:105488718-105488740 AGGGAGGGAGAAGGAGGGAGGGG + Intronic
960040755 3:113148100-113148122 ATGAAGGCAGGAGGTGGGGGTGG + Intergenic
960046771 3:113206316-113206338 CGGGAGGCGGGAGGTTGCAGTGG - Intergenic
960525433 3:118704818-118704840 AGGGAGGAAGGAAGGAGGAGAGG - Intergenic
961175076 3:124828505-124828527 AGGGAGGCAGGAGGGAGAAGAGG + Intronic
961345297 3:126260151-126260173 AGGGAGGAGGGAGGTAGGAGAGG - Intergenic
961594543 3:128006405-128006427 TGGGAGGCAGGCGGGAGGAGAGG + Intergenic
962312765 3:134337785-134337807 AGGGAAGGATGAGGTTGGAGAGG - Intergenic
962559530 3:136591250-136591272 AGGAAGGGAGGAGGGAGGAGGGG + Intronic
962903133 3:139777892-139777914 GGGGATGCAGGAGGTTGGGGAGG - Intergenic
963639741 3:147843909-147843931 AGGGACACAGGAGGTCATAGAGG + Intergenic
964303847 3:155319787-155319809 TGGGAGCCAGGAGGTGGGTGGGG - Intergenic
964335532 3:155650032-155650054 AGGGAGGCGTGAGGGAGGAGAGG + Intronic
964407930 3:156369058-156369080 AGGGAGGCAGTGGGTGGGGGTGG - Intronic
964471700 3:157063842-157063864 GGGGAGGCAGGAGTTCGATGTGG - Intergenic
964896555 3:161603601-161603623 GGGGAGGGAGGAGGGAGGAGGGG - Intergenic
965061856 3:163793995-163794017 AGGGAGAGAGGAGGTGGCAGAGG - Intergenic
966318190 3:178672270-178672292 AGGGGTGCAGGAGGTAGTAGGGG + Intronic
966419508 3:179723496-179723518 AAGGAGGGAGGTGGTCAGAGAGG + Intronic
966950607 3:184813112-184813134 AGGGTGGGAGGAGGTAGGATCGG + Intronic
967005002 3:185375595-185375617 AGCGAGGGAGTAGGTGGGAGTGG + Intronic
967072199 3:185971905-185971927 AGGGAGGCAGGTGAGTGGAGAGG - Intergenic
967277384 3:187789921-187789943 AGGGAGGGAGGGGGAGGGAGGGG + Intergenic
967332133 3:188301087-188301109 AGAGAGGCAGGAGGGTGGATGGG - Intronic
967843436 3:194025815-194025837 AGGGTGGCAGGAGGAAGGACTGG - Intergenic
967970427 3:194995079-194995101 AGGAAGGCAGGGGGTTGGGGGGG - Intergenic
968434723 4:578565-578587 AGGGAGGCTGGAGGCCAGACTGG - Intergenic
968509307 4:988338-988360 GGGGAGGCACGAGGTGTGAGGGG + Exonic
968525053 4:1052494-1052516 AGGGGGGCAGGACCACGGAGGGG - Intergenic
968582432 4:1401331-1401353 AGGGAGGAGGGAGGAGGGAGAGG + Intergenic
968659654 4:1793734-1793756 GGGGCGGCTGGGGGTCGGAGGGG + Intronic
968973194 4:3807077-3807099 AGGGAGGGAGGAGGAAGGAAGGG - Intergenic
969197379 4:5573782-5573804 AGGGAGTCAGCAGGAAGGAGGGG - Intronic
969318230 4:6394990-6395012 AGGCAGGGAGGTGGGCGGAGGGG - Intronic
969496088 4:7527110-7527132 AGGGCGGCCGGAGGTGGGTGGGG - Intronic
969537413 4:7765214-7765236 TGGGAGGCAGCAGGGCAGAGTGG - Intronic
969610611 4:8225811-8225833 ATGCAGGCAGGAGGTCCCAGAGG + Intronic
969847399 4:9930132-9930154 AGGGAGGAAGGAGAGGGGAGGGG - Intronic
969874155 4:10123700-10123722 AGGGAGGCATGCGAACGGAGAGG - Intergenic
970523241 4:16906487-16906509 GGAAAGGCAGGAGGTCAGAGAGG - Intergenic
970767432 4:19566599-19566621 AGGGCGGCAGGAGAGAGGAGTGG - Intergenic
971241917 4:24897084-24897106 AGGGAGACACGCGGTCAGAGAGG + Intronic
971394491 4:26215795-26215817 AGGGATGCGGGAGGCGGGAGTGG - Intronic
971451596 4:26806180-26806202 AGGAAGGCTGGAGGGCGGATGGG - Intergenic
971899690 4:32643514-32643536 TGGAAGGCAGGAGGAGGGAGAGG + Intergenic
971954856 4:33403525-33403547 AGGGAGGGAGGAAGTCAGGGAGG - Intergenic
972273976 4:37539713-37539735 AGGATGGCAGCAGGTCCGAGAGG - Intronic
972915989 4:43880470-43880492 AGGGAGGAAGGAGGAAGGAAAGG + Intergenic
973273772 4:48287838-48287860 AGGAAGGCAGAAGGTTAGAGAGG - Intergenic
973295228 4:48511744-48511766 AGAGAGACTGGAGGTTGGAGTGG + Intronic
973857879 4:55031724-55031746 AGGGAGGCAGGATGTTGTACTGG - Intergenic
975048645 4:69832032-69832054 AGAGAGGCTGGAGGTGAGAGTGG - Intronic
975395583 4:73869863-73869885 CGTGAGGCAGGAGGTCGGGCTGG - Intronic
975731553 4:77342566-77342588 AGGGAGGGAGGGGGTGGGAGTGG + Intronic
975795895 4:78007094-78007116 AGGGTGGCAGCCGGTCAGAGGGG + Intergenic
977290553 4:95160578-95160600 AGGGAGGAAGGAGGGAGGAAGGG - Intergenic
978330582 4:107608790-107608812 CTGGAGGCAGGAGGTCACAGAGG + Intronic
978582699 4:110248105-110248127 GGGGAGGCAGAAGGTCAGTGTGG + Intergenic
978705092 4:111698449-111698471 AGGGAGGGGGGAGGAAGGAGGGG + Intergenic
979527722 4:121735165-121735187 GGTGAGGCAGGAGGTCAGAGAGG - Intergenic
979809815 4:125022331-125022353 AGGAGGGCAGAAGGTCAGAGAGG + Intergenic
980493485 4:133560663-133560685 AGGGAGCCAGGAGCAGGGAGAGG + Intergenic
981514022 4:145587751-145587773 AGGGAAGCAGGAGTAGGGAGTGG + Intergenic
981672223 4:147300072-147300094 AGGGAGACAGGAGTGCGGAAGGG + Intergenic
981676672 4:147350825-147350847 AGGAAGGCAGGAGGAGGGGGAGG + Intergenic
982121817 4:152150374-152150396 AGGGAGGCTGGGGTTGGGAGAGG - Intergenic
983883425 4:172957436-172957458 AGCGGGGCAGTAGGTGGGAGTGG + Intronic
984268021 4:177517259-177517281 AGGGAAGCAGCAGGTCAGAGGGG - Intergenic
984620771 4:181949803-181949825 AGGGAGGCAGGGGGCTTGAGAGG - Intergenic
984888973 4:184474626-184474648 GCGGAGGGAGGAGGGCGGAGAGG - Intergenic
984999383 4:185469656-185469678 GTGGAGGCAGGAGGGCGGAGAGG + Intronic
985155354 4:186982328-186982350 AGGGAGGCAGGAAATCAGACAGG - Intergenic
985214610 4:187637629-187637651 AGGGAGGAGGGAGGACGGAGGGG - Intergenic
985327568 4:188789168-188789190 TGGAAGGTAGGAGGTGGGAGAGG - Intergenic
985700426 5:1368561-1368583 AGGGAGGCGGGAGAGCGGTGGGG + Intergenic
986089890 5:4493608-4493630 AGAGAGGCAGGAGGAGAGAGAGG - Intergenic
986311379 5:6553422-6553444 AGGGAGGCAGGAAGTCAGTAAGG + Intergenic
986390878 5:7287235-7287257 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
986476714 5:8142205-8142227 AGGGAGGCAGTAGGTCCCCGGGG - Intergenic
986517681 5:8581061-8581083 AGGGAGGCAGGTGGGAGGAGGGG - Intergenic
986560253 5:9053636-9053658 ATGGAGTCTGGAGGTCTGAGTGG - Intronic
987038230 5:14038660-14038682 AGGTAGGTTAGAGGTCGGAGCGG - Intergenic
987213849 5:15712721-15712743 AGGAAGGAAGGAGGACAGAGAGG + Intronic
987335045 5:16891385-16891407 AGAGAGGAAGGAGGAAGGAGGGG + Intronic
987864884 5:23525861-23525883 AGGGAGGGAGGATGTGGCAGAGG + Intronic
987905070 5:24066318-24066340 TGGAAGGCAGGAGGAGGGAGAGG - Intronic
988066224 5:26230637-26230659 AGGAAGGAAGGAGGACGGAAGGG - Intergenic
988578680 5:32450150-32450172 AGGGAAGCAGTATGTCGCAGAGG - Intergenic
989183571 5:38601629-38601651 AAGGAGCCAGGAGGTCCCAGTGG - Intronic
989440508 5:41466700-41466722 AGGGAGGCAGGGAGTTGGTGGGG - Intronic
990227706 5:53674396-53674418 AGGGTGGGAGGAGGTCAGAGTGG + Intronic
990261125 5:54023645-54023667 AGGGAGGAGGAAGGTCAGAGAGG - Intronic
990297925 5:54421373-54421395 AGGGAGGGAGGGGGAGGGAGAGG + Intergenic
990499896 5:56385699-56385721 AGGGAAGCAGGAGGAAGAAGAGG - Intergenic
991676601 5:69094449-69094471 AGGGAGGCAGGCAGGGGGAGAGG - Intronic
992267623 5:75034178-75034200 ATGCTGGCAGGAGGTTGGAGAGG + Intergenic
992605091 5:78447902-78447924 AAGGAGGCAGGAGGGAGAAGAGG - Intronic
992678962 5:79134094-79134116 AGGGAGGAAGGAGGGCGGGGAGG + Intronic
992997348 5:82346536-82346558 AGGGAGGTGGGAGGAGGGAGCGG - Intronic
993779253 5:92045345-92045367 AGAGAGGAAGGAGGAAGGAGAGG - Intergenic
993845065 5:92931110-92931132 AGGGAGGCAGGGTGAGGGAGAGG + Intergenic
994869692 5:105331648-105331670 AGGGAGGAAAGAGGAGGGAGGGG + Intergenic
995582371 5:113615440-113615462 AGGGAGGTTGGTGGTGGGAGGGG + Intergenic
996258475 5:121435868-121435890 ATGGAAGCAGGAGGAGGGAGAGG + Intergenic
996280767 5:121726738-121726760 ATGGAGGCAGGGGGTCGTGGGGG + Intergenic
996496492 5:124162832-124162854 AGGGAGAAAGGAGGTGGAAGAGG + Intergenic
996553196 5:124751195-124751217 TGGGAGGAAGGAGGTGGGGGTGG - Intergenic
996748142 5:126863884-126863906 AGGAAGGAAGGAGATAGGAGTGG + Intergenic
997583452 5:135031147-135031169 AGGGAGGGAGCAGGTCTGAATGG + Intronic
998137684 5:139682716-139682738 GGGGTGGCAGGAGCTCCGAGGGG + Intronic
998477202 5:142432010-142432032 CAGGAGGCGGGAGGTAGGAGAGG + Intergenic
998566208 5:143217959-143217981 AGGGTGAGAGGAGGTCAGAGGGG - Intronic
999129609 5:149272471-149272493 AGGGAGGGAGGAGGCGGGGGTGG + Intronic
999210667 5:149885920-149885942 AGGGAAGCAAGAGGTCAGAGAGG - Intronic
999561851 5:152812202-152812224 AGGGAGGGAGGCGGAAGGAGTGG - Intergenic
999609203 5:153351072-153351094 AGTGAAGCAGGAGGCCAGAGAGG - Intergenic
999650989 5:153767365-153767387 AGGGAGGCAGCTGGTTGCAGTGG + Intronic
1000020251 5:157311889-157311911 AGGGAGGCAGGAGGGTAAAGTGG + Intronic
1000185242 5:158851893-158851915 GGGGAGGCAGGGGGGAGGAGAGG + Intronic
1000298002 5:159928836-159928858 AGGGAGGCAGCTGGTTGGGGAGG + Intronic
1000453480 5:161419813-161419835 AGGGAGGTAGGAGGGCAGTGAGG + Intronic
1001108372 5:168875138-168875160 AGGGAGGAAGGAGGGAAGAGAGG + Intronic
1001279495 5:170376503-170376525 CGGGAGGTAGGAGGAGGGAGAGG - Exonic
1001570085 5:172725164-172725186 AGGGCTGCAGGTGGTGGGAGCGG + Intergenic
1001805266 5:174579306-174579328 AGGGCAGCAGGAAGTCAGAGAGG + Intergenic
1002079477 5:176728863-176728885 AGGGAGGCAGAAGGTGGGGCTGG - Intergenic
1002193545 5:177490826-177490848 GAAGAGGCAGGAGGTGGGAGAGG + Intronic
1002279622 5:178122782-178122804 AGGGAGACAGGAGGTGGGTGCGG - Exonic
1002453529 5:179332706-179332728 AGGGAGGGAGGGGATGGGAGAGG + Intronic
1002453535 5:179332730-179332752 AGGGAGGGAGGAGTGCAGAGAGG + Intronic
1002482618 5:179513303-179513325 AGGGAGGGGGGAGGGAGGAGGGG - Intergenic
1002594254 5:180312012-180312034 AGGGAGGCAGGGAGGCGGGGAGG + Intronic
1002594271 5:180312052-180312074 AGGGAGGCAGGGAGGCGGGGAGG + Intronic
1002594291 5:180312108-180312130 AGGGAGGCAGGGAGGCGGGGAGG + Intronic
1002904694 6:1438852-1438874 AGGGAGGGAAGAGGGCAGAGAGG - Intergenic
1002932985 6:1647023-1647045 AGGGAGGAAGGATGGCGGAAAGG + Intronic
1003026248 6:2558248-2558270 AGGGAGGAAGCAGGTTGGAGTGG - Intergenic
1003365615 6:5472090-5472112 AGGCAGCAATGAGGTCGGAGGGG - Intronic
1003389819 6:5703948-5703970 AGGGAGGAAGGAGCTCAGAGAGG - Intronic
1003514117 6:6804259-6804281 AAGGAGGCAGGAGGTAGAAAAGG + Intergenic
1003516380 6:6822272-6822294 AGGGAGGCAGGAAGAAGCAGAGG - Intergenic
1004031674 6:11876275-11876297 AGGAAGGAAGGAGGTGGGGGAGG + Intergenic
1004199182 6:13532186-13532208 AAGGAGGCAGGAGGTCAGAAAGG - Intergenic
1004320668 6:14629022-14629044 AGGGAGGGAGGAGGACAGAAAGG - Intergenic
1005826062 6:29632579-29632601 AGGGAGGCAGGAGGAGGGTGGGG - Intronic
1006089588 6:31620655-31620677 AGGGAGGTGGGAGGTGGGAGGGG + Intergenic
1006358733 6:33575734-33575756 AGGGAGGCAGTAGCTCGCATGGG - Intronic
1006546654 6:34786616-34786638 GGGGTGGCAGCAGGGCGGAGGGG - Intergenic
1006547568 6:34792342-34792364 CGTCAGGGAGGAGGTCGGAGAGG - Intronic
1006596976 6:35200741-35200763 AGGGTGGCAGGAGTTCAGAGAGG - Intergenic
1006941047 6:37752620-37752642 AGGGAGGCAGTAGTGGGGAGGGG - Intergenic
1007399099 6:41593692-41593714 AGGGAGGCGGGCGGCTGGAGTGG - Intronic
1007742769 6:44022896-44022918 GGGGAGGCAGGAGGTCAGCCAGG - Intergenic
1007815108 6:44516767-44516789 AGAGTGGCAGGGGGTGGGAGAGG - Intergenic
1008024212 6:46616008-46616030 AGGGAGGGAGGGGGAGGGAGGGG - Intronic
1008429417 6:51398231-51398253 GGGGAAGCAGGAGGTGGAAGAGG - Intergenic
1008801962 6:55379301-55379323 GGGGAGGGAGGAGGAGGGAGAGG - Intronic
1008846666 6:55974394-55974416 AGGGAGGGAGGAGGAAGGATTGG - Intergenic
1010686734 6:78861674-78861696 TGGGAGGCAGCAGGACAGAGTGG + Intergenic
1011314532 6:86016799-86016821 AGGGAGGAAGGGGGGCGGTGGGG + Intergenic
1011476109 6:87751288-87751310 GGGGTGGCAGCAGGGCGGAGGGG + Intergenic
1012772331 6:103454735-103454757 ATGGAGGTAGGAGGTAGGACTGG + Intergenic
1012983071 6:105850278-105850300 AGGGCCGCAGGGGGCCGGAGAGG + Intergenic
1013364283 6:109424099-109424121 AGGGTGGCAGGAGGGGTGAGCGG + Intronic
1014029251 6:116681773-116681795 AGGGAGGCTGGCGGATGGAGAGG - Intronic
1014082184 6:117300522-117300544 AGGGAGGGAGGAAGTTGAAGAGG + Intronic
1014160033 6:118157250-118157272 GGGAAGGCAGGAGGAGGGAGCGG + Intronic
1014552824 6:122808645-122808667 AGGGAGGGAGGGGGGAGGAGGGG - Intronic
1014935482 6:127380480-127380502 AGGGAGGTAGTGGGTGGGAGGGG - Intergenic
1015136999 6:129883489-129883511 TGGGAGGCAGCAGTTTGGAGGGG + Intergenic
1015770899 6:136767355-136767377 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1015877242 6:137834918-137834940 AGGGAGGCAGGAGGGAGGGAAGG + Intergenic
1016295546 6:142569753-142569775 AGGGAGGCAGGAAGAGGGAAAGG + Intergenic
1016992963 6:149942375-149942397 AGGCTGGCAGGAGGGTGGAGGGG + Intronic
1017005372 6:150025147-150025169 AGGCTGGCAGGAGGGTGGAGGGG - Intronic
1017213472 6:151882137-151882159 TGGGACGCAGGAGGAAGGAGAGG + Intronic
1017960506 6:159217013-159217035 GTGGAGGCTGGAGGTGGGAGCGG + Intronic
1017983363 6:159421888-159421910 AGGCAGGCAGGAGGTGGAAAGGG + Intergenic
1018681613 6:166270165-166270187 AAGCAGCAAGGAGGTCGGAGGGG + Intergenic
1018698379 6:166407967-166407989 AGGGAGGCAGGAGGGCTGGGCGG + Intergenic
1019005805 6:168795448-168795470 AGGGAACCAGGAGGACAGAGAGG - Intergenic
1019162924 6:170081013-170081035 CGGGGGTCAGGAGGTCGCAGTGG - Intergenic
1019212156 6:170415247-170415269 AGGGAGGGAGCAGGTCTGAAGGG + Intergenic
1019335703 7:481585-481607 AGGGAGGGAGGAGGGTGGGGAGG - Intergenic
1019351458 7:556017-556039 AGGGAGACAGGGGCCCGGAGGGG - Intronic
1019483546 7:1277200-1277222 AGGGAGGGAGGAGGGAGAAGGGG - Intergenic
1019542853 7:1559380-1559402 GGGCAGGCAGGGGGTCGGGGTGG - Intronic
1019624880 7:2011055-2011077 AGGGAGGCAGGGGGTTCGGGGGG + Intronic
1019709388 7:2511385-2511407 AGTGAGGCAGGAGGCTGGAGGGG - Intergenic
1019801394 7:3090908-3090930 TGGCAAGCAGGAGGTCAGAGTGG + Intergenic
1019931292 7:4225066-4225088 AGGGAGGCAGGCGTTCAGGGAGG - Intronic
1019938384 7:4270946-4270968 AGGGAGGGAGGAGGACGGGGAGG + Intergenic
1020080161 7:5282628-5282650 AGGGAGAGAGGAGGTAGAAGGGG + Intronic
1020080168 7:5282647-5282669 GGGGAGGGAGGAGGAGGGAGAGG + Intronic
1020331111 7:7017803-7017825 TGGGTGGCAGGAGGTGTGAGGGG - Intergenic
1020800076 7:12722089-12722111 AGGGAGATAGGAGATCTGAGGGG - Intergenic
1020975770 7:15004107-15004129 AGGGAGGCAGGAGAGCAGAAAGG - Intergenic
1021954180 7:25807302-25807324 AGGGAGGGAGGAGGGAGGAGTGG + Intergenic
1021986804 7:26105252-26105274 CAGAAGGCTGGAGGTCGGAGTGG - Intergenic
1022207802 7:28180348-28180370 AGGGAGGCGGCAGGGCGGGGAGG - Intronic
1022459969 7:30595378-30595400 AGGGACGCAGGAAGTCGGAGGGG - Intronic
1022514273 7:30965510-30965532 AGGGAGGGAAGTGGTGGGAGTGG - Intronic
1022726990 7:32990244-32990266 AGGGAGGCAGGGGGTCAGACCGG + Intronic
1022905931 7:34856830-34856852 TGAGAGGCAGGAGGAGGGAGAGG + Intronic
1022953747 7:35362972-35362994 AGGGCAGCAGGTGGTCAGAGGGG - Intergenic
1023058317 7:36307241-36307263 AGGGAGGAGGGAGGTGGGAGTGG - Intergenic
1023742817 7:43295602-43295624 AGGGAGGCAAGAGGCCCAAGGGG + Intronic
1023776783 7:43615677-43615699 TGGGAGGCATGAGGTTGGAAAGG - Intronic
1023932107 7:44712365-44712387 TGGGAGACAGTAGGTCAGAGGGG + Intergenic
1023983561 7:45082788-45082810 AGGGAGGAAAGAGGCCTGAGTGG - Exonic
1023991688 7:45132548-45132570 AGGGAGGGAGGAAGGAGGAGAGG + Intergenic
1023991709 7:45132600-45132622 AGGGAGGGAGGAGGTGGGAGAGG + Intergenic
1024074277 7:45810790-45810812 CGGGAGGCAGGAGGCCGGGAAGG - Intergenic
1025034860 7:55587729-55587751 AGGGAGGGAGAGGGTGGGAGAGG - Intergenic
1025046592 7:55697389-55697411 AGGGAGGCAGGCGGTCAGACCGG - Intergenic
1025922660 7:65927946-65927968 AGGCAGGAAGGAGGAGGGAGCGG + Intronic
1026104436 7:67409980-67410002 AGGGAGGGAGGAGGGAGGGGAGG - Intergenic
1026122512 7:67550295-67550317 AGGGAGGAAGGAGAGGGGAGGGG - Intergenic
1026656931 7:72264820-72264842 AGGCAGGTAGGAGGAGGGAGAGG - Intronic
1026781747 7:73272759-73272781 TGGGAGGCAGGAGGTGGGTAAGG - Intergenic
1027022596 7:74826193-74826215 TGGGAGGCAGGAGGTGGGTAAGG - Intronic
1027035269 7:74920624-74920646 AGGGAGTAAGGAGGTGGGCGGGG - Intergenic
1027065416 7:75119716-75119738 TGGGAGGCAGGAGGTGGGTAAGG + Intronic
1027733579 7:81905221-81905243 AGGAAGGCAGGAGGGAGGAAGGG - Intergenic
1028054478 7:86225570-86225592 TGGGGGGCAGGAGGTCAGGGGGG + Intergenic
1028128887 7:87147226-87147248 AGTGAGGCAGGAGGACTGAGTGG - Intergenic
1029388827 7:100261108-100261130 AGGCGGGGAGGAGTTCGGAGTGG + Intronic
1029394784 7:100300516-100300538 AGGGAGTAAGGAGGTGGGCGGGG + Intergenic
1029412947 7:100427125-100427147 AGGGAGGAGGGAGGGAGGAGGGG - Intronic
1029422692 7:100479290-100479312 AGGGAGGGAGGAGGAAGGGGAGG - Intergenic
1029477717 7:100794891-100794913 AGGGAGGGAGGAGAGGGGAGAGG + Intronic
1029536644 7:101161183-101161205 GGTGAGGCAGGAGCTGGGAGGGG + Exonic
1029575386 7:101400150-101400172 AGGGAGGCAGGGGTGGGGAGGGG + Intronic
1029615086 7:101651239-101651261 AGTGAGGCAGGAGGTGGCAGTGG - Intergenic
1030789462 7:113706223-113706245 AGGAAGGCAGGAGGTCAGAGAGG - Intergenic
1032016619 7:128384120-128384142 GGGGAGGGAGGAGGTTGGTGGGG + Intergenic
1032298980 7:130668984-130669006 AGCGAGGCGGGAGGACTGAGGGG + Exonic
1032339118 7:131054535-131054557 AGGGAGGGAGGAGGGAGGAAGGG + Intergenic
1032746668 7:134793132-134793154 AGGGAGGCAGGCGCTGAGAGGGG + Intronic
1033150860 7:138913945-138913967 AGGGAGACAGGAAGGAGGAGGGG + Intronic
1033329202 7:140404115-140404137 AGCGAGGCAGGAGGAAGAAGGGG + Exonic
1033534309 7:142298197-142298219 AGAGAGGCAGGAGGGAGGAAAGG + Intergenic
1033928397 7:146492216-146492238 AGGGGGGCAGGAGGAGAGAGAGG + Intronic
1034244533 7:149634614-149634636 GGGGAGGCAGTAGGTCAGGGTGG + Intergenic
1034448139 7:151123704-151123726 AGGGAGGCAGGAGGGAGGCCGGG + Intronic
1034540434 7:151754830-151754852 AGGGAGGCAGGGGAACTGAGGGG - Intronic
1035174010 7:157037698-157037720 AGGGAGGCAGGAGAAAGGGGAGG + Intergenic
1035223107 7:157418489-157418511 AGGGAGGCAGGTGGTTCGACAGG + Intergenic
1035275451 7:157745483-157745505 AGGGAGGCAGGCTGGGGGAGAGG + Intronic
1035741110 8:1929524-1929546 CGGGAGGCAGGAGGCCGGTGGGG - Intronic
1036656381 8:10679887-10679909 AGGGAGGCCTGTGGTCTGAGTGG - Intronic
1036755581 8:11468727-11468749 AGGGAGCCAGGAGGTAGAGGTGG - Intronic
1037818320 8:22123639-22123661 AGGGAGAAAGCAGGTAGGAGAGG - Exonic
1037831583 8:22192776-22192798 AGGGAGGCAGGTGATCCTAGAGG + Intronic
1038215097 8:25554746-25554768 ATGGAAGCAAGAGGTTGGAGTGG + Intergenic
1038328498 8:26589928-26589950 ATGGAGGCAGGAGGGCTGGGAGG + Intronic
1038542639 8:28402277-28402299 AGGGAGGGAGGAGGAGGGACAGG + Intronic
1039063929 8:33593523-33593545 AGCCAGCCAGGAGGTAGGAGGGG - Exonic
1039218889 8:35305850-35305872 AGGGAGGGAGGGGGAGGGAGGGG - Intronic
1039454687 8:37698714-37698736 GGGGAGGGAGGAGGAGGGAGAGG - Exonic
1039554714 8:38467824-38467846 AGGGAGCCAGGAGGTGAAAGGGG + Exonic
1039725552 8:40212298-40212320 TGGGTGGCAGTGGGTCGGAGTGG - Intergenic
1039772683 8:40703589-40703611 AGGGAGGAGGGAGATGGGAGGGG + Intronic
1039923372 8:41908331-41908353 AGAGAGCCAGGAGGTGGCAGGGG - Intergenic
1040339825 8:46434889-46434911 AGGCAGGCAGAAGGTAGAAGTGG - Intergenic
1040466183 8:47697547-47697569 AGGGAGGCAGGAGGCCTGGCAGG - Intronic
1040523751 8:48199933-48199955 AGAGAGGGAGGAGGGAGGAGAGG - Intergenic
1041557892 8:59179503-59179525 AGAGAGGAAGGAGGTGGGTGTGG - Intergenic
1041625812 8:60025405-60025427 AGGGAGGCAGCAGAGTGGAGTGG + Intergenic
1042021788 8:64377351-64377373 AGGGAGGGGGTGGGTCGGAGCGG - Intergenic
1042021933 8:64378008-64378030 AGGGAGGCGGGAGAGAGGAGGGG - Intergenic
1042166595 8:65951611-65951633 TGGGAGGCAGCAGGTAAGAGGGG - Intergenic
1043796586 8:84549454-84549476 ATGGATCCAGGAGGTGGGAGAGG + Intronic
1044170801 8:89049688-89049710 ATGGTGGCAGGAGGTGGCAGGGG + Intergenic
1044326431 8:90864342-90864364 AGGGAGGGAGGGGGAGGGAGTGG + Intronic
1044398352 8:91741121-91741143 ATGGAGGCAGTAGGTCTAAGGGG + Intergenic
1044430671 8:92103160-92103182 AGGGAGGGAGGCGGGAGGAGGGG - Intronic
1045125949 8:99089080-99089102 AGGGAGGCAGTAGGGCAAAGTGG + Intronic
1045295759 8:100870534-100870556 AGGCTGGCAGAAGGTTGGAGGGG + Intergenic
1045346408 8:101297730-101297752 AGGGAGGCAGGAGAACAGAGTGG + Intergenic
1045504126 8:102766756-102766778 AGGGAGGCACGAGGTCAGAAGGG - Intergenic
1046547467 8:115669237-115669259 GGGGAGGGAGGAGGGGGGAGAGG - Intronic
1046680086 8:117158997-117159019 AGGGAGACAGGAGATCAGAGAGG + Intronic
1047297176 8:123581402-123581424 AGGGAGACTGGAGGTGGGGGAGG - Intergenic
1047319257 8:123764224-123764246 AGGGAGGCAGTAGGGAGAAGTGG + Intergenic
1047402483 8:124558416-124558438 AGGGAGGGAGGAGGATGGACAGG + Intronic
1047512825 8:125528769-125528791 TGGGAGCCAGGAGCTAGGAGTGG - Intergenic
1047538635 8:125743005-125743027 AGGGAGACAGGAGAGTGGAGGGG - Intergenic
1047549050 8:125850037-125850059 AAGGAGGGAGGAAGTGGGAGAGG - Intergenic
1047772264 8:128039000-128039022 AGGGAGGCAGAAGGAAGGGGAGG + Intergenic
1048042616 8:130745890-130745912 AGGGAGGCAGGAAGAGGAAGAGG + Intergenic
1048209507 8:132443143-132443165 AGGTAGGGAGGGGGTCGGGGAGG + Intronic
1048925138 8:139264867-139264889 AGGGAGGAGGGAGGCGGGAGGGG - Intergenic
1049049595 8:140183981-140184003 AGGGAGGAGGGAGGAGGGAGGGG + Intronic
1049070150 8:140349615-140349637 AGGGAGGCGGCAGGAGGGAGCGG + Intronic
1049109819 8:140635697-140635719 GGGGAGGAAGGAGGAGGGAGGGG + Intergenic
1049307174 8:141910275-141910297 AGGGAGGCACGGGGGAGGAGAGG + Intergenic
1049356704 8:142192731-142192753 AGGGAGGGAGGAGCAGGGAGGGG + Intergenic
1049361122 8:142213004-142213026 AGAGAGGGAGGAGGAGGGAGGGG - Intronic
1049432625 8:142572293-142572315 AGGGAGGCAGGTGGTGTGTGGGG - Intergenic
1049604229 8:143521588-143521610 GGGCAGGCAGGAGGTGGGACAGG + Intronic
1050325019 9:4490386-4490408 AGCGAGGAAGGAGGGAGGAGCGG - Intergenic
1051038409 9:12776530-12776552 GGGAGGGCAGGAGGGCGGAGCGG - Intronic
1051331890 9:16032142-16032164 AGGGAGGAAGGTGGCAGGAGAGG + Intronic
1051743145 9:20270446-20270468 AGGGAGGAAGAAGGATGGAGAGG - Intergenic
1051894729 9:21975186-21975208 AGGGAGGCCGGAGGGCGGTGTGG - Intronic
1052049746 9:23831348-23831370 AGGGAGGAAGGAAGACGGGGAGG - Intergenic
1053003330 9:34589754-34589776 AGGGAGGGAGGAGGATGGGGGGG - Intronic
1053317461 9:37064108-37064130 AGGGAGGGAGGAAGGCAGAGAGG - Intergenic
1053321792 9:37105222-37105244 AGGGAGGCAGGAAGGCAGAGAGG - Intergenic
1053443604 9:38135430-38135452 GGGGAGGCAGGAGGAAGGGGAGG - Intergenic
1053566086 9:39253658-39253680 AGGGAAGCAGGAGGAAGGTGGGG - Intronic
1053831853 9:42091473-42091495 AGGGAAGCAGGAGGAAGGTGGGG - Intronic
1054131062 9:61365382-61365404 AGGGAAGCAGGAGGAAGGTGGGG + Intergenic
1054153628 9:61625194-61625216 AGGGAGGCAGGCGGAAGCAGGGG - Intergenic
1054179936 9:61901591-61901613 AGGGAGGCAGGCGGAAGCAGGGG + Intergenic
1054188167 9:61969049-61969071 AGGGAGGAGGGAGGACAGAGGGG - Intergenic
1054473410 9:65556322-65556344 AGGGAGGCAGGCGGAAGCAGGGG - Intergenic
1054598691 9:67095953-67095975 AGGGAAGCAGGAGGAAGGTGGGG + Intergenic
1054657656 9:67679550-67679572 AGGGAGGCAGGCGGAAGCAGGGG - Intergenic
1055245698 9:74239907-74239929 AGGGAGCCAGGAGGATGCAGAGG + Intergenic
1055505451 9:76943697-76943719 AGGTAGGCAGGAGGTGTTAGAGG - Intergenic
1055687424 9:78791712-78791734 AGGGAAGCAGGAGGTAGGAAGGG + Intergenic
1055885298 9:81055657-81055679 AGGGAGGGAGGTGGTCATAGCGG + Intergenic
1056446014 9:86666842-86666864 AGGGAGGCATGACTTCAGAGGGG + Intergenic
1056764142 9:89434573-89434595 AGAGAGGCAGGAGGGCAGAGAGG - Intronic
1057028313 9:91754058-91754080 AGGGAGGCAGGAGGCCTGGAAGG + Intronic
1057261597 9:93587604-93587626 AGGGATGGAGGAGCTCTGAGGGG + Intronic
1057421597 9:94917418-94917440 AGAGAGGCATGAGGGCGGAAGGG - Intronic
1057456287 9:95215339-95215361 AGGGAAGAAGGTGGTAGGAGAGG + Intronic
1057500432 9:95593563-95593585 AGGGAGGCAGAAGGCAGGACGGG + Intergenic
1057799669 9:98182683-98182705 AAGGAGGCAGGAGCCCAGAGAGG - Intronic
1058074854 9:100640310-100640332 AGTGAGGCAGGAGGTTGTAGTGG + Intergenic
1059278132 9:113112188-113112210 TGGGAGGCTGGAGGTGAGAGAGG + Intergenic
1059471555 9:114508559-114508581 GGGGAGGCAGGATGTTGGGGAGG - Intergenic
1059763730 9:117363490-117363512 AGGGAGGCGGGAGGTTAGAATGG - Intronic
1059862949 9:118485434-118485456 AGGGAGGAGGGAGGAGGGAGTGG + Intergenic
1059879915 9:118678173-118678195 AGGGCGGCTGCCGGTCGGAGGGG + Intergenic
1060235104 9:121857177-121857199 AGGGAGACAGGAGGTTGGACAGG + Intronic
1060406696 9:123376414-123376436 AGGGTGGCAGGGGGGCCGAGGGG - Intronic
1060497865 9:124131179-124131201 AGAGAGGCAGGAGCCCAGAGAGG + Intergenic
1060735736 9:126065556-126065578 AGGGAGGGAGGAGGAGGGAAAGG - Intergenic
1060793121 9:126498812-126498834 AAGGAGGGAGGAGGCTGGAGGGG + Intronic
1060818868 9:126650387-126650409 AGGCAGGCGGGAGCTCCGAGGGG + Intronic
1060949935 9:127594995-127595017 AGGGAGGGAGGAGGTTGGCAGGG + Intergenic
1061062090 9:128255515-128255537 AGGGAGGCAGGGGGACAGAATGG + Intergenic
1061274171 9:129559807-129559829 AGGGAGGCAGGAGCTCCTGGAGG + Intergenic
1061293443 9:129665329-129665351 AGTGAGGCTGGAGCTGGGAGTGG + Intergenic
1061423302 9:130483866-130483888 AGGGAGACAGGAGGGGAGAGTGG - Intronic
1061482986 9:130906343-130906365 AGGCAGGCAGGAGGGAGAAGCGG - Intronic
1061852206 9:133422862-133422884 CAGGAGGCAGGAGGTGGGTGAGG - Intronic
1061893547 9:133635263-133635285 AGGGAGGGAGGAGGCTGGGGAGG + Intergenic
1061913063 9:133735044-133735066 AGAGAGCCAGGAGGAGGGAGAGG + Intronic
1061958169 9:133974354-133974376 GGGGAGGCTGGAGGTTGGAGGGG - Intronic
1062006892 9:134243083-134243105 AGGGAGCCAGGAGGACGCAGCGG + Intergenic
1062044760 9:134419873-134419895 GGAGAGCCAGGAGGCCGGAGCGG - Intronic
1062149547 9:135010587-135010609 AGTGAGGTAGGAGGTGGGACTGG - Intergenic
1062190806 9:135246943-135246965 AGAGAGGAAGGAGGAAGGAGAGG + Intergenic
1062196361 9:135276397-135276419 TGTGTGGCAGGAGGTTGGAGGGG - Intergenic
1062203476 9:135321512-135321534 TGGGAGTCAGGAGGGCGGATCGG + Intergenic
1062290455 9:135792050-135792072 CGTGAGCCAGGGGGTCGGAGCGG - Exonic
1062359429 9:136180626-136180648 AGGGAGGCAGGAGGCCTGGAGGG + Intergenic
1062392109 9:136337985-136338007 AGGGAGACAGCAGGCCGGGGGGG + Intronic
1062539426 9:137035038-137035060 AGGGAGTCAGGAGGCCTGGGTGG - Exonic
1062618297 9:137407827-137407849 CGGGAGGCGGGAGGCGGGAGGGG + Intronic
1062630861 9:137462506-137462528 AGGAAGGCACGAGGCCGGACGGG - Intronic
1185480628 X:443739-443761 AGGGAGGAAGGTGGTCGGGGAGG + Intergenic
1186309022 X:8297151-8297173 AGGGAGGAAGGAAGGGGGAGCGG - Intergenic
1186510475 X:10126326-10126348 AGGAAGGAAGGAGGACGGGGCGG - Intronic
1186888515 X:13938354-13938376 CGGGACGCTGGAGGTGGGAGGGG - Intronic
1187212529 X:17244971-17244993 GGGGCGGCTGCAGGTCGGAGGGG + Intergenic
1187371143 X:18707112-18707134 AAGGAGGCAGCCGGTCGCAGTGG - Intronic
1189256276 X:39642269-39642291 CGGCAGGCTGGAGGTTGGAGGGG + Intergenic
1190385202 X:49878332-49878354 AGGGGGGCAGCAGGTGGAAGTGG - Intergenic
1190528594 X:51352594-51352616 AGGGAGTCAGAAAGTCAGAGAGG - Intergenic
1190713742 X:53087553-53087575 AGGGAGGCAGGAAGGCAGTGTGG - Intronic
1190732077 X:53233079-53233101 AGGGAGGCAGGAGCTGAGTGAGG + Exonic
1191937364 X:66439853-66439875 AGGGAGGGAGGAGGGGGGCGTGG + Intergenic
1192173947 X:68874407-68874429 AGAGAGGGAGGAGGCAGGAGAGG + Intergenic
1192261004 X:69505775-69505797 AGGGAGTCAGGGGGCCGCAGAGG - Exonic
1192337163 X:70231649-70231671 AGGGAGGCAGGAGGAAATAGAGG + Intergenic
1192359487 X:70429991-70430013 AGGGAGGCAACAGAACGGAGAGG + Exonic
1194729797 X:97439880-97439902 AGGGAAGCAGGTGGTCGAATAGG + Intronic
1194959889 X:100223165-100223187 AGTGAGGCTGGAGGTGGGTGAGG - Intergenic
1195206536 X:102605116-102605138 AAAGAGGCAGGGGGTAGGAGAGG - Intergenic
1196034641 X:111130904-111130926 AGGAAGGCAGAAGTTCAGAGAGG + Intronic
1196412961 X:115439201-115439223 AGAGAGGAAGGAGGTAGGTGTGG + Intergenic
1197754653 X:129984789-129984811 AGGGAGGGAGGAGGTGCGAGCGG - Intronic
1197805313 X:130393174-130393196 AGGGAGTCAGGAGATCAGAGTGG + Intergenic
1197835114 X:130686112-130686134 AGGCAGGCAGGAGTAAGGAGTGG + Intronic
1198031358 X:132756487-132756509 AGGGGGAAAGGAGGTGGGAGAGG - Intronic
1198183123 X:134229448-134229470 TGGAAGGCAGGAGTTAGGAGGGG - Intergenic
1198228796 X:134670328-134670350 TAGGAGGCAGGAGGTGGGAGGGG - Intronic
1200003326 X:153072843-153072865 AGGGCGGCTGGGGGTGGGAGTGG + Intronic
1200004397 X:153077166-153077188 AGGGCGGCTGGGGGTGGGAGTGG - Intergenic
1200061662 X:153486451-153486473 AGGGGGCCAGGAGGCCGCAGTGG + Intronic
1200155009 X:153970573-153970595 AGGGAGGAAAGAGGAGGGAGAGG + Intronic
1201517642 Y:14835328-14835350 AGGGAGGAAGGAGGGAGGAGGGG + Intronic
1201698521 Y:16854231-16854253 AGGAAGGAAGGAGGGGGGAGGGG - Intergenic
1201948920 Y:19541810-19541832 AGGGAGGCAGGATGTGGGTTGGG - Intergenic
1202367717 Y:24178470-24178492 AGGGAGGCAGGGGGACAGAACGG - Intergenic
1202503066 Y:25491653-25491675 AGGGAGGCAGGGGGACAGAACGG + Intergenic