ID: 1142000422

View in Genome Browser
Species Human (GRCh38)
Location 16:87661199-87661221
Sequence GTAAGAGGGAGGCAGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1226
Summary {0: 1, 1: 1, 2: 4, 3: 111, 4: 1109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000422_1142000436 29 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000436 16:87661251-87661273 TTATCCACCCAGATAATCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 170
1142000422_1142000431 -3 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110
1142000422_1142000432 -2 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000422_1142000428 -9 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000422_1142000435 28 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000435 16:87661250-87661272 ATTATCCACCCAGATAATCCAGG 0: 1
1: 1
2: 5
3: 58
4: 311
1142000422_1142000430 -4 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000422 Original CRISPR GTAAGAGGGAGGCAGGAGGT CGG (reversed) Intronic
900372410 1:2337815-2337837 CTGAGAGGGAGGCAGGGGCTGGG + Intronic
900384021 1:2401232-2401254 GAAGGAGGGAGGAAGGAGGGAGG - Intronic
900384025 1:2401243-2401265 GGAGGAGGGAGGAAGGAGGGAGG - Intronic
900384039 1:2401278-2401300 GAAGGAGGGAGGAAGGAGGAGGG - Intronic
900384068 1:2401362-2401384 GGAGGAGGGAGGAAGGAGGGAGG - Intronic
900387789 1:2418494-2418516 GTCCGAGGGAGGCAGTGGGTGGG - Intergenic
900466450 1:2827857-2827879 GGAAGCGGGAGGGAGGAGGGAGG + Intergenic
900471956 1:2859460-2859482 ACAAGAGGGAGGAAGGAGGGAGG + Intergenic
900471965 1:2859492-2859514 GGAAGAGGAAGGAAGGAGGGAGG + Intergenic
900471969 1:2859503-2859525 GAAGGAGGGAGGAAGGAGGGAGG + Intergenic
900471975 1:2859524-2859546 GGAAGAGGAAGGAAGGAGGGAGG + Intergenic
900471979 1:2859535-2859557 GAAGGAGGGAGGAAGGAGGGAGG + Intergenic
900471985 1:2859556-2859578 GGAAGAGGAAGGAAGGAGGGAGG + Intergenic
900568629 1:3347540-3347562 GCAAGAGGCAGTCAGGGGGTGGG + Intronic
900943078 1:5813731-5813753 GGAGGAGGGAGGAAGGAGGAAGG + Intergenic
901125807 1:6927973-6927995 GGAGGAGGGAGGCAGGAAGAAGG - Intronic
901292292 1:8133410-8133432 GCAAGAGAGAGGGAGGAGGATGG - Intergenic
901400738 1:9013750-9013772 GGAAGAGGGTAGCAGGTGGTGGG + Intronic
901449703 1:9328629-9328651 GCCAGAGGGAGGCAGTGGGTGGG - Intronic
901637792 1:10678396-10678418 GTGAGGGAGAGGCAGCAGGTGGG + Intronic
901751658 1:11413806-11413828 GAAAGAGGGAGGAGGGAGGAGGG - Intergenic
901829023 1:11880880-11880902 GAAAGATGGAGGCGGGAGGGAGG - Intergenic
902546522 1:17193849-17193871 GAGAGCAGGAGGCAGGAGGTGGG + Intergenic
902583897 1:17426317-17426339 GTGAGAAGGGAGCAGGAGGTGGG - Intronic
902613682 1:17612054-17612076 GTAAAAGGGAGGGAGGGGGATGG - Intronic
902722321 1:18312115-18312137 GCAAGAGGGAGACAAGAGATGGG - Intronic
902892120 1:19452110-19452132 GTAAGAGGACTGCAGGGGGTGGG - Intronic
902990561 1:20184778-20184800 CTAAGAGGGAGGAGGGAGGGAGG + Intergenic
903038863 1:20513370-20513392 AGAAGAGGGAGGAAGGAGGGAGG + Intergenic
903041178 1:20531894-20531916 ATAAGAAGGAGGCAGAAGGTGGG + Intergenic
903140222 1:21334870-21334892 GCAGGAGGGAGGCAGGAGCGCGG - Intronic
903162591 1:21499931-21499953 GTAAGGGGAGGCCAGGAGGTAGG + Intergenic
903236663 1:21955234-21955256 GAAACAGGGAGCCAGGAGGAGGG + Intergenic
903268690 1:22174327-22174349 GGGAGAGGGAGGGAGGAGGAAGG - Intergenic
903367929 1:22816392-22816414 GTATGAAGAAGGCAGGAGGCAGG - Intronic
903390259 1:22958974-22958996 GCAGGATGGGGGCAGGAGGTGGG - Intronic
903658879 1:24965046-24965068 GTACGAGGGCGGCCGGGGGTGGG + Intronic
903733484 1:25515165-25515187 GAGAGTGGGAGGAAGGAGGTTGG - Intergenic
903767604 1:25744617-25744639 GTGAGAGGGAGGGAGAAGTTAGG - Intronic
903931371 1:26864227-26864249 GCAGGAGGGAGGCAAGAGGAGGG - Exonic
904025840 1:27503204-27503226 GGGAGAGGCAGGCAGGTGGTTGG + Intergenic
904087177 1:27917076-27917098 GGAGGAGGGAGGAAGGAGGAAGG - Intergenic
904253403 1:29239816-29239838 GAAAGAGGGAAGGAGGAGGCTGG - Intronic
904284185 1:29443502-29443524 GGAAGAAGGAGGTGGGAGGTGGG + Intergenic
904301815 1:29559183-29559205 GTAGGAGGTGGGCAGGAGTTAGG + Intergenic
904497708 1:30896432-30896454 AGAAGAGGGAGGCAGGAGTGAGG + Intronic
904807475 1:33142116-33142138 CTAGGAGGGAGGTGGGAGGTGGG - Intergenic
904928572 1:34067847-34067869 GTAAGTGGGAGCCAGAAGGGAGG - Intronic
905249826 1:36640805-36640827 ACAAGAGGAAGGCAGGAGGAGGG - Intergenic
905687809 1:39921474-39921496 GAAGGTGGGCGGCAGGAGGTGGG - Intergenic
905783154 1:40730444-40730466 GTAATAGGGAGGCCCGAGGTGGG + Intronic
905954993 1:41985241-41985263 CTAAGAAGGAGGCAGGAGCCAGG + Intronic
906470819 1:46129101-46129123 AGAAGAGGGAGGCAAGAGGAAGG + Intronic
906591015 1:47024006-47024028 GGAGGAGGGAGGAAGGAGGAGGG + Intronic
906622756 1:47297690-47297712 GGGAGAGTGAGGCAGGAGGGTGG - Intronic
906645298 1:47470356-47470378 GTAAGAGAGAGGAAGGAGTTGGG + Intergenic
906795312 1:48692138-48692160 CTAAGAGGGAGGAAGGAGAGAGG + Intronic
907155321 1:52328086-52328108 GTAGGAGGGAGGCAAGATTTGGG + Intronic
907290910 1:53412361-53412383 GCATGAAGGAGGCAGAAGGTGGG + Intergenic
907899077 1:58720985-58721007 GTGAGATGAAGCCAGGAGGTAGG + Intergenic
908446584 1:64203571-64203593 GAGAGACGGAGGCAGGGGGTTGG - Intergenic
909382720 1:75018310-75018332 TTAAGAGGTATGCAGGAGATCGG + Intergenic
909716844 1:78718449-78718471 GGAAAAGGGAGGGAGGATGTAGG - Intergenic
909892607 1:81026533-81026555 GTAAGAGTGAGACAGGAGGGAGG - Intergenic
910099842 1:83564158-83564180 TGAAGAGGGAGGCAGGAGAGTGG - Intergenic
910202132 1:84710503-84710525 GTAAAAGGGAGGCAGGACAAAGG + Intergenic
910388258 1:86707751-86707773 GAAAGACGGAGGCAGGAGATTGG - Intronic
911223990 1:95284171-95284193 GTAAGAGAGAGTAAGGAGTTGGG - Intergenic
911239554 1:95449987-95450009 GAAAGATGGAGTTAGGAGGTGGG - Intergenic
911412511 1:97527370-97527392 GTAAGATGGGGGCAGCAGCTGGG - Intronic
912587257 1:110778362-110778384 TGAAGAGGTAGGCAGGAGGTGGG + Intergenic
912944692 1:114075174-114075196 GGAGGTGGGAGGCAGGAGGTGGG + Intergenic
913159107 1:116129267-116129289 GAAAGAGGGAGTCGGGAGGGTGG - Intronic
914900918 1:151710604-151710626 GGAGGAGGGAGGCAGGAGAAGGG - Intronic
914991194 1:152501020-152501042 GGAAGAGGGAGGAAGGAGGAAGG - Intergenic
915024964 1:152818950-152818972 GTGTGAGGGAGGAAGGATGTTGG - Intergenic
915040524 1:152964704-152964726 GATGGAGGGAGGGAGGAGGTGGG - Intergenic
915103368 1:153516275-153516297 GTAACAGGGTGGGAGGAGGTAGG - Intergenic
915565385 1:156710032-156710054 GGAAGGGAGAGGGAGGAGGTGGG + Intergenic
915736794 1:158090323-158090345 GTAGGAGGAAGGCAGGAGGAGGG - Intronic
916887814 1:169087082-169087104 GAGAGAGGGAGGGAGGAGGAAGG - Intergenic
916976558 1:170086665-170086687 GAGAGAGGGAGGAAGGAGGGAGG - Intergenic
917459639 1:175218926-175218948 GGAAGAGGGAGGGAGGAAGGGGG + Intergenic
917515518 1:175704559-175704581 GAAAGGGGGAAGGAGGAGGTGGG - Intronic
917639386 1:176968468-176968490 GGAAGTGGGAGGTGGGAGGTGGG - Intronic
918123120 1:181557131-181557153 GTGACAGGGAGGAAGGTGGTGGG - Intronic
919033969 1:192282186-192282208 GTAATAGGGAGGCCTGAGGAGGG + Intergenic
919058839 1:192605791-192605813 GAGAGAGGGAGGGAGGAGGAGGG + Intergenic
919817192 1:201448985-201449007 GTCTGGGGGAGGCAGGAGATTGG - Intergenic
919938874 1:202272862-202272884 CTAGGAGGCAGGCAGGAAGTGGG - Intronic
920116361 1:203624494-203624516 GGAAGAGGGAGGGAAGAGGGAGG + Intergenic
920159752 1:203987396-203987418 GGGAGGTGGAGGCAGGAGGTTGG - Intergenic
920189773 1:204186173-204186195 TTAAGAGGGAAGCAGGTGGAGGG + Intergenic
920309280 1:205039118-205039140 GAGAGAGGGAGGTAGGATGTGGG - Intergenic
920548351 1:206837369-206837391 ATAAGAGGGAGGAAGGAATTTGG + Intronic
920646513 1:207807806-207807828 GTAAGAGGGAGGGAGGGACTCGG + Intergenic
920886052 1:209929103-209929125 AAAAGAGGAAGGGAGGAGGTGGG - Intergenic
921309135 1:213825396-213825418 GGAAGAGGGAGGGAGCAGGGAGG + Intergenic
921334481 1:214072636-214072658 GGCAGAGGGAGGCAGCAGGGGGG - Intergenic
921753855 1:218829447-218829469 GTAATAGTGAGGTAGGAGGTGGG - Intergenic
921800745 1:219399575-219399597 GTAAGAGGGAGCAGGGGGGTTGG + Intergenic
921815291 1:219556768-219556790 GTGAGAGGTAGGAAGGAGATCGG + Intergenic
922057446 1:222054977-222054999 GAAAGAGGGAGGCAGGGAGTAGG + Intergenic
922355548 1:224771889-224771911 GTGAGAGGAAGGCAGGAGAGAGG + Intergenic
922570310 1:226630838-226630860 AAAAGAGGGAGGGAGGAGGAAGG + Intergenic
922643452 1:227260474-227260496 GTTGTAGGGAGGAAGGAGGTTGG - Intronic
922722656 1:227906560-227906582 GGAGGAGGGAGGGAGGAGGAGGG - Intergenic
922784463 1:228276188-228276210 GGAAGAGAGAGGAGGGAGGTGGG + Intronic
922885142 1:229014158-229014180 GGAAGAGGGAGGAAGAAGGTAGG + Intergenic
923369496 1:233295904-233295926 GAGAGAGGGAGGGAGGAGGAAGG - Intergenic
923421242 1:233817433-233817455 GAAAGAGGAACGCAGGAAGTTGG + Intergenic
923784492 1:237054290-237054312 AGAAGAGGGAGGAAGGAGGAAGG - Intronic
924202619 1:241675229-241675251 GAAGGAGGGAGGAAGGAGGGAGG - Intronic
924327670 1:242911936-242911958 GCAAGAGGGAGGCAGAAGAGAGG - Intergenic
924343532 1:243055071-243055093 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
924566053 1:245199305-245199327 GGAGGAGGGAGGGAGGAGGGAGG - Intronic
924743149 1:246809434-246809456 GTGGGAGGGAGGCAGGAGAAGGG + Intergenic
1063117347 10:3080798-3080820 GTCAGAGGGAGTCAGGGAGTCGG + Intronic
1063197541 10:3757812-3757834 GGAAGAGGGAGGCAGCGGGGAGG - Intergenic
1063289980 10:4735184-4735206 GAAAGAGGAAGGAAGGAGGGAGG - Intergenic
1063606800 10:7529661-7529683 GGAGGAGGGTGGTAGGAGGTGGG + Intergenic
1064194537 10:13234375-13234397 GGAAGAGAGAGGCAGGAGGCTGG + Intergenic
1064403558 10:15040909-15040931 TTAAGAGGGAGGCAGGATTGAGG - Intronic
1064414453 10:15136413-15136435 GGGAGAGGGAGGAAGGAGGAAGG + Intronic
1064469602 10:15622262-15622284 GGAAGAAGGAAGCAGGAGGAAGG - Intronic
1064553876 10:16528998-16529020 GAGAGAGAGAGGGAGGAGGTGGG - Intergenic
1064720476 10:18224303-18224325 GAAAGAGGGAGGGAAGAGGAGGG - Intronic
1065436467 10:25708252-25708274 GAAGGAGGGAGGCAGGAGGCGGG - Intergenic
1065438569 10:25726430-25726452 GAAAGAGGGAGGAAGGAAGACGG - Intergenic
1065545109 10:26810929-26810951 GGAAGAGGGAGAGAGGAGGAAGG + Intronic
1065822229 10:29536256-29536278 GGAGGAGAGAGGCAGGAGGGCGG + Intronic
1065886688 10:30084157-30084179 GAAAGAAGGAGGAAGGAGGAAGG + Intronic
1065963554 10:30753231-30753253 GTGAGCGGGAGGTGGGAGGTGGG - Intergenic
1067049290 10:43002786-43002808 AGAAGAGGGAGGCACCAGGTTGG + Intergenic
1067264074 10:44721953-44721975 GGAAGAGGGAGGCAGAAGAATGG - Intergenic
1067286122 10:44908735-44908757 ATAAGAGGGAGGGAAGAGGAGGG - Intergenic
1067476254 10:46568756-46568778 GTAAGAGGGAATCACTAGGTAGG + Intergenic
1067618484 10:47773024-47773046 GTAAGAGGGAATCACTAGGTAGG - Intergenic
1067739988 10:48888278-48888300 GAAAGAGGGAGGGAGGGGGAGGG - Intronic
1067833194 10:49621949-49621971 GGATGAGGGAGGGAGGAGGGAGG + Intronic
1067950869 10:50737862-50737884 GGAAGGGGGAGGCAGTAGGAAGG + Intergenic
1068616507 10:59124232-59124254 GTAGGAGGGAGGCAGTGGGTTGG - Intergenic
1069108173 10:64409428-64409450 GAAAGAGGAAGGAAGGAGGGAGG + Intergenic
1069396344 10:67993412-67993434 GGGAGAGTGAGGCAGGAGGATGG + Intronic
1069718340 10:70534694-70534716 GTAAGAGGGAGGTGGGGGGGTGG - Intronic
1069913226 10:71772346-71772368 CTCGGAGGGAGGCAGGAGGGAGG - Intronic
1070234743 10:74611650-74611672 TAAAGGGGGAGGCAGGAAGTGGG - Intronic
1070326092 10:75390201-75390223 GTAACATGGAAGCAGGAGGCAGG + Intergenic
1070457453 10:76631504-76631526 GAAGGAGGGAGGCTGGTGGTGGG - Intergenic
1070512675 10:77175826-77175848 GGAAAGGGGAGGCAGGAGGCAGG + Intronic
1070622559 10:78024496-78024518 GGAAGAGGCAGGCGGGAGGCAGG + Intronic
1070713482 10:78700540-78700562 GTAAGAAGGAAGGAAGAGGTTGG + Intergenic
1070813597 10:79310527-79310549 GGGAGCGGGAGGCAGGAGGGCGG - Intronic
1070886217 10:79903076-79903098 GGAAGGGGGAGGCAGTAGGAAGG + Intergenic
1071430888 10:85605789-85605811 GCCACAGGGAGGTAGGAGGTTGG + Intronic
1071476775 10:86032189-86032211 GTGAGAGGGAGGGAGGTGGGGGG + Intronic
1071815879 10:89232441-89232463 GTCAGAGAGAGGCAAGAGGAAGG + Intronic
1071854244 10:89607267-89607289 GGAATAGGGAGGCCTGAGGTAGG + Intronic
1071978798 10:90982751-90982773 GTATGAGGGAGGCGTGAGGAAGG + Intergenic
1071978809 10:90982808-90982830 GTATGAGGGAGGCGTGAGGAAGG + Intergenic
1072047316 10:91669944-91669966 GGGAGAGGGAGGGAGGAAGTCGG + Intergenic
1072222309 10:93336810-93336832 GTAGGAGGGAGGAAGAAGGGAGG + Intronic
1072497835 10:95980160-95980182 AGAAGAGGGAGGGAGGAGGAAGG + Intronic
1072551970 10:96485965-96485987 GAAAGAGAGAAGCAGGGGGTGGG + Intronic
1072594258 10:96856451-96856473 GGAAGGGGGAGGGGGGAGGTAGG - Intronic
1073053069 10:100681622-100681644 GCAAGAGGCAGCCAGGAGGATGG + Intergenic
1073096111 10:100980736-100980758 GGAAGAGGGAGTGGGGAGGTTGG + Intronic
1073577633 10:104639611-104639633 GAAAGGAGGAGGCAGGAGGGAGG - Intergenic
1073797222 10:107001488-107001510 GTAATAGGAAGGAAGGAAGTAGG + Intronic
1074106829 10:110395036-110395058 GTAGGATGGAGTCTGGAGGTGGG - Intergenic
1074123468 10:110510236-110510258 GCAGGAGGGAGGCTGGGGGTTGG - Exonic
1074377993 10:112953943-112953965 GTAACAGGGAGGAAGGACGAAGG - Intronic
1074542290 10:114374833-114374855 GGCAGAGGGAGGGAGGGGGTGGG + Intronic
1074571267 10:114626554-114626576 TGAAGAGGAAGGGAGGAGGTCGG - Intronic
1075412772 10:122241217-122241239 GTAAGATGGATGAGGGAGGTTGG + Intronic
1075428602 10:122362462-122362484 GGAAGAGGGAGTCTGGAGGTGGG - Intergenic
1075470714 10:122687385-122687407 GCAAGAGAGAGGCAGGGGGTGGG + Intergenic
1075555335 10:123426891-123426913 GTGGGAGGGAGGCAGGAAATTGG + Intergenic
1076563229 10:131381130-131381152 GTGAGATGGAGGCTGGAGGGAGG + Intergenic
1076626074 10:131822807-131822829 GTGAGAGTGGGGCAGCAGGTGGG + Intergenic
1076629877 10:131846116-131846138 CCAAGACGGAGGGAGGAGGTTGG - Intergenic
1076800811 10:132827206-132827228 GTCAGGGGAAGGCAGGAGGGCGG + Intronic
1077268568 11:1664605-1664627 GGAAGGGGGAGGGAGGAGGGAGG + Intergenic
1077307160 11:1873571-1873593 GGAAGAGGGAGGAAGAAGGGAGG + Intronic
1077343144 11:2034948-2034970 GCTGGAGGGAGGCAGGAGCTGGG - Intergenic
1077714715 11:4569417-4569439 GCAGGAGGGCGGCAGGAGGAGGG + Intergenic
1077800067 11:5528200-5528222 GCCAGATGGAGGCAGGAGATGGG - Intronic
1077803447 11:5565599-5565621 GTAAGAGAAAAGAAGGAGGTTGG + Intronic
1077890400 11:6414129-6414151 GTATAAAGGAGGCGGGAGGTGGG - Intronic
1077973622 11:7222926-7222948 GTAAGAGGGAAGCTGTATGTTGG + Intergenic
1078523979 11:12086659-12086681 GGAAGCAGGAGGCAGGAGGCTGG - Intergenic
1078727515 11:13944856-13944878 GTTAGAGGGAAGAAGGAGGGAGG + Intergenic
1079107547 11:17581196-17581218 GGGGGAGGGAGACAGGAGGTTGG + Intronic
1079437069 11:20467031-20467053 CGAAGAAGGTGGCAGGAGGTTGG + Intronic
1079443044 11:20534491-20534513 GTAATAGTGAGGGAGGAGGAGGG - Intergenic
1080016513 11:27512532-27512554 GGAAGACTGAGGCAGGAGGATGG + Intergenic
1081492725 11:43580180-43580202 GGAAGAGGGAGGGAGGAAGAGGG + Intronic
1081567757 11:44270377-44270399 AGAAGAAGGAGGGAGGAGGTGGG - Intronic
1081631128 11:44690728-44690750 GTACGAGGGAGCCTGGTGGTGGG - Intergenic
1081835341 11:46149114-46149136 GTAAGAGGGTGGCTGAAGGGTGG + Intergenic
1081972998 11:47212988-47213010 CGAAGAGGCAGGCAGGAGTTGGG - Intergenic
1082261206 11:50077310-50077332 GTCATTGGGAGGCAGGAGCTGGG + Intergenic
1082775847 11:57243913-57243935 GTAAAAGGGTGACAGGAGGTGGG - Intergenic
1082786912 11:57322383-57322405 GGAAGGGGGAGGCAGGCAGTGGG - Intronic
1083611523 11:64006720-64006742 GTAAGAGGGAGGCTGGGACTTGG - Intronic
1083669682 11:64292771-64292793 GTAAGGGGAAGGCTGGAGATAGG + Exonic
1083885073 11:65569397-65569419 GGAAGAGGGGGCCAGGAGGAAGG + Intergenic
1084126562 11:67102920-67102942 GTAAGAGAGAGGCAGAGTGTAGG - Intergenic
1084351746 11:68606294-68606316 GAAAGAAGGAGGAAGGAGGGAGG - Intronic
1084364024 11:68686007-68686029 GGAAGAGGGAGGCAGGATTTGGG - Intronic
1084452258 11:69246160-69246182 GGAAGAGGGAGGCAGTAGCCTGG - Intergenic
1084753038 11:71216468-71216490 GTTAGAGGGATTCAGGAGGAGGG + Intronic
1085278284 11:75314023-75314045 GTGGGAGGGAGGCTGGAGGCTGG - Intronic
1086393667 11:86391940-86391962 GTAAGAGGGAGGATGGAGGGAGG + Intronic
1086778858 11:90877022-90877044 GTAAGACAAAGGTAGGAGGTTGG + Intergenic
1087786225 11:102357251-102357273 GGAAGAGGGAGTAAGGAGGGAGG - Intronic
1088472724 11:110203369-110203391 GTAGTGGGGAAGCAGGAGGTTGG + Intronic
1088553326 11:111036758-111036780 GAGAGAGGGAGCAAGGAGGTTGG - Intergenic
1088693430 11:112346624-112346646 ACAAGAGCGAGGCATGAGGTGGG - Intergenic
1088947198 11:114526046-114526068 GGAAGAGGGAGGCAGAAGAGTGG + Intronic
1089051393 11:115548989-115549011 GTAAGAGGGAGGAAGTAAGAGGG + Intergenic
1089280123 11:117368386-117368408 ATGAGAGGCAGGCAGGAGCTGGG + Intronic
1089462586 11:118661753-118661775 GGCAGAGGGAGGCAGCAGGGTGG - Intronic
1089978272 11:122751508-122751530 GTAGGCTGGAGCCAGGAGGTGGG - Intronic
1090020638 11:123125459-123125481 GGAGGAGGGAGGGAGGAGGGAGG - Intronic
1090020643 11:123125470-123125492 GAAGGAGGGAGGGAGGAGGGAGG - Intronic
1090238230 11:125164937-125164959 GAGAGAGGGAGGCAGCAGGGAGG + Intronic
1090238236 11:125164961-125164983 GAGAGAGGGAGGCAGCAGGGAGG + Intronic
1090903112 11:131049898-131049920 GAGAGAGGGAGGCAGGAGCTTGG - Intergenic
1090960878 11:131555723-131555745 GAAAGGGGAAGGCAGGAGCTGGG - Intronic
1091113130 11:132989528-132989550 GTAGGAGGCAGGAAGGAGGATGG + Intronic
1091121728 11:133063301-133063323 TTAAGAAGGAGACAGGAGGCTGG - Intronic
1202826130 11_KI270721v1_random:90137-90159 GCTGGAGGGAGGCAGGAGCTGGG - Intergenic
1091416851 12:295372-295394 GAAAGAGGGAGGAAGGAGGGAGG + Intronic
1091551211 12:1536220-1536242 GGAAGAGGGAGGCAGGTCGATGG + Intronic
1091568135 12:1662575-1662597 GTGAGGGGGAGGCGGGAAGTGGG - Intergenic
1091835582 12:3583439-3583461 ATGAGGGAGAGGCAGGAGGTAGG + Intronic
1092203758 12:6603358-6603380 GGAAGAGGGAGAGAGGAGGGAGG - Intronic
1093096085 12:14973736-14973758 GAAAGAGGCAGGAAGGAGCTGGG - Intronic
1093628118 12:21375055-21375077 GGAAGACTGAGGCAGGAGGAAGG - Intronic
1093686160 12:22056683-22056705 GTAAGGGGGAAGCATTAGGTGGG + Intronic
1094817674 12:34203924-34203946 GAAAGAGGGAGGGAGGGGGAAGG - Intergenic
1095866674 12:46979728-46979750 GAGAGAGGGAGGGAGGAGGAAGG + Intergenic
1096311415 12:50524558-50524580 GGAAGAGGGAAGCGGGAGGATGG - Intronic
1096572121 12:52529520-52529542 GGAAGAGGGAAGCAGGAGATTGG + Intergenic
1096791724 12:54049098-54049120 GGATGAGGGAGGAAGGTGGTGGG + Intronic
1096954706 12:55514630-55514652 GTAAGAGTGTGAAAGGAGGTAGG - Intergenic
1096983665 12:55743228-55743250 GGAGGAGGGAGGGAGGAGGAGGG - Intergenic
1097271303 12:57776172-57776194 GAAAGAGGGAGGCAGGACCTTGG - Intronic
1098454187 12:70653454-70653476 GTAAGAGGGAAGCAGGATTGGGG + Intronic
1098567314 12:71951129-71951151 GTAAGAAGGGGGCCTGAGGTTGG - Intronic
1099398447 12:82170996-82171018 GGAGGAGGGAGGGAGGAGGGGGG + Intergenic
1099939970 12:89175126-89175148 GAAAGAGGGAGGCAGATGGTAGG - Intergenic
1100250413 12:92815976-92815998 GTGAGAGGAAGGCAGAAGGGAGG + Intronic
1100994449 12:100288385-100288407 GTAAAAATGAGGCAGGAGGATGG - Intronic
1101255562 12:102973648-102973670 GGAAGAGAGAGGAAGGAGGGAGG - Intergenic
1101407679 12:104443072-104443094 GTAAGAGGGAAGCAGGAGGTGGG + Intergenic
1101601351 12:106212793-106212815 GTGAGATGGACGCAGAAGGTGGG - Intergenic
1101619787 12:106374326-106374348 TTACCAGGGAGGCTGGAGGTGGG - Intronic
1101941747 12:109104432-109104454 GAAAGAGGGAGGTAGCAGATAGG - Intronic
1101998732 12:109543540-109543562 TTAAGAAGGATGCAGGAGGCTGG + Intergenic
1102015613 12:109646013-109646035 GGGAAAGGGAGGCAGGAGGAAGG + Intergenic
1102544124 12:113642509-113642531 GAGAGAGGGAGGCAGGGGGAAGG - Intergenic
1102574867 12:113849948-113849970 GGAAGAGGGAGGAGAGAGGTTGG + Intronic
1102582859 12:113902268-113902290 ATGAGTGGGAGGCAGGAGGGAGG - Intronic
1102840377 12:116113765-116113787 GTAAGAGGGAGAGGGGAGGGAGG + Intronic
1103019462 12:117522323-117522345 TGAACAGGGAGGCAGGAGGGTGG + Intronic
1103620785 12:122185986-122186008 GTCAGAGGAAGGATGGAGGTTGG + Intronic
1103956774 12:124581877-124581899 GAAAGAGGGAGGGAGGAAGGAGG + Intergenic
1104191093 12:126482480-126482502 GAAGGAGGGAGGGAGGAAGTGGG - Intergenic
1104280554 12:127372665-127372687 GAAAGAGGGAGGCAGGCTGAAGG + Intergenic
1104427242 12:128687880-128687902 CTTAGAGGTAGGCAGTAGGTTGG - Intronic
1104502594 12:129300948-129300970 ATAAGAGGGAGACAGGAGTGGGG - Intronic
1104900822 12:132188793-132188815 GTTAGAGTCAGGCTGGAGGTGGG + Intergenic
1104950473 12:132437624-132437646 GAGAGAGGGAGGGAGGAGGAAGG + Intergenic
1104971502 12:132532837-132532859 GGGACAGGGAGGCTGGAGGTGGG + Intronic
1105023722 12:132835011-132835033 GTAAGAGGGAAGCAAGAGGCCGG - Intronic
1105283041 13:18980679-18980701 GAGAGAGGGAGGGAGGAGGGAGG + Intergenic
1105446586 13:20462229-20462251 GGGAGAAGGAGGCAGGAGGATGG + Intronic
1105504172 13:20996243-20996265 GTAAGTTAGAGGCAGGAGATTGG - Intronic
1105576851 13:21661818-21661840 GGAAGAGGTAGGCAGGAAGAAGG + Intergenic
1106032738 13:26017520-26017542 GCCAGAGGGAGGCAGGAGGCTGG + Intronic
1106211809 13:27655832-27655854 GGAAGAAAGAGGCAGGAGGAAGG + Intronic
1106622701 13:31386311-31386333 GAAAGAGAGAGGCAGGAGAAGGG - Intergenic
1106686621 13:32067110-32067132 GTAGGAGGGTGACAGGAGGAGGG + Intronic
1107457509 13:40568376-40568398 GTAAAAGAGAGGAAGGAGGAGGG - Intronic
1107881570 13:44836804-44836826 GAGGGAGAGAGGCAGGAGGTGGG - Intergenic
1109283298 13:60382065-60382087 GCATGTGGGAGGCAGAAGGTAGG - Intergenic
1110122967 13:71906113-71906135 GTAAGAGGGAAGAAGGAATTAGG + Intergenic
1110286226 13:73753046-73753068 GTAAGAGTGTGGAAGGAGGCTGG - Intronic
1110497012 13:76180062-76180084 GTAAAAGTGAGGCAGGAGACTGG + Intergenic
1110954807 13:81540763-81540785 GAGAGAGGGAGACAGGAGGAAGG - Intergenic
1111446091 13:88347752-88347774 GAAAAAGGGAGGGAGGAGGAAGG + Intergenic
1111996790 13:95173420-95173442 AGAAGAGAAAGGCAGGAGGTAGG + Intronic
1112501356 13:99945851-99945873 GTAGGAGGGAGACAGGAGAAAGG - Intergenic
1113119292 13:106909138-106909160 CTAAGAGGTAGGAGGGAGGTAGG - Intergenic
1113325354 13:109276333-109276355 GTAAGAGGGAGGGAGGAGTATGG + Intergenic
1113554147 13:111217795-111217817 GGAAGAGGGAGGCTGGTGGGAGG + Exonic
1113595592 13:111529720-111529742 GAAACAGGGAGGGAGGAGGAGGG - Intergenic
1114418272 14:22558512-22558534 GGAAGCCGGAAGCAGGAGGTGGG - Intronic
1114748631 14:25178779-25178801 GCAAAAGGGAGGAAGGATGTTGG - Intergenic
1115426870 14:33270481-33270503 GTAAGAGAGAGGGAGAAGGAGGG + Intronic
1115518488 14:34209092-34209114 TTAAGAGGAAAGGAGGAGGTAGG + Intronic
1116023778 14:39491848-39491870 GCAAGAGGGAGGGAAGAGGAGGG - Intergenic
1116085298 14:40229602-40229624 GTGAGAGGGAGGGAGGAGAGAGG - Intergenic
1116508481 14:45714786-45714808 GTAAGAAGAAGCGAGGAGGTCGG - Intergenic
1117742038 14:58828432-58828454 GGAAGAGGATGGCAGGAGCTAGG + Intergenic
1118119700 14:62825837-62825859 GAAACAGGAAGGCAGGAGGGAGG - Intronic
1118154009 14:63220827-63220849 GTATGAGGGAGGAAGGAGTTTGG - Intronic
1118476227 14:66120011-66120033 GTAAGAGGGAGTAAGGAGTCAGG - Intergenic
1118532682 14:66724554-66724576 GATAGAGGGATGCAGGAGGTAGG + Intronic
1118854646 14:69611658-69611680 GCGGGAGGGAGGGAGGAGGTGGG - Exonic
1119181312 14:72607067-72607089 GTCAGAGGGATGGAGGAGGGAGG - Intergenic
1119197001 14:72724552-72724574 TTTAGAGGAAGGAAGGAGGTAGG + Intronic
1119443524 14:74645796-74645818 GTAAGGGGGTGGCCCGAGGTGGG - Intergenic
1119854183 14:77887020-77887042 GTGAGAGGGAGCCAGGAAGATGG - Intronic
1120590311 14:86366290-86366312 GAAAGAGGAAGGAAGGAGGAAGG + Intergenic
1120654866 14:87177477-87177499 GGAAGAGAGAGAGAGGAGGTGGG - Intergenic
1120903164 14:89593222-89593244 GGAAGAGGGAGAAAGGAGGGAGG + Intronic
1121140060 14:91533791-91533813 GTCAGTGGGAGGCTTGAGGTGGG - Intergenic
1121274396 14:92657794-92657816 GGAAGAGGGAGGCAGCAGCAAGG + Intronic
1121346844 14:93142405-93142427 GAAAGACTGAGGCAGGAGGATGG + Intergenic
1121511228 14:94514755-94514777 GCCAGAGGTAGGCAGGTGGTGGG + Intronic
1121519991 14:94579501-94579523 GCAAGAAAGAGGCAGGAGATTGG - Intronic
1121777139 14:96598333-96598355 GGAGGAGGGAGGGAGGAGGAGGG - Intergenic
1121777145 14:96598347-96598369 GGAAGACGGAGGGAGGAGGAGGG - Intergenic
1121888057 14:97562627-97562649 GAAAGAGGGAGGAAGGAAGGAGG + Intergenic
1121888063 14:97562649-97562671 GAAAGAGGGAGGAAGGAAGGAGG + Intergenic
1122029555 14:98902328-98902350 ATAAGAGGGAGTCAGGCAGTTGG - Intergenic
1122102810 14:99426925-99426947 GTGTGGGGGAGGCAGAAGGTGGG - Intronic
1122147750 14:99703333-99703355 GGAGGAGGGAGACAGGAGGAGGG - Intronic
1122227888 14:100290415-100290437 TTTACAGGGAGGCAGGAGGCGGG - Intergenic
1122325684 14:100879661-100879683 GGAGGAGGGAGGGAGTAGGTGGG - Intergenic
1122696075 14:103552897-103552919 GTGAGATGGAGACAGAAGGTGGG + Intergenic
1122856876 14:104564157-104564179 TGAAGAGGGATGCAGGAGGCAGG - Intronic
1202839780 14_GL000009v2_random:111094-111116 GTTGGTGGGAGGCAGGAGGGAGG - Intergenic
1202909158 14_GL000194v1_random:101234-101256 GTTGGTGGGAGGCAGGAGGGAGG - Intergenic
1124368440 15:29090102-29090124 GTGAGTGGGAGGCAGGATGCTGG + Intronic
1124881077 15:33643284-33643306 GTGAGAGGCAGGCAGGTGGCTGG - Intronic
1125095110 15:35841655-35841677 TTAAGAGAAAGGCAGGAAGTTGG + Intergenic
1125732436 15:41900672-41900694 GTGCGAGGGGGGCACGAGGTGGG + Exonic
1126343018 15:47664648-47664670 GGAAAAGGGAGGCAGAAAGTAGG - Intronic
1127259645 15:57318867-57318889 GGAAGAGGGAGGAAGGAGGAAGG + Intergenic
1127271972 15:57409626-57409648 GAAAGGGGGAGGGAGAAGGTAGG + Intronic
1127324722 15:57883949-57883971 GGGAGTGGGAGGCAGGAGGCGGG - Intergenic
1127504208 15:59582396-59582418 GTAGGAGGGGGTAAGGAGGTGGG - Intergenic
1127507394 15:59610404-59610426 GGAGGAGGGAGGGAGGAGGGAGG - Intronic
1127507399 15:59610415-59610437 GAAGGAGGGAGGGAGGAGGGAGG - Intronic
1127750369 15:62033779-62033801 GAAAAAGGGAGACAGGAGGAGGG + Intronic
1128128276 15:65208892-65208914 GAAAGAGCAAGGCAGGAGGCAGG + Intronic
1128780065 15:70353427-70353449 GAAAGACGGAGGAAGGAGGGAGG + Intergenic
1129105159 15:73302033-73302055 CTAAAAGGCAGGCAGGATGTGGG - Intronic
1129190189 15:73932912-73932934 GAAACAGGGAGGCAGGAGGAGGG - Intronic
1129600399 15:76995180-76995202 GGAAGAGGCAGGCTGGAGCTCGG - Exonic
1129604453 15:77018033-77018055 GGGAGATGGAGGCAGGAGGGAGG + Intronic
1129658103 15:77537913-77537935 CTAAGAGGGAGGGAGGAGCCAGG + Intergenic
1130062447 15:80579615-80579637 GTCCCAGGGAGGCAGGAGGAGGG + Intronic
1130325152 15:82873690-82873712 GTAAGAGGGCGGCACAAGGGTGG + Intronic
1130349040 15:83074304-83074326 ATAAAAGGGAGGCAGGTGCTCGG - Intergenic
1130555319 15:84918472-84918494 GTTAGAGGCAGGCAGGATGCAGG - Intronic
1130578435 15:85114206-85114228 CTAGGAGGCAGGCAGCAGGTGGG - Intronic
1130721086 15:86386224-86386246 GGAGGAGGGAGGGAGGAGGAAGG - Intronic
1131735329 15:95325897-95325919 GCAAGACAGGGGCAGGAGGTTGG + Intergenic
1131770733 15:95734744-95734766 GGAAGAGGGAGACAGGAAGGAGG + Intergenic
1131793349 15:95988429-95988451 GGAAGAGGGAGGGGGGAGGAAGG + Intergenic
1132053770 15:98633947-98633969 GGAGGAGGGAGGGAGGAGGAGGG - Intergenic
1132878477 16:2150565-2150587 GTTAGAGGGAGGATGGAGGAAGG + Intronic
1133026350 16:2990516-2990538 GCAGGAGGGAGTCAGGAGGAGGG - Intergenic
1133422113 16:5654761-5654783 GGAAGAAGGAGGAAGGAGGAAGG - Intergenic
1133447912 16:5877984-5878006 GCAAGTGTGAGGTAGGAGGTGGG - Intergenic
1134135259 16:11673081-11673103 GGGAGAGGGAGGTGGGAGGTGGG + Intronic
1134351822 16:13444782-13444804 GGAAGAGGGAGGGAAGAGGGAGG - Intergenic
1134590533 16:15449365-15449387 ACAAGAGGGAGGAAGGAGGGAGG + Intronic
1134894727 16:17874630-17874652 GTGTGAGGGAGACAGGAGGGGGG - Intergenic
1135060418 16:19266835-19266857 GCAGGAGGGAGGCAAGAGGAAGG - Intronic
1135110928 16:19690325-19690347 GAAGGAGGGAGGGAGGAGGAAGG + Intronic
1135258132 16:20958016-20958038 GTAGGATAGAGGCAGGAGGCGGG + Intronic
1135417530 16:22280135-22280157 GCAACAGGGTGGCAGGAGGAGGG - Intronic
1135976363 16:27110932-27110954 GGAGGAGAGAGGCAGGAGATAGG - Intergenic
1136138866 16:28276061-28276083 GGAGGAGGGAGGCTGGAGGAGGG + Intergenic
1136268009 16:29132117-29132139 GTCAGAGGGAGGAGGGAGGGAGG + Intergenic
1136287834 16:29254604-29254626 GGAAGGGGGAGGAAGGAGGATGG + Intergenic
1136383252 16:29906842-29906864 GCAAGAGGAAGGCAGGGGGAGGG + Exonic
1136406805 16:30053034-30053056 GGAAGAGGGAGGCGCGAGGCGGG + Intergenic
1136410812 16:30076045-30076067 GAAAGAGGGAGGCAGGGAGCCGG + Exonic
1136480108 16:30535850-30535872 GCTAGAGGGAGACAGGCGGTCGG - Intronic
1136556031 16:31008397-31008419 GTAAGGGGGAGGCAGGGGAGGGG - Intronic
1136934583 16:34448142-34448164 GTGAGAGGGTGGGGGGAGGTAGG + Intergenic
1136969989 16:34963672-34963694 GTGAGAGGGTGGGGGGAGGTAGG - Intergenic
1137553441 16:49455707-49455729 GGGAGAGGGAGGCAGGAAGAGGG + Intergenic
1137575187 16:49594900-49594922 GCAAGAGGGCGGAAGGAGGCTGG + Intronic
1138055592 16:53829746-53829768 GTAATAGGGAGGTAATAGGTGGG + Intronic
1138055797 16:53831889-53831911 GTAAATGGGTGGCAGAAGGTAGG + Intronic
1138128416 16:54457407-54457429 GAGAGAGGGAGGGAGGAGGAGGG - Intergenic
1138225737 16:55292756-55292778 CCAAGAGGGAGAGAGGAGGTAGG + Intergenic
1139393284 16:66619979-66620001 GAAAGAGGGGGGCAGGTGGTTGG - Intronic
1139545775 16:67648868-67648890 GTATGTGGGAGGTGGGAGGTGGG - Intronic
1139835002 16:69831049-69831071 GGCAGAGGGAGGCAGGAAGAAGG + Intronic
1140045953 16:71440881-71440903 GTGACAGTGAGGGAGGAGGTGGG - Intergenic
1140121929 16:72091361-72091383 GTCAGAGGGAGGGAGGAGAGTGG - Intronic
1140209288 16:72958381-72958403 GGCAGAGGGCGGCAGGAGGCTGG - Exonic
1140257513 16:73349751-73349773 AAAAGAGGGAGGAAGGAGGGAGG - Intergenic
1140335626 16:74102557-74102579 GGAAAAGGGAGGCAGGAGAGTGG + Intergenic
1140357654 16:74319912-74319934 GTAAGAAGGAGCCAGAAGGCCGG - Intergenic
1140541521 16:75760419-75760441 GAGGGAGGGAGGGAGGAGGTAGG - Intronic
1140743728 16:77963288-77963310 CAAAGAGGGAGGCAGGAGGAGGG + Intronic
1141150502 16:81561545-81561567 GGAAGAGGGTGGCAGGGGCTGGG + Intronic
1141505677 16:84476663-84476685 ACAAGAGGGAGGCAGGTGGGTGG + Exonic
1141508267 16:84495378-84495400 TTAAGAGGAAGGGAGCAGGTAGG - Intronic
1141571587 16:84937282-84937304 GGAGGAGGGCGGGAGGAGGTGGG - Intergenic
1141749195 16:85946917-85946939 GGAAGGGGGAGGCAGGAGCAGGG - Intergenic
1141789540 16:86225203-86225225 GAAAGAGAGAGGCAGGTAGTGGG - Intergenic
1141831065 16:86510265-86510287 GAAAGAGGGAGGAGAGAGGTGGG + Intergenic
1142000422 16:87661199-87661221 GTAAGAGGGAGGCAGGAGGTCGG - Intronic
1142093485 16:88227307-88227329 GGAAGGGGGAGGAAGGAGGATGG + Intergenic
1142251369 16:88993559-88993581 GGAAGAGGGAGGGAGGAAGGAGG - Intergenic
1142251403 16:88993649-88993671 GGAAGAGGGAGGGAGGAGGGAGG - Intergenic
1142251446 16:88993772-88993794 GGAAGAGGGAGGAGGGAGGAGGG - Intergenic
1142409124 16:89907504-89907526 GGAGGAGGGAGGTGGGAGGTGGG - Intronic
1142409145 16:89907567-89907589 GGAGGAGGGAGGCAGAAGCTGGG - Intronic
1142409161 16:89907616-89907638 GGATGAGGGAGGCGGGAGCTGGG - Intronic
1142409264 16:89907908-89907930 GGAGGAGGGAGGCAGGAGCTGGG - Intronic
1142409379 16:89908251-89908273 GGAAGAGGGAGCTGGGAGGTGGG - Intronic
1142409476 16:89908587-89908609 GGAGGAGGGAGGCGGGAGCTGGG - Intronic
1142409531 16:89908734-89908756 GCAGGTGGGAGGCAGGAGCTGGG - Intronic
1142409539 16:89908762-89908784 GGAGGAGGGAGGCGGGAGCTGGG - Intronic
1142788319 17:2243059-2243081 GGAGGTGGGAGGCAGGAGATGGG + Intronic
1142958196 17:3535290-3535312 GGAAGAGGGAAGCAGGAAGGAGG - Intronic
1143104571 17:4522567-4522589 GAAAGAGGGAGGGAGGAAGGAGG - Intronic
1143351635 17:6292182-6292204 GTAGGAGGAAGGCAGAGGGTTGG + Intergenic
1143361132 17:6372200-6372222 GCAGGAGGGAGGCGGGAGGATGG + Intergenic
1143371770 17:6444823-6444845 GCCAGAGAGAGGAAGGAGGTTGG + Intronic
1143634948 17:8159277-8159299 GTAGGAGAGATGCTGGAGGTGGG - Exonic
1144033440 17:11342346-11342368 GGCAGAGGGAGGCAGGAGAGAGG + Intronic
1144171538 17:12664130-12664152 AGAAGAGGGAAGCAGAAGGTGGG + Intergenic
1144624268 17:16836796-16836818 GAAGGAGGGAGGAAGGAGGCAGG - Intergenic
1144882161 17:18435923-18435945 GAAGGAGGGAGGAAGGAGGCAGG + Intergenic
1144945452 17:18967352-18967374 GAAGGAGGGAGGCAGGAGGGAGG + Intronic
1145150072 17:20508463-20508485 GAAGGAGGGAGGAAGGAGGCAGG - Intergenic
1145764117 17:27446215-27446237 GAGAGAGGGAGGGAGGAGGGAGG + Intergenic
1145868518 17:28255874-28255896 GTGGGAGGGAGGCAGGAGGAAGG + Intergenic
1146162006 17:30565106-30565128 GAAGGAGGGAGGAAGGAGGCAGG - Intergenic
1146320547 17:31843262-31843284 GGAATAGGAAGGCAGGAGGCAGG - Intergenic
1146720145 17:35118456-35118478 GAAGGAGAGAGGCAGGAGGATGG - Intronic
1146934613 17:36805053-36805075 CTAAGAAGGTGGCAGGAGGAGGG - Intergenic
1146955813 17:36935932-36935954 GGAAGAGGGAAGGAGGAGGGGGG - Intergenic
1147054737 17:37825539-37825561 GAAAGAGGGAGACAGGAAATGGG + Intergenic
1147141791 17:38464574-38464596 GGGAGAGGGAGGAAGGAGGGGGG + Intronic
1147578405 17:41615518-41615540 GAAGGAGGGAGGAAGGAGGCAGG - Intronic
1147923575 17:43933227-43933249 GTGGGAGGGAGGCAGGAAGAAGG - Intergenic
1147977338 17:44255340-44255362 GCAGGAGGAAGGCAGGAGGTGGG - Intronic
1148114132 17:45164998-45165020 TCAGGAGGGAGGCAGCAGGTAGG + Intronic
1148132489 17:45270508-45270530 GTGAGAGGGGCGCAGGAGGGTGG + Exonic
1148190079 17:45672221-45672243 GGAAGTGGGAGGCAAGAGGAGGG + Intergenic
1148255203 17:46125044-46125066 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1148255208 17:46125055-46125077 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1148358947 17:46996085-46996107 GTAAGTGGGAAGCAGGGAGTGGG - Intronic
1148540604 17:48477475-48477497 GTGGGAGGGAGGGAGGAGGGAGG - Intergenic
1148728103 17:49810892-49810914 GGAAGACTGAGGCAGGAGGATGG + Intronic
1149017082 17:51920361-51920383 ATGAAAGGGAGGGAGGAGGTTGG + Intronic
1149393257 17:56213528-56213550 AACAGAGGGAGGCAGGAGGAAGG + Intronic
1149444314 17:56701785-56701807 GAGAAAGGGAGGAAGGAGGTAGG + Intergenic
1149862232 17:60128497-60128519 GTGAGAGGAAGGCAGGGGGAGGG - Intergenic
1150330214 17:64288191-64288213 GGAAGAGGGAGGAGGGAGGGAGG + Intergenic
1150488264 17:65558991-65559013 GTGAGAGGAAGGCAAGAGCTGGG + Intronic
1150699730 17:67436481-67436503 GCAAGAGGTAAGCAGAAGGTAGG + Intronic
1150859452 17:68786338-68786360 GTGAGAGGAAGGAAGGAGGGAGG - Intergenic
1151276546 17:73038769-73038791 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1151560726 17:74868145-74868167 GATGGAGAGAGGCAGGAGGTGGG - Intronic
1151964391 17:77423790-77423812 GTAAGAAAGTGGCAGGAGGTGGG + Intronic
1152005119 17:77675807-77675829 GGAGGAGGGAGGAAGGAGGGAGG - Intergenic
1152016913 17:77756855-77756877 GGAATGGGGAGGGAGGAGGTGGG - Intergenic
1152418094 17:80175903-80175925 GAGAGAGGGAAGCAGGAGGCAGG + Intronic
1152588518 17:81199763-81199785 GAAAGAGGCAGCCAGGAGGAAGG - Exonic
1153272263 18:3334249-3334271 GACAGAGGGATGGAGGAGGTAGG - Intergenic
1153417200 18:4859738-4859760 GTCAGATGGAGGCAGGAAGAAGG + Intergenic
1153435203 18:5061631-5061653 ATAAGAGGGAGACAGGAGGGAGG - Intergenic
1153495964 18:5700023-5700045 GTATGAGAGAGGCAGGTGGCTGG - Intergenic
1153498089 18:5720945-5720967 GGAAGACTGAGGCAGGAGGGTGG - Intergenic
1154055828 18:11013244-11013266 GAAAGAAGGAGGCAGGAGAGAGG + Intronic
1154226552 18:12510205-12510227 GGAGGAGGGAGGCAGGAGGTAGG + Intronic
1154492371 18:14931994-14932016 GCAGGAGGGAGGTGGGAGGTGGG - Intergenic
1154935087 18:21046555-21046577 GTAGGAGGAAGGCAGCAGCTAGG + Intronic
1155034941 18:22018262-22018284 GGAAGAGGCAGGAAGGAGGCAGG - Intergenic
1155362465 18:25016405-25016427 GTAGGCAGGAGGCTGGAGGTAGG + Intergenic
1155813786 18:30276336-30276358 GAAGGAGGGAGGAAGGAGGGAGG + Intergenic
1156016997 18:32557952-32557974 GGAAGAAGGATGGAGGAGGTGGG - Intergenic
1156895428 18:42240481-42240503 ATGGGAGGGAGGCAGGAGGCAGG - Intergenic
1157121257 18:44913378-44913400 ATAAGAGGTAGCCAGGAGGACGG - Intronic
1157391489 18:47307136-47307158 CTAAGAGGGAGGGAGCAGGGTGG + Intergenic
1157454028 18:47810304-47810326 GTAAGTGGTAGGGAAGAGGTGGG - Exonic
1157843518 18:50981086-50981108 GTAGGAGGGTGGCGGGGGGTGGG - Intronic
1158058721 18:53312979-53313001 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1158103789 18:53861394-53861416 GAAGGAGGGAGGAAGGAGGGAGG + Intergenic
1158374610 18:56848732-56848754 GAAAGAGCGAGCAAGGAGGTGGG - Intronic
1158521657 18:58176242-58176264 GAATGAGGGAGGCAGGAGAGAGG - Intronic
1159214642 18:65375123-65375145 GAAGGAGGGAGGAAGGAGGGAGG - Intergenic
1159449675 18:68584283-68584305 GCAAGAGGGAGGCTGAGGGTTGG - Intergenic
1159457380 18:68677889-68677911 GTGAGAAGGAGGCAGGATATGGG + Intronic
1159718736 18:71858805-71858827 GTCACAGGGACGCAGAAGGTGGG + Intergenic
1159777852 18:72624268-72624290 TTAAGAGGGAGGGTGGAGATGGG - Intronic
1159866176 18:73707902-73707924 GGAAGAGAGAGGGAGGGGGTAGG + Intergenic
1160046574 18:75392192-75392214 GAAAGAGGGAGGAAGGCGTTCGG + Intergenic
1160241157 18:77124164-77124186 ATGAGGGGGAGGCAGGAGGCTGG - Intronic
1160329334 18:77977681-77977703 GTTAGAGTGAGGCAGAAGCTGGG - Intergenic
1160356168 18:78229745-78229767 GAAGGAGGGAGGGAGGAGGAAGG - Intergenic
1160381639 18:78461578-78461600 GGAAGAGGGAGGCAGCGGGAGGG - Intergenic
1160529284 18:79554098-79554120 GCAAGAGGGAGGCATGACCTCGG - Intergenic
1160856403 19:1219916-1219938 CAAAGATGGAGGCGGGAGGTTGG - Intronic
1160971956 19:1773252-1773274 GAGGGAGGGAGGCAGGAGGGGGG - Intronic
1161013461 19:1971059-1971081 GGTAAAGTGAGGCAGGAGGTGGG - Intronic
1161046101 19:2135877-2135899 GTAACTGGGAGGGAGGAGGGTGG - Intronic
1161139745 19:2640121-2640143 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1161284549 19:3462625-3462647 GTCACAGGGTTGCAGGAGGTGGG + Intronic
1161403944 19:4081623-4081645 GCAAGAAGGAGGCGGGAGGGAGG - Intergenic
1161530522 19:4786455-4786477 GTTGGAAGGAGGGAGGAGGTTGG + Intergenic
1161530536 19:4786501-4786523 GTTGGAGGGAGAGAGGAGGTTGG + Intergenic
1161530552 19:4786547-4786569 GTTGGAGGGAGGGAGTAGGTTGG + Intergenic
1161530559 19:4786565-4786587 GTTGGAGGGAGGGAGGAGGTTGG + Intergenic
1161530566 19:4786583-4786605 GTTGGAGGGAGGGAGGAGGTTGG + Intergenic
1161530583 19:4786629-4786651 GTTGGAGGGAGGGAGGAGGTTGG + Intergenic
1161530589 19:4786647-4786669 GTTGGAGGGAGGGACGAGGTTGG + Intergenic
1161530596 19:4786665-4786687 GTTGGAGGGAGGGAGGAGGTTGG + Intergenic
1161530607 19:4786697-4786719 GTTGGAGGGAGGGAGGAGATTGG + Intergenic
1161530622 19:4786743-4786765 CTTGGAGGGAGGGAGGAGGTTGG + Intergenic
1161753952 19:6117759-6117781 GAAGGAGGGAGGGAGGAGGAAGG + Intronic
1161761945 19:6180101-6180123 ATAAGAGGGAAGCAGGAGAGGGG - Intronic
1161781531 19:6296326-6296348 GGGAGAGGGAGGCAGGAGAATGG - Intergenic
1161989031 19:7673489-7673511 GAAGGAGGGAGGGAGGAGGGAGG - Intergenic
1162129992 19:8520586-8520608 GAGGGAGGGAGGGAGGAGGTGGG - Intergenic
1162327279 19:10006663-10006685 GTTAGAGAGAGGGAGGAGGTGGG - Intronic
1162472085 19:10878331-10878353 GAATGAGGCAGGCAGGAGTTGGG + Intronic
1162531093 19:11236882-11236904 GTGGGAGGGAGGCACCAGGTGGG + Intronic
1162869030 19:13571785-13571807 GGAAGGGTGAGGCAGGAGGATGG + Intronic
1162946830 19:14049083-14049105 GTAAGAGTGGGGCTGGAGGATGG + Intronic
1162990673 19:14300040-14300062 GTAGGAGTGAGGTAGGAGGCTGG + Intergenic
1163446190 19:17347753-17347775 GAAAGAGGGAGGGATGAGGCTGG + Intergenic
1163544637 19:17933668-17933690 GCACGCGGGATGCAGGAGGTAGG - Intronic
1164731028 19:30504514-30504536 GTCAGAGGGGGGCAGGAGGAGGG - Intronic
1164914304 19:32038079-32038101 GCAGGAGGGGGGCAGGAGGAGGG + Intergenic
1165103107 19:33450766-33450788 GTAAAACTGAGGCAGGAGGCGGG + Intronic
1165715871 19:38045614-38045636 ATAACAGGCAGGAAGGAGGTGGG + Intronic
1165793349 19:38505264-38505286 GTGAGGGGGAGGCAGCAGTTGGG - Intronic
1165838459 19:38773147-38773169 GAAGGAGGGAGGCAGAAGGTGGG + Intronic
1165841100 19:38789550-38789572 GAAGGAGGGAGGCAGAAGGTGGG - Intronic
1166108656 19:40610031-40610053 GTCAAAGGGAGGCTGGAGCTGGG - Intronic
1166273165 19:41730969-41730991 GAAAGAGGCAGGCATGAGCTAGG - Intronic
1166318657 19:42003195-42003217 GGCAGAGGAATGCAGGAGGTGGG - Intronic
1166692744 19:44833519-44833541 GAGAGAGGGAGGGAGGAGGAAGG + Intergenic
1166705419 19:44905643-44905665 GGCAGAGGGAGGAAGGAGGTGGG - Intergenic
1167045524 19:47046728-47046750 GTAAGGGGGATTGAGGAGGTAGG - Intronic
1167127139 19:47557541-47557563 GAGAGAGGGAGGGAGGAGGCTGG + Intergenic
1167240796 19:48342091-48342113 GAAGGGGGGAGGAAGGAGGTGGG + Intronic
1167512072 19:49900683-49900705 GTGAGTGGGAGACAGGAGGGAGG + Intronic
1167654193 19:50752802-50752824 GTCTCAGGGAGCCAGGAGGTAGG + Intergenic
1167713160 19:51124674-51124696 TTGAGAGGGAGGCAGGAGGTGGG + Intergenic
1167715759 19:51142069-51142091 TTGAGAGGGAGGCAGGAGGTGGG + Intergenic
1167744535 19:51342806-51342828 GTGACAGGGAGGGAGGAGGTGGG - Intergenic
1167845404 19:52159751-52159773 GGAAGAGGCAGGGAGGAGGAAGG + Intronic
1168146057 19:54420647-54420669 GTGGGAGGGAGGCTGGAGGATGG - Intronic
1168357853 19:55713602-55713624 GTAAGAGGGAGAGGGGAGGAGGG - Intronic
1168435044 19:56309983-56310005 CTAAGCTGGAGGGAGGAGGTGGG + Intronic
924991707 2:318064-318086 GTAAGAGGGTGGAAGGACATTGG + Intergenic
925009121 2:468542-468564 GTCTCGGGGAGGCAGGAGGTGGG - Intergenic
925079645 2:1053922-1053944 GCAAGAGGGGGGCGGGAGGGAGG - Intronic
925927620 2:8681750-8681772 GGAGGAGGGAGGCGGGAGGAGGG - Intronic
926176283 2:10595119-10595141 GCAAGAGGGAGGGAGGGGGAGGG + Intronic
926266885 2:11331012-11331034 GAAAGAAGGAGGGAGGAGGAGGG + Intronic
926690852 2:15732420-15732442 GTGAGAGGCAGGCAGCTGGTAGG - Intronic
926701997 2:15810054-15810076 GAAAGAGGAGGGCAGGAGGCAGG - Intergenic
927096230 2:19749623-19749645 GGAAGCAGGAGGCAGGAGGCAGG - Intergenic
927287491 2:21371637-21371659 GAAGGAGGGAGGGAGGAGGGAGG + Intergenic
927987193 2:27420329-27420351 GTAAGAGGAAGGCAGAGGGAGGG - Intergenic
928172919 2:29014824-29014846 GTAGGAGGGAGGAAGGAAGGAGG + Intronic
928913697 2:36448889-36448911 GTCAGAGAGAGGCAGGAGCCAGG - Intronic
929082953 2:38139137-38139159 GTTAGAGACAGGAAGGAGGTTGG + Intergenic
929086451 2:38172337-38172359 GAAGGAAGGAGGCAGGAGGAAGG - Intergenic
929333871 2:40716291-40716313 TTAAGAGGTAGTCAGGATGTAGG + Intergenic
929444517 2:41991988-41992010 GGAAGAGGAAGGCAGGAGAGGGG + Intergenic
929454490 2:42056180-42056202 GGTAGAAGGAGGCAGGAGGGTGG + Intronic
929899610 2:45989277-45989299 GTCAGAGAGAGGCAGGAGCGAGG - Intronic
929912831 2:46106340-46106362 GTAAATGGGTGGCAGGTGGTGGG - Intronic
930088140 2:47512778-47512800 GGAAGAGGGAGGAAAGAGGAAGG + Intronic
930089196 2:47519679-47519701 GGCAGAGGAAGGCAGGAGGGAGG - Exonic
930283922 2:49404316-49404338 GTAAGTGGGAGGCAGGTTGGAGG + Intergenic
930560566 2:52955215-52955237 GTAAAAGTGAGGCATGAGGCTGG + Intergenic
930640530 2:53850100-53850122 GAAAGAAGGAGGGAGTAGGTAGG + Intergenic
931116306 2:59170450-59170472 GGAAGAGGGTGTGAGGAGGTGGG - Intergenic
931703883 2:64931031-64931053 GTCAGAGGGCTCCAGGAGGTTGG + Intergenic
932420773 2:71600006-71600028 GCAGGAGGGAGGCAGGCGGCAGG + Intronic
932599892 2:73116539-73116561 GGAGGAGGGAGGGAGGAGGTAGG - Intronic
932713123 2:74082323-74082345 GGAAGAGGAAGGCAGGAGGATGG + Intronic
932968744 2:76512390-76512412 GGGAGAGGGAAGCAGGAGGAAGG - Intergenic
933055118 2:77653036-77653058 GTAAGAAAGAAGCAGGAGGTAGG - Intergenic
933679117 2:85083315-85083337 GAAGGAGGGAGGGAGGAGGGAGG + Intergenic
933891704 2:86778083-86778105 GTATGAGGGAGGGAGTAGGGAGG + Intergenic
934054541 2:88240829-88240851 GGAAGAGGGAAGGAGGAGCTTGG - Intergenic
934089359 2:88537882-88537904 GCAAGTGGAAGGCAGGAGGTGGG - Intergenic
934763464 2:96868580-96868602 CCAAGAGGGAGGCAGGAAGTGGG + Intronic
935079179 2:99775551-99775573 GTCAGAGGGCAGGAGGAGGTAGG + Intronic
935131519 2:100264649-100264671 GAAAGATGGAGGCAGGAGGGAGG - Intergenic
935199618 2:100845003-100845025 CTTAGAGGCAGGCAGGGGGTGGG + Intronic
935633569 2:105232352-105232374 GTATTAGTGGGGCAGGAGGTGGG - Intergenic
936067006 2:109339932-109339954 GTGAGGAGGAGGCAGGTGGTTGG + Intronic
936122431 2:109758301-109758323 GGAAGACTGAGGCAGGAGGATGG + Intergenic
936222262 2:110613173-110613195 GGAAGACTGAGGCAGGAGGATGG - Intergenic
936528026 2:113255244-113255266 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
936528043 2:113255279-113255301 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
937231047 2:120398429-120398451 CTATGTGGGAGGCAGGAGGCAGG + Intergenic
937339628 2:121082773-121082795 ACAAGAGGGAGGCTGGAGGCAGG + Intergenic
938365967 2:130734577-130734599 GAAAGAAGGAGGCAGGAGGGTGG + Intergenic
938620931 2:133052386-133052408 TTAAGGTGGAGGCAGGAGATGGG + Intronic
938741834 2:134239545-134239567 GGAAGAGGGAGTCAGAGGGTAGG - Intronic
938841940 2:135172798-135172820 GTGAGTTGGAGGCAGGAGGCTGG - Intronic
938941363 2:136172283-136172305 GAAAGAGGGAGACAGGAAATGGG + Intergenic
939159355 2:138567976-138567998 GGAAGTGGGAGGTAGGAAGTGGG + Intronic
939239436 2:139538901-139538923 GTGTGAGGGAGGCAGAAGGCAGG - Intergenic
939421031 2:141969418-141969440 ACAAGAGGGTGGCGGGAGGTGGG - Intronic
939707402 2:145471962-145471984 GTGAGTGGGAGGAGGGAGGTTGG - Intergenic
939931853 2:148245144-148245166 GGAAGACCGAGGCAGGAGGATGG + Intronic
940279972 2:151978825-151978847 GTATGAGGGCAGCAGGAGGCTGG - Intronic
940857944 2:158744337-158744359 GAGAGAGGAAGGCAGAAGGTGGG + Intergenic
941067245 2:160917352-160917374 GAAAGAGGGAGGCAGAGGGTTGG + Intergenic
941499022 2:166245674-166245696 TTTAGATGAAGGCAGGAGGTGGG + Intronic
941631027 2:167884368-167884390 GGAAGAGGGAAGAAGGAGGAGGG - Intergenic
941778370 2:169417336-169417358 TTCAGAGGGAGGGAGGAGGAGGG + Intergenic
942447690 2:176088868-176088890 GTGAAAGGGACGCAGGAGGGTGG - Intergenic
942452193 2:176115258-176115280 GTAAGGGAGGGGAAGGAGGTGGG - Intronic
943868094 2:192955313-192955335 GAATGAGGGAGGAAGGAGATTGG - Intergenic
943965522 2:194327708-194327730 ACCAGAGGGAGGCAGAAGGTAGG + Intergenic
944187880 2:196969492-196969514 GTATGTGGCAGGAAGGAGGTAGG + Intronic
944318297 2:198307009-198307031 GTGAGAGGGCTGCAGGGGGTGGG - Intronic
944419952 2:199519089-199519111 GTAAGAGGCAGCCCAGAGGTAGG - Intergenic
944551153 2:200845643-200845665 GTAAGGCCGAGGCAGGAGGATGG + Intergenic
945049281 2:205807809-205807831 GTGGGAGGGCGGCAGGAGGGAGG - Intergenic
945160471 2:206885164-206885186 GTAGGAATGAGGCAGGAGGAAGG - Intergenic
945384596 2:209181832-209181854 GAAAGAGGGAGCCAAGAAGTGGG + Intergenic
946010940 2:216563025-216563047 GTGTGAGGGAGGTGGGAGGTGGG + Intronic
946063867 2:216969254-216969276 GAAGGAGGGAGGGAGGAGGAAGG - Intergenic
946338868 2:219055993-219056015 GGAAGTGGGGGGCAGGAGCTGGG - Intronic
947353028 2:229266246-229266268 GGGAGAAGGAGGGAGGAGGTTGG - Intronic
947428342 2:230004058-230004080 GGCAGAGGGTGGCAGGAGGCAGG - Intronic
947504750 2:230699194-230699216 GAGAGAGGGAGGGAGGAGGGAGG + Intergenic
947523268 2:230864413-230864435 GCAAGACGGAGGCAGCAGTTTGG + Intergenic
948049960 2:234972620-234972642 GGAAGACTGAGGCAGGAGGATGG + Intronic
948106873 2:235421546-235421568 GTTAGGGGGAGGAAGGAGGGAGG - Intergenic
948187252 2:236031213-236031235 CTAAGAAGGAGGGAGGAGGAAGG + Intronic
948434926 2:237946565-237946587 GAGAGAGGGAGGGAGGAGGAAGG + Intergenic
948465967 2:238151749-238151771 GAAGGAGGGAGGCAGGGCGTGGG + Exonic
948577660 2:238965027-238965049 GCAGGGGGGAGGCAGGAGGGAGG - Intergenic
948577676 2:238965076-238965098 GTAAGGAGGAGGGAGGAGGGAGG - Intergenic
948577721 2:238965226-238965248 GTAAGGAGGAGGGAGGAGGAAGG - Intergenic
948585770 2:239018830-239018852 GTGGGAAGGAGGCAGCAGGTGGG - Intergenic
948669096 2:239555194-239555216 GGAAGGCTGAGGCAGGAGGTTGG - Intergenic
948883484 2:240871803-240871825 GGATGAGGGAGGCTGGAGGAGGG - Intronic
948886255 2:240886515-240886537 CTAAGAACGAGGTAGGAGGTGGG + Intronic
1168841476 20:912612-912634 GAGAGAGGGAGGCAGAAGGAGGG + Intronic
1168848331 20:960014-960036 GTGAGAGGGAGACAAGAGGAGGG + Exonic
1168902551 20:1377397-1377419 CTAAGAGGTAGACAGGAGGGTGG + Intronic
1169066436 20:2696728-2696750 GTAAGAGGGAGTCCTGAGGCTGG - Intronic
1169190914 20:3658814-3658836 GAAGGAGGCAGGCAGGAGGCGGG + Intergenic
1169210869 20:3765710-3765732 AGAAGGGGGAGGCAGGAGGAGGG - Intronic
1169584876 20:7070079-7070101 GTAAAAGGGAGGCAACAGATTGG + Intergenic
1169742162 20:8906771-8906793 GGGAGAGGAAGGCAGGAGGTAGG + Intronic
1170134760 20:13060591-13060613 GTGGGAGGGTGGGAGGAGGTAGG - Intronic
1170332326 20:15227359-15227381 GAAAGAGGGAGGGAGAAGGGAGG - Intronic
1170783639 20:19449076-19449098 GGGAGAGGGAGGCAGGAAATGGG + Intronic
1171370907 20:24661445-24661467 GAAAGAGGGAGGAAGTAGGAAGG + Intronic
1171370917 20:24661474-24661496 GGAAGAGGGAGGAAGAAGGGAGG + Intronic
1171370927 20:24661500-24661522 GGAAGAGGGAGGAAGGAGGGAGG + Intronic
1171370960 20:24661608-24661630 GGAGGAGGGAGGGAGGAGGGAGG + Intronic
1172134820 20:32679812-32679834 CTAGGATGGAGGCAGGAGGTGGG + Intergenic
1172181334 20:33005505-33005527 GGAAGAGGGAGGCAGGGAGATGG + Intergenic
1172525073 20:35595844-35595866 CTATGAGGGAGGCTGGGGGTGGG - Intergenic
1172649705 20:36494023-36494045 GCAGCAGGGAGGCAGGAGGCAGG - Intronic
1172841058 20:37903052-37903074 GGAGGAGGGAGGCGGGAGGAGGG + Intergenic
1172858737 20:38030229-38030251 GGAGGAGGGAGGAAGGAGGAAGG + Intronic
1172906279 20:38372176-38372198 GAAAGAGGGAAGGAGGAGCTGGG + Intronic
1172933440 20:38601853-38601875 GTGAGAGGGAGGAGTGAGGTAGG - Intergenic
1173016123 20:39227435-39227457 TGAAGAGGGAGGCAGGGAGTGGG - Intergenic
1173565976 20:44039008-44039030 CCAAGAGGGAAGCAGGAGGCTGG + Intronic
1173581458 20:44149604-44149626 GGAAGAGGGCAGAAGGAGGTGGG - Intronic
1173835073 20:46119437-46119459 GGAACAGGGAGGCAGGGGGAGGG + Intronic
1173846572 20:46192404-46192426 GAAAGAGAGAGGCAGGAAGAGGG - Intronic
1173928451 20:46798508-46798530 CTGAGAGAGAGGCAGGAGGCAGG - Intergenic
1173957807 20:47047966-47047988 CTAAGAGGGAGGCAGGGGCGCGG - Intronic
1174367828 20:50067096-50067118 GTAAGAGGGGGAAAGGAGCTGGG - Intergenic
1174726291 20:52865737-52865759 GAAAAAGGGAGGCAGGGAGTGGG + Intergenic
1174904168 20:54532548-54532570 GTGTGTGGGAGGCTGGAGGTGGG + Intronic
1175273902 20:57754469-57754491 GAAGGAGGGAGGGAGGAGGGAGG - Intergenic
1175321022 20:58088481-58088503 GAAAGAGGGAAGCAGGATCTCGG - Intergenic
1175385425 20:58591900-58591922 ATGTGAGGGAGGCAGGAGGTCGG + Intergenic
1175522957 20:59614147-59614169 GGATGAGGGAGGCAGAAGCTGGG - Intronic
1175570174 20:60012245-60012267 GCAAGAGGGTGGGAGCAGGTGGG + Intronic
1175661793 20:60819822-60819844 ACAGGAGGGAGGCAGGAGGCAGG - Intergenic
1175891483 20:62317930-62317952 GTATGAGGGAAGGAGGAGGATGG + Intronic
1175978584 20:62725833-62725855 GTGAGGGGGAGGGAGGAGGAGGG + Intronic
1176034181 20:63028437-63028459 GTGGGAGGGAGGCAGGAAGGAGG - Intergenic
1176057177 20:63154934-63154956 GGAGGAGGGAGGAAGGAGGGAGG - Intergenic
1176384034 21:6128047-6128069 GAGGGAGGGAGGGAGGAGGTAGG + Intergenic
1176424118 21:6537258-6537280 GCAGGAGGGAAGCAGGAGGGAGG + Intergenic
1176628512 21:9115947-9115969 GTTGGTGGGAGGCAGGAGGGAGG - Intergenic
1176897284 21:14395986-14396008 GGAAGAGGGAGAAAGGAGGGAGG - Intergenic
1177362497 21:20091485-20091507 GTAAGTGGGAGAGAGAAGGTGGG - Intergenic
1177733344 21:25057907-25057929 GGAAGAGGGAGGGAGCTGGTCGG + Intergenic
1177736203 21:25092916-25092938 GGAAGAGGGAGGGAAGAGGGTGG - Intergenic
1177957384 21:27616286-27616308 GGAAGGGGGAGGCAGGAGAATGG - Intergenic
1178115516 21:29412565-29412587 GTGAGAGGCTGGCAGGAGGAAGG - Intronic
1178379634 21:32096883-32096905 GTCAGTGGGGGGCAGGGGGTAGG - Intergenic
1178913505 21:36694483-36694505 GGGAGAGGGAGGCAGGTCGTAGG + Intergenic
1179030049 21:37712538-37712560 GGAGGAGGGAGGGAGGAGGAGGG - Intronic
1179236747 21:39554194-39554216 GAAAGAGGAAGAGAGGAGGTGGG - Intergenic
1179384112 21:40925708-40925730 GTAAGAGGGAGACAGGTGATGGG + Intergenic
1179577947 21:42319483-42319505 GTCCGAGGGAGGAAGGAAGTAGG + Intergenic
1179630469 21:42674700-42674722 GTAGGAGAGAGGCTGGTGGTAGG - Intronic
1179699611 21:43145573-43145595 GCAGGAGGGAAGCAGGAGGGAGG + Intergenic
1179732352 21:43374842-43374864 GAAGGAGGGAGACAGGAGGATGG - Intergenic
1179739440 21:43410191-43410213 GAGGGAGGGAGGGAGGAGGTAGG - Intergenic
1180378632 22:12117499-12117521 GTTGGTGGGAGGCAGGAGGGAGG + Intergenic
1180572554 22:16741616-16741638 GTTAGTGGGGGGCAGGAGGAGGG - Intergenic
1180642340 22:17309420-17309442 GTAGGAGGCAGGCACGAGGTAGG - Intergenic
1180706934 22:17815960-17815982 GCAAAAGGGAGGCAGGAAGCAGG + Intronic
1180934972 22:19619503-19619525 GGAAGTGGGAGGCAGCTGGTGGG - Intergenic
1181332060 22:22100483-22100505 GTCAGAGGAAGGGAGGAGGGTGG - Intergenic
1181379067 22:22485116-22485138 GAAAAAGAGAGGAAGGAGGTAGG + Exonic
1181428849 22:22864453-22864475 GAGAGAGGGAGGGAGGAGGAAGG + Intronic
1182420954 22:30248338-30248360 GTGAGAGGCAGGAAGGAGGAAGG - Intergenic
1182696454 22:32202256-32202278 GAAAGAGGAAGGCAGGAGGAGGG - Intronic
1182897615 22:33872031-33872053 GAACTAGGGTGGCAGGAGGTGGG + Intronic
1183057349 22:35315124-35315146 GGAGGAGGGAGGCAGGAGGAGGG + Intronic
1183096596 22:35555664-35555686 GTAAATGGGAGGCGGGAGGAAGG + Intergenic
1183197489 22:36363453-36363475 GACAGAGGGAGGCAGGAAGGAGG + Intronic
1183395631 22:37569282-37569304 GTAAGAGGGAGGCTGGGGCGGGG - Exonic
1183481832 22:38069433-38069455 GGACAAAGGAGGCAGGAGGTGGG - Intronic
1183603917 22:38857685-38857707 GGCAAAGGGAGGCAGGAGATGGG - Intergenic
1183722752 22:39571979-39572001 GGTAGTGGGAGGCAGGAGGAGGG + Intronic
1183872201 22:40748489-40748511 GTAAGAGGGGGCCTGAAGGTGGG - Intergenic
1184366700 22:44056335-44056357 TTAAGAGGCAGGGAGCAGGTGGG + Intronic
1184790726 22:46698138-46698160 GAAAGAGTGAGGCAGGATGCGGG + Intronic
1185101837 22:48844749-48844771 GGAAGAGAGAGGCTGGAGGGAGG - Intronic
1185279092 22:49962327-49962349 GAGAGAGGGAGGGAGGAGGGAGG - Intronic
1185292416 22:50033736-50033758 TTAAAAGGGAGCCAGGAGGATGG + Intronic
1185422930 22:50745003-50745025 GTAAAGGTGAGGCTGGAGGTGGG - Exonic
949406438 3:3719437-3719459 GTGAGAGCGAGGCAGAAGATGGG + Intronic
949760953 3:7470101-7470123 GTAAGAGAGTGGTAGGAGGAGGG - Intronic
949994073 3:9602540-9602562 GCAAGAGGGAGGCTGGGGGTGGG - Intergenic
950125349 3:10506810-10506832 CTCAGAGGTGGGCAGGAGGTGGG - Intronic
950182847 3:10927273-10927295 GGCAGAGGGAGGCAGGGGCTGGG + Intronic
950281078 3:11708487-11708509 GCAAAAGGGAGGCCTGAGGTGGG + Intronic
950437297 3:12987648-12987670 GAAAAAGGCAGGCAGGAGGGAGG + Intronic
951605660 3:24432021-24432043 ATAATAGGGAGGCAGGAGATAGG + Intronic
951617314 3:24562094-24562116 CTAAGACTGAGGCAGGAGGATGG + Intergenic
951837529 3:26999804-26999826 GAAATAGGAAGGAAGGAGGTGGG - Intergenic
951959478 3:28300710-28300732 GAGAGAGGGAGGAAGGAGGGAGG - Intronic
952107580 3:30087722-30087744 GGAGGAGGGAGGGAGGAGGACGG - Intergenic
953637867 3:44677906-44677928 GTCAGAGGGAGGCATGAGAATGG - Intergenic
954590020 3:51775325-51775347 TGCAGAGGGTGGCAGGAGGTGGG - Intergenic
954785199 3:53087476-53087498 GGAAGAGACAGGCAGGAGCTGGG - Intronic
954815090 3:53273896-53273918 GTAAGGGGGAGGCAAGAGAGAGG + Intergenic
955058279 3:55474793-55474815 GGAGGGGGGAGGTAGGAGGTGGG + Intronic
955148199 3:56341212-56341234 GTAAGATGGAGGAAGGTGGAGGG - Intronic
955572093 3:60319014-60319036 AGAAGAGGAAGGCAGGAGGAAGG - Intronic
955603619 3:60674899-60674921 ATAAGAGAGATGCATGAGGTAGG - Intronic
955781991 3:62494641-62494663 GTAAGAGCCAGGTATGAGGTTGG - Intronic
956243302 3:67154033-67154055 GTGAGATGGATGCAGAAGGTGGG + Intergenic
956263660 3:67373702-67373724 GAAAGAGGGAGGAAGGAGAGAGG - Intronic
956326162 3:68055300-68055322 GTATGCGGGGGGCAAGAGGTGGG + Intronic
956750834 3:72342615-72342637 CTAAGAAGGAGGCAGGAGACTGG - Intergenic
957094724 3:75768163-75768185 GTTGGTGGAAGGCAGGAGGTAGG - Intronic
957097137 3:75786777-75786799 GTAAGAGGCACGCAGGAGACTGG + Intergenic
957105131 3:75877270-75877292 GTTAGTGGGGGGCAGGAGGAGGG + Intergenic
957294641 3:78321656-78321678 GTAAGAGCGAGTAAGGAGGAAGG + Intergenic
957578172 3:82035720-82035742 GTTCCAGGGATGCAGGAGGTAGG + Intergenic
958437955 3:94121329-94121351 GAAAGAGGGAGGCAGAGAGTTGG - Intronic
958582262 3:96042376-96042398 GTGAGGCTGAGGCAGGAGGTTGG - Intergenic
958715695 3:97777359-97777381 GTAGGAGGGTGGAAGGGGGTGGG - Intronic
959817946 3:110698086-110698108 CTAAGAGGGAGGCGGGGGGAGGG - Intergenic
959866180 3:111273039-111273061 GGAGGTGGGAGGCAGGAGGCGGG - Intronic
960027039 3:113021130-113021152 TTAAGAGGGAGGCAGGCAGGAGG - Intergenic
960290374 3:115877271-115877293 GTGGGAGGGAGGAAGGAGGCAGG - Intronic
960510082 3:118539594-118539616 GCAATGGGGAGGCAGGAGATGGG + Intergenic
960963109 3:123085678-123085700 GAAAGGGGAAGGCAGGAGGGAGG - Intronic
961081634 3:124033284-124033306 GAGCGAGGGAGGGAGGAGGTAGG + Intergenic
961161532 3:124730686-124730708 GGAAGAGGGTGACAGGAGTTGGG + Intronic
961334254 3:126160777-126160799 GTAGAAGGGAAGCAGTAGGTGGG - Intronic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961541709 3:127604694-127604716 GTCAGAGGGAGGCAGCAGAGCGG + Exonic
961554097 3:127685775-127685797 GAAAGAGGGAGGAAGGAGGCAGG - Intergenic
961669212 3:128516870-128516892 ATAAGAGGGAGGCAGAAGTGGGG + Intergenic
961821833 3:129579150-129579172 GAAAGAAGGAGGGAGGAGGGAGG + Intronic
962209358 3:133464082-133464104 GTAGGTAGGAGGCAGGAGGTGGG - Intronic
962592948 3:136909198-136909220 GTAAGAGAGAGGCAGAAGTTAGG + Intronic
964118652 3:153161172-153161194 GGAAGTGGGAGGCAGAGGGTGGG + Intergenic
964218538 3:154317740-154317762 AAAAGAGGGAAGCAGGAGCTAGG + Intronic
964535010 3:157711261-157711283 GTGAGAGAGAGACAGGAGCTGGG - Intergenic
964879283 3:161405811-161405833 GCAAGAGGGAGGCAGCATGCAGG + Intergenic
966087360 3:176084750-176084772 GGAGGAGGGAGGAAGGAGGAGGG + Intergenic
966422302 3:179745572-179745594 GTAAGAGAGGGGCTGGGGGTGGG - Intronic
967136601 3:186517709-186517731 CAAAGAGGGATGGAGGAGGTTGG + Intergenic
967138556 3:186533062-186533084 GTAAGTGGAGGGGAGGAGGTTGG - Intergenic
967164136 3:186765579-186765601 ATAAGAGGGAGGCAGGACATTGG + Intergenic
967894695 3:194386413-194386435 GACAGAAGGAGGCAGGAGGGGGG - Intergenic
968432445 4:566804-566826 GGAGGTGGGAGGCAGGTGGTGGG - Intergenic
969075487 4:4574845-4574867 GGAAGGGGGAGGAAGGAGGAGGG - Intergenic
969143550 4:5100742-5100764 GGAGGAGGGAGGGAGGAGGGAGG - Intronic
969143555 4:5100753-5100775 GAAGGAGGGAGGGAGGAGGGAGG - Intronic
969159060 4:5239361-5239383 ATTGGAGGCAGGCAGGAGGTCGG + Intronic
969198866 4:5585733-5585755 CTAAGTGGGGGGCAGGGGGTGGG - Intronic
969301649 4:6300582-6300604 GTCAGAGGGAGGCGTGAGATGGG + Intronic
969313357 4:6367048-6367070 GTGAGAGAGAGGGAGGAGGCTGG + Intronic
969483542 4:7459335-7459357 GTACTAGGGAGACATGAGGTGGG + Intronic
969512835 4:7629466-7629488 GGAGGTGGGAGTCAGGAGGTGGG + Intronic
969600145 4:8171376-8171398 GGGAGAGGGAGCCAGGAGGGAGG - Intergenic
969680292 4:8639622-8639644 GTAAGGGGGAGGGGAGAGGTGGG + Intergenic
970444167 4:16110173-16110195 GGAAGAAGGAGGAAGGAGGAAGG + Intergenic
970804734 4:20017634-20017656 GACAGAGAAAGGCAGGAGGTGGG - Intergenic
971160235 4:24126545-24126567 GAGAGAGGGAGGCAGGAACTAGG + Intergenic
971394492 4:26215800-26215822 GTGAGAGGGATGCGGGAGGCGGG - Intronic
971405571 4:26319291-26319313 GGAAGGGGAAGCCAGGAGGTTGG - Intronic
971540466 4:27810038-27810060 GTAAGAGAGAGGCATGGGTTTGG + Intergenic
971985297 4:33814465-33814487 AAATGAGGGAGGCAAGAGGTAGG + Intergenic
972625140 4:40789814-40789836 GCAAGAGAAAGGCAGCAGGTGGG + Intronic
972708658 4:41571498-41571520 TGAAGAGAGAAGCAGGAGGTTGG + Intronic
972910685 4:43812808-43812830 GTAGGATGGAGGGTGGAGGTTGG + Intergenic
973159255 4:46994526-46994548 GAGAGAGAGAGGCAGAAGGTGGG + Intronic
973286073 4:48418107-48418129 GAAAGAAGGAGGAAGGAGGGAGG - Intronic
973803077 4:54497768-54497790 GTTAAAGGAAGGCAAGAGGTTGG + Intergenic
973823775 4:54685268-54685290 GGAAACTGGAGGCAGGAGGTGGG - Intronic
973890878 4:55366154-55366176 GGAAAAGGGAGGCAGGTGGAAGG - Intronic
973986452 4:56359329-56359351 GGAGGCGGGAGGCAGGAGGCAGG - Intronic
974030032 4:56768534-56768556 CTAAGTAGGAGGGAGGAGGTCGG - Intergenic
974435892 4:61856922-61856944 GAAAGAGGGAGGAGGGAGGGCGG - Intronic
975046288 4:69808082-69808104 GTAACAGTGATGCAAGAGGTGGG - Intergenic
976247021 4:83014446-83014468 GGAAGACTGAGGCAGGAGGATGG + Intergenic
976383009 4:84421637-84421659 GACAGAAGGAGGGAGGAGGTGGG - Intergenic
977283836 4:95076695-95076717 ATAAGAGGGAGGTAGTTGGTAGG + Intronic
977294075 4:95192397-95192419 GTGAGAAGGGGGGAGGAGGTGGG - Intronic
977432434 4:96947340-96947362 GTGAGAGGATGGGAGGAGGTTGG + Intergenic
977865819 4:102026244-102026266 GTAAGAGTGAGCCTGGAGCTGGG - Intronic
977870184 4:102081699-102081721 GAAAGAGGGAGGGAGGAGGGAGG + Intergenic
978140930 4:105316835-105316857 GTAACAGGGAGGGAGGAGCCTGG - Intergenic
978234572 4:106443258-106443280 GAAGGAGGGAGGGAGGAGGGAGG - Intergenic
978400906 4:108329659-108329681 GGAGGAGGGAGGGAGGAGGGAGG + Intergenic
978481956 4:109202939-109202961 GAAAGAGAGAAGCAGGAGGAAGG + Intronic
979490413 4:121320330-121320352 ATCAGAGGGAGGAAGGAGTTAGG + Intergenic
980174763 4:129331046-129331068 GTAAGATAGTGGCAAGAGGTAGG + Intergenic
980893574 4:138839727-138839749 GTGGGAGGGCGGCAGGAGGGGGG + Intergenic
981148471 4:141353400-141353422 GAAGCAGGGAGGCAGGAGGGAGG + Intergenic
981914408 4:150017879-150017901 GTCAGAGGAAGGCAGGACCTTGG + Intergenic
981916075 4:150034634-150034656 GAAACAGGGAGGCAGGAGATGGG - Intergenic
982277790 4:153654581-153654603 GTAAGGGGGAGGCGGGGGGATGG - Intergenic
982314094 4:154013703-154013725 ATGAGAGAGAGACAGGAGGTTGG - Intergenic
982790326 4:159584854-159584876 TTATGAGGGAAGCAGGAAGTGGG + Intergenic
982977637 4:162086303-162086325 GGAAGAGGGAGAAAGGAGGGGGG - Intronic
983029581 4:162783141-162783163 GGATGAGGGAGGGAGGAGGAGGG - Intergenic
983633111 4:169870117-169870139 GGAAGAGGGAGGAAGGCGGCAGG + Intergenic
984077680 4:175204409-175204431 GGAAGCTGGAGGCAGGAGGATGG - Intergenic
985141020 4:186840642-186840664 AGAAGAGGGAGGGAGGAGGAGGG - Intergenic
985208324 4:187565306-187565328 GGAAGAGGAAGGGAGGAGGGAGG - Intergenic
1202760250 4_GL000008v2_random:102966-102988 GTTGGTGGGAGGCAGGAGGGAGG + Intergenic
985671593 5:1209571-1209593 GGAAGAGAGAGGGAGGAGGGAGG - Intronic
985803583 5:2021995-2022017 GTTAGGGGGAGGCAAGGGGTAGG - Intergenic
985824560 5:2182583-2182605 GTAAGAGGATGGGAGGAGGAAGG - Intergenic
985856365 5:2430375-2430397 ACTAGAGTGAGGCAGGAGGTGGG + Intergenic
985863354 5:2492300-2492322 GTGAGAGACAGGCTGGAGGTGGG - Intergenic
986029368 5:3880957-3880979 GTCTGAGGAAGGCAGGAGGGAGG - Intergenic
986283733 5:6344970-6344992 GAAGGAGGGAGACAGGAGGAGGG + Intergenic
986328857 5:6702936-6702958 GGGAGAGGGAGGGAGGAGGAGGG - Intergenic
986517684 5:8581066-8581088 TTAAGAGGGAGGCAGGTGGGAGG - Intergenic
986875122 5:12098043-12098065 GTCAGAGGAAGACAGGGGGTTGG - Intergenic
986899544 5:12414408-12414430 GGAAGAGGAAGGCAGAAGTTTGG + Intergenic
986936886 5:12900135-12900157 GAGAGAGGGAGGGAGGAAGTGGG + Intergenic
987180517 5:15362971-15362993 AAAAGATGGAGGCAGGAGTTGGG - Intergenic
987588091 5:19885056-19885078 GGAAAAAGGAAGCAGGAGGTGGG - Intronic
988848174 5:35151300-35151322 GTAAGATGGAAGCAGCAGCTTGG + Intronic
989069646 5:37497230-37497252 GGAAAAGGGAGGGAGGAGGGAGG - Intronic
989108546 5:37886031-37886053 GGAGGCGGGAGGCAGGTGGTGGG + Intergenic
989170588 5:38467886-38467908 GGAAGAGGCAGGGAGGAGGTGGG - Intergenic
989587326 5:43085616-43085638 GTAGGAGGGAGGTAGGAGAATGG + Intronic
990802422 5:59619870-59619892 GTTAGAGGGAGGAAGGCAGTAGG + Intronic
991814107 5:70497870-70497892 GTGGGAGGGAGGCATGAGGCTGG + Intergenic
991817240 5:70519162-70519184 GTGGGAGGGAGGCATGAGGCTGG + Intergenic
992120639 5:73588437-73588459 GTAAGAGAGAGTTGGGAGGTGGG + Intergenic
993034916 5:82746187-82746209 GTAAGAGAGGGGAAGGTGGTTGG + Intergenic
993382131 5:87220086-87220108 GTAGAAGGCAGGCATGAGGTGGG - Intergenic
994076683 5:95659739-95659761 GCAAGAAGGAGGCAGGAGGCAGG - Intronic
994945073 5:106377217-106377239 GAAAGAGAGAGGAAGGAGGGAGG - Intergenic
995023358 5:107391663-107391685 GTAAGTTGGAGTCAGGAAGTTGG + Intronic
996705471 5:126493303-126493325 GTAAGGGAGAGGCAGGAGGGCGG - Exonic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
996897106 5:128498023-128498045 ATCAGAGGGAGGCAGGAGAGAGG + Intronic
996930545 5:128881157-128881179 GTAATGGTGAGGTAGGAGGTGGG - Intronic
997342460 5:133155452-133155474 GGAAGAGGGAGGCAGAGGGTAGG + Intergenic
998138258 5:139685717-139685739 GGAAGTGGGAGGTGGGAGGTGGG - Intergenic
998139214 5:139690460-139690482 GGCAGAGGGAGGCAGGAAGGAGG - Intergenic
998181435 5:139948313-139948335 GTATGTGGGAGCCAAGAGGTTGG - Intronic
998225433 5:140322960-140322982 GGAGGAGGGAGGCGGGTGGTGGG + Intergenic
998477201 5:142432005-142432027 GTGAGCAGGAGGCGGGAGGTAGG + Intergenic
998604064 5:143615592-143615614 GGAAGAAGGAGGAAGGAGGAAGG - Intergenic
999149010 5:149414580-149414602 GGAAGTGGGAGGTAGGAGGTAGG - Intergenic
999261145 5:150239634-150239656 GCAGGAGGGAGGCAGGAGCAAGG + Intronic
999273768 5:150314611-150314633 GGCAAAGGCAGGCAGGAGGTGGG - Intronic
999326155 5:150644971-150644993 GGAGGAGGGAAGAAGGAGGTTGG + Intronic
999625561 5:153517017-153517039 ATGAGAGAGAGGCAGGAGGTGGG + Intronic
999872332 5:155765423-155765445 GAAAGAGGGAGGAGGGAGGGTGG + Intergenic
1000308650 5:160019874-160019896 AGAAAAGGGAGGCAGGAGGCAGG - Intronic
1001514341 5:172344979-172345001 GAAAGAAGGAGGAAGGAGGGAGG + Intronic
1001569924 5:172723881-172723903 GAAAGAGGGAGGAAGGGGGAAGG + Intergenic
1001570084 5:172725159-172725181 GGAAGAGGGCTGCAGGTGGTGGG + Intergenic
1001770247 5:174290495-174290517 ATAAGAGGGAGAGAGGAGGGAGG - Intergenic
1001824325 5:174733288-174733310 GGAGCAGGGCGGCAGGAGGTAGG + Intergenic
1001824399 5:174733744-174733766 GTGAGAGGGTGGCTGGGGGTGGG - Intergenic
1002100551 5:176855544-176855566 GTGAGAGGGAGGCAGAAACTGGG + Intronic
1002279623 5:178122787-178122809 GAGGGAGGGAGACAGGAGGTGGG - Exonic
1002307726 5:178293652-178293674 GTAAGAATGAGGGAGGAGGGAGG + Intronic
1003162925 6:3651330-3651352 GGAAAAGGGAGGGAGGAGGGAGG + Intergenic
1003516054 6:6819564-6819586 GGAGGAGGGAGTAAGGAGGTGGG + Intergenic
1003829914 6:9996848-9996870 GTCAGAGGAAGGAAGGAGTTAGG + Intronic
1004075935 6:12344235-12344257 CTGGGAGGTAGGCAGGAGGTTGG + Intergenic
1004221194 6:13747852-13747874 GAGAGAGGGAGGGTGGAGGTGGG + Intergenic
1005353936 6:24963994-24964016 GGAAGGCGGAGGCAGGAGGAGGG - Intronic
1005826066 6:29632584-29632606 GGCCGAGGGAGGCAGGAGGAGGG - Intronic
1006047201 6:31308140-31308162 GACAGAGGGAGGAAGGAGCTGGG - Intronic
1006085040 6:31589457-31589479 GTAAGAGAGTGGGAGGAGGGAGG - Intronic
1006187709 6:32190178-32190200 GTGAGAGAGAGGGAGGAGGGAGG + Exonic
1006193524 6:32223506-32223528 ATGAGAGGGAAGCAGGAGATGGG - Intronic
1006727700 6:36211571-36211593 GTCACAGGCAGGCAGGGGGTTGG + Intronic
1006939777 6:37744078-37744100 GTACGAGGGAAGAAGGAGGAGGG - Intergenic
1006980739 6:38145874-38145896 GGAATAGAGAGGCAGGGGGTAGG - Intronic
1007238782 6:40410334-40410356 GCACGGGGGAGGCAGGAGGAAGG + Intronic
1007292743 6:40799582-40799604 GGAAGAGGGAGGGAGGAAGGAGG - Intergenic
1007301784 6:40873185-40873207 TTAAGTGGGAGGAAGGAGGCTGG - Intergenic
1007337973 6:41168462-41168484 GATGGAGGGAGGCAGGAGGATGG - Intergenic
1007397646 6:41586724-41586746 GAAGGAGGGAGGCGGGAGGAGGG + Intronic
1007415226 6:41687714-41687736 GGAAGAGGGAGGCAGGGAGAGGG + Intronic
1008410422 6:51172342-51172364 GTAAGTGGAAGCCAGAAGGTAGG + Intergenic
1008502088 6:52193456-52193478 GTAACAGGGAGGGAGGATGGTGG - Intergenic
1008863252 6:56176958-56176980 GAATGAGGGAGGCAGGAGCAGGG + Intronic
1008920932 6:56843692-56843714 GAGAGAGGGAGGGAGGAGGGTGG + Intronic
1009465482 6:63963119-63963141 GGAAGGGGGAGGCGGGAGGGAGG + Intronic
1009850082 6:69185210-69185232 GTTAGATGGAGGCAGGATATAGG - Intronic
1010870357 6:81029569-81029591 GGAAGAGGGAGGAAGGAAGGAGG + Intergenic
1011476671 6:87755440-87755462 ATAAGAGGGAGGCAGAGGGCGGG - Intergenic
1011507490 6:88062651-88062673 GTAAGAGTGGTGCATGAGGTGGG + Intronic
1012466906 6:99525668-99525690 GTTAGAGGTTGTCAGGAGGTGGG - Intergenic
1012676775 6:102124264-102124286 ATAAAAGGGAAGCAGGAGGCGGG + Intergenic
1012943153 6:105438513-105438535 GTGAGAGGGAGGAGGGAGGAAGG - Intergenic
1013192210 6:107813121-107813143 GGAAGGTGGAGGCAGGAGGATGG + Intronic
1013235516 6:108194975-108194997 GTCTGTGGGAGGCTGGAGGTAGG + Intergenic
1013267156 6:108511144-108511166 GGAGGAGGGAGGTAGGAGGAAGG + Intronic
1013591850 6:111625558-111625580 GTAAGAGGCAGGCGGGCGGCAGG - Intergenic
1013653958 6:112225986-112226008 TACAAAGGGAGGCAGGAGGTAGG - Intronic
1014192460 6:118513247-118513269 GTAAGAAGGTGGCAGGGGGTGGG + Intronic
1014213891 6:118734944-118734966 GTAAGTGGTAGGGAGGAGGGTGG + Intergenic
1014577658 6:123093049-123093071 GTAAGTGGGAGTGGGGAGGTGGG + Intergenic
1015597640 6:134881035-134881057 AAAAGAGGGAGGGAGGAGCTTGG - Intergenic
1015884702 6:137904745-137904767 GAAAGAGAGAGGAAGGAGGCTGG + Intergenic
1016047956 6:139499705-139499727 GAAACAGGGAGGTGGGAGGTGGG - Intergenic
1016139830 6:140594727-140594749 GTCACACGGATGCAGGAGGTGGG - Intergenic
1016295545 6:142569748-142569770 ATGAGAGGGAGGCAGGAAGAGGG + Intergenic
1016448472 6:144156761-144156783 GGAAGAGGGGAGGAGGAGGTGGG - Intronic
1016455442 6:144225649-144225671 GGAAGAGGAAGGAAGGAAGTGGG + Intergenic
1017342043 6:153335502-153335524 ACAAGAGGGAGGAAGGAGGAAGG - Intergenic
1017625303 6:156341663-156341685 GAAAGAGGGAGGGACGGGGTGGG - Intergenic
1018712559 6:166507139-166507161 GGAAGAGGGAGGGAAGAGGGAGG - Intronic
1018985858 6:168636854-168636876 GGAGGAGGGAGGCGGGAGGAGGG - Intronic
1018985864 6:168636868-168636890 GGAGGAGGGAGGCGGGAGGAGGG - Intronic
1019151743 6:170010986-170011008 GGAGGAGGGAGGGAGGAGGCAGG + Intergenic
1019266753 7:121493-121515 GAAAGAGGGAGGGAGGAGTAGGG + Intergenic
1019455455 7:1124547-1124569 GTAAGAGGCAGTCGGGGGGTGGG + Intronic
1019484081 7:1280506-1280528 GGAAGAAGGAGGAAGGAGGAAGG + Intergenic
1019709392 7:2511390-2511412 GCCAGAGTGAGGCAGGAGGCTGG - Intergenic
1019781391 7:2942309-2942331 GGAAGAGGGAGGAAGGAAGAGGG - Intronic
1020100535 7:5391898-5391920 CTAAGAGGCAGGCAGGTGCTAGG + Intronic
1020114247 7:5466764-5466786 GCAGGAGGGAGGCAGGAGCCCGG + Intronic
1020368813 7:7411050-7411072 GTAGGAGCCAGGCAGAAGGTTGG + Intronic
1021432711 7:20579162-20579184 GGAAGAGGGTGGCATGAGATGGG + Intergenic
1022001488 7:26230358-26230380 GTAGGAGGTGGGTAGGAGGTTGG - Intergenic
1022013649 7:26330130-26330152 GTAACAGGAATGAAGGAGGTAGG + Intronic
1022661731 7:32374066-32374088 GAAAGAGGGAGGAGGGAGGAGGG + Intergenic
1022776767 7:33534819-33534841 GGAAGAGGGAAACAGGAGTTGGG - Intronic
1022779760 7:33568354-33568376 TTAAGTGGGAGGAAGGAAGTGGG - Intronic
1022824690 7:33997050-33997072 TTAAGTGGGAGGGAGGAGGGAGG - Intronic
1022875756 7:34527641-34527663 ATAAGAGGGTGTCAGGAGGGAGG - Intergenic
1023058318 7:36307246-36307268 GGAAGAGGGAGGAGGGAGGTGGG - Intergenic
1023156368 7:37256488-37256510 GTAGGAGGGAGGGAGGATGGAGG + Intronic
1023401001 7:39793015-39793037 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1023664913 7:42513055-42513077 GTCAAAGGGAAGCAGGAGCTGGG - Intergenic
1023724782 7:43131751-43131773 GGAAGAGGGATACTGGAGGTGGG + Intronic
1023897366 7:44445120-44445142 GTAAGGGGCAGGCAGCAGGAAGG - Intronic
1023991708 7:45132595-45132617 GGAGGAGGGAGGGAGGAGGTGGG + Intergenic
1024565065 7:50673935-50673957 GAAACAGGGAGGCTGGAGGGAGG - Intronic
1024648631 7:51387762-51387784 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1024903965 7:54354693-54354715 GTAAGAGGGAAGAAGGAGGAGGG - Intergenic
1024907103 7:54398091-54398113 GAAAGAGGGAGGCAGGAGAGTGG - Intergenic
1024920054 7:54545922-54545944 GTAAGAGGGGGGAAGGGGGTGGG + Intronic
1025176387 7:56804417-56804439 GCCACCGGGAGGCAGGAGGTAGG - Intergenic
1025178590 7:56813971-56813993 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1025179028 7:56815761-56815783 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1025179484 7:56817647-56817669 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1025179933 7:56819485-56819507 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1025180408 7:56821467-56821489 GCCACCGGGAGGCAGGAGGTGGG + Intergenic
1025180851 7:56823305-56823327 GCCACCGGGAGGCAGGAGGTGGG + Exonic
1025181278 7:56825056-56825078 GCCACCGGGAGGCAGGAGGTGGG + Intronic
1025181724 7:56826894-56826916 GCCACCGGGAGGCAGGAGGTGGG + Intronic
1025690193 7:63750101-63750123 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025690640 7:63751924-63751946 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025691091 7:63753747-63753769 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025691525 7:63755523-63755545 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025691965 7:63757346-63757368 GCCACCGGGAGGCAGGAGGTGGG - Exonic
1025692414 7:63759169-63759191 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025692858 7:63760992-63761014 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025693274 7:63762671-63762693 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025693717 7:63764494-63764516 GCCACCGGGAGGCAGGAGGTGGG - Intergenic
1025695402 7:63771969-63771991 GCCACCGGGAGGCAGGAGGTAGG + Intergenic
1025977354 7:66379353-66379375 GCCAGTGGGAGGCAGAAGGTGGG + Intronic
1026045766 7:66904408-66904430 ATCAGCGGGAGGCAGGAGCTGGG - Intergenic
1026306446 7:69146333-69146355 AGAAGAGGGAGGAAGGAGGAGGG - Intergenic
1026654435 7:72244913-72244935 GTCAGAGGGAGTCAGAGGGTAGG - Intronic
1026806102 7:73430406-73430428 GTTAGAGGGAGGGAGGGGGAGGG - Intergenic
1027236119 7:76298896-76298918 GTACTAGAGAGGCAGGAGGTTGG + Intergenic
1027533537 7:79366396-79366418 GAAAGAGGGCAGGAGGAGGTGGG + Intronic
1027569552 7:79847227-79847249 GGAAGAGGGATGGAGGAGGAAGG - Intergenic
1027650192 7:80856991-80857013 ATAAGAGGGAGGAAGAAGGGAGG - Intronic
1027916774 7:84334676-84334698 GTAAAAGGGAGGATTGAGGTTGG - Intronic
1028086607 7:86644541-86644563 GTAGAAGAGAGGGAGGAGGTTGG - Exonic
1028448242 7:90949953-90949975 ATAAGAGGGAGGGAGTTGGTGGG + Intronic
1028652940 7:93170803-93170825 GTGAGATGGACGCAGAAGGTGGG - Intergenic
1028857472 7:95607914-95607936 GTAAAGGGGAGGGTGGAGGTAGG - Intergenic
1029176001 7:98664844-98664866 GAGACAGGGAGGCAGCAGGTAGG - Intergenic
1029411325 7:100413260-100413282 GAAAGAGGGAGGCAGTGGCTAGG - Intronic
1029580554 7:101434235-101434257 GAAAGAGAGAGACAGGAGGGAGG - Intronic
1030421314 7:109309967-109309989 GTCAGAGGGAGGCTGCAGGTGGG - Intergenic
1030770399 7:113468197-113468219 GAAAAAGGGAGGAAGGAGGAAGG - Intergenic
1031414518 7:121479451-121479473 GAGAGAGGGAGGGAGGAGGGGGG + Intergenic
1031950557 7:127887316-127887338 AGAAGAGGCAGGCAGGAGGGAGG - Intronic
1032019908 7:128401544-128401566 GGAAGGGAGAGGCAGGAGGAAGG + Intronic
1032285681 7:130536974-130536996 TTAAGGAGGAGGGAGGAGGTGGG + Intronic
1032339116 7:131054530-131054552 GGAGGAGGGAGGGAGGAGGGAGG + Intergenic
1032647084 7:133836768-133836790 GGTTGAGGGAGGCAGGAGGATGG - Intronic
1033150852 7:138913922-138913944 GAAAGAGGGAGACAGGAGGGAGG + Intronic
1033359271 7:140626612-140626634 GCAAGAGGGAGAAAGGAGGTGGG - Intronic
1034276206 7:149824910-149824932 TTGAGGGGGAGGCAAGAGGTGGG + Intergenic
1034448137 7:151123699-151123721 GGAGGAGGGAGGCAGGAGGGAGG + Intronic
1034859637 7:154584211-154584233 GTGAGAGGGAAGGAGCAGGTGGG - Intronic
1035174007 7:157037693-157037715 GGAAGAGGGAGGCAGGAGAAAGG + Intergenic
1035262406 7:157670299-157670321 GAAAAAGGGAGGCAGGAGGTCGG - Intronic
1035280776 7:157776689-157776711 AGGAGAGGGAGGCAGGAGGAGGG - Intronic
1035354774 7:158270498-158270520 GGCAGAGGGAGCCAGGGGGTCGG - Intronic
1035574780 8:697533-697555 TTGACAGGGAGGCAGGAGGAGGG - Intronic
1036135855 8:6160980-6161002 GGGAGAGGGGAGCAGGAGGTGGG - Intergenic
1036154174 8:6326264-6326286 GGAAGAGGGAGGGAGGAAGGAGG + Intergenic
1036643819 8:10600063-10600085 GTGAGAGGGGAGCAGGATGTGGG - Intergenic
1036756082 8:11471909-11471931 GTAAGAGGGGGGCCACAGGTGGG + Intronic
1037587482 8:20288046-20288068 GGCAGGGAGAGGCAGGAGGTGGG - Intronic
1037666386 8:20973509-20973531 GTAAGAGAAAGGAAGGTGGTTGG + Intergenic
1037671185 8:21016590-21016612 GAAGGAGGGAGTGAGGAGGTGGG - Intergenic
1037892997 8:22633757-22633779 GTTAGTTGGAGGCTGGAGGTGGG + Intronic
1038025889 8:23590420-23590442 GGAAGACTGAGGCAGGAGGGTGG + Intergenic
1038035856 8:23686392-23686414 GTGAGATGGAGACAGTAGGTTGG + Intergenic
1038223434 8:25632349-25632371 GCCAGATTGAGGCAGGAGGTAGG - Intergenic
1038525671 8:28271070-28271092 TAGAGAGGGAGGAAGGAGGTGGG - Intergenic
1038542612 8:28402218-28402240 GGAGGAGGGAGGGAGGAGGTGGG + Intronic
1038542638 8:28402272-28402294 GGAGGAGGGAGGGAGGAGGAGGG + Intronic
1038548666 8:28446284-28446306 GTGCGGGGGAGGCAGGAGGATGG - Intronic
1038820891 8:30951096-30951118 GAAAGAGGAAGGAAGGAGGGAGG - Intergenic
1039218892 8:35305855-35305877 GAAAGAGGGAGGGAGGGGGAGGG - Intronic
1039230760 8:35445127-35445149 GAGACAGGGAGGCAGGAAGTTGG - Intronic
1039550783 8:38441335-38441357 GTGAGAGGTAGGGAGGAGGTGGG - Intronic
1040532747 8:48278830-48278852 ATAACAGGGATGCAGGAGATTGG - Intergenic
1040936823 8:52790137-52790159 GGAAATGGGAGGAAGGAGGTAGG + Intergenic
1041173558 8:55170366-55170388 GCAAGAGGGAGGCAGGAATGGGG + Intronic
1041178841 8:55226975-55226997 GTAAGAGTGAGCCAGGTTGTGGG - Intronic
1041300454 8:56406240-56406262 GAAAGAGAGAGGCAAGAGGGGGG - Intergenic
1041954441 8:63542052-63542074 AGAAGAGGAAGGCAGGAGGAAGG - Intergenic
1042716505 8:71778960-71778982 GTAAGAAGGAGGCAGCCCGTGGG + Intergenic
1043398185 8:79858471-79858493 GAAAGAGGGAGGAAGGGGATAGG - Intergenic
1044070189 8:87750966-87750988 GGAAGAGGCAGTCAGGAGGTTGG - Intergenic
1044122362 8:88413059-88413081 GTAAGAGGGTGCGAAGAGGTGGG + Intergenic
1044269909 8:90230012-90230034 GCAAGAGGGAGCCATGAGGCAGG - Intergenic
1044551624 8:93519070-93519092 GTAAGAGTGAGGCAGGATGGGGG + Intergenic
1044867636 8:96587850-96587872 GGAAAAGGGAGGGACGAGGTAGG + Intronic
1044908491 8:97030867-97030889 TGGAGAGGGAGGGAGGAGGTGGG + Intronic
1044975346 8:97659252-97659274 GGAAGAGGGAGGTAGTACGTGGG - Intronic
1045505029 8:102772245-102772267 GAAAGAGGTAGGGGGGAGGTTGG + Intergenic
1046718070 8:117588891-117588913 GAAAGAGGGTGGGAGGAGGTGGG - Intergenic
1046818014 8:118606783-118606805 GCAGGAAGGAGGCAGGAGATAGG + Intronic
1048031928 8:130641198-130641220 GCAAGAGGGAGTCAGCAGGGTGG + Intergenic
1048365274 8:133732987-133733009 GTCAGCGGGAGGCTGGAAGTTGG + Intergenic
1048436565 8:134423971-134423993 GCATGAGGGAGGCAGGTGGCAGG - Intergenic
1048466984 8:134674018-134674040 GTGAGAGCGAAGCAGAAGGTGGG + Intronic
1048799186 8:138180637-138180659 GAAAGAGGGAAGGAGGAGTTTGG + Intronic
1048848795 8:138624473-138624495 GGAGGAGGGAGGAAGGAGGGAGG + Intronic
1048998343 8:139808016-139808038 CTAAGAGGAGGGCAGGAGGTGGG + Intronic
1049249733 8:141581903-141581925 GTGAGCTGGAGGCAGGAGGGAGG + Intergenic
1049311791 8:141937411-141937433 GAAAGAGGGAGGAGGGAGGGAGG - Intergenic
1049335699 8:142083578-142083600 GCAGGAGAGAGGCAGGATGTGGG + Intergenic
1049356701 8:142192726-142192748 GTGAGAGGGAGGGAGGAGCAGGG + Intergenic
1049365797 8:142236306-142236328 GGCAGACAGAGGCAGGAGGTGGG + Intronic
1049370269 8:142261050-142261072 GAAAGAGGGAAGCAGGAGGGAGG + Intronic
1049470428 8:142772890-142772912 GACAGAAGGAGGCAGGAGGCAGG + Intronic
1049658548 8:143809518-143809540 GCAGGAAGGAGGCAGGAGGCTGG - Intronic
1050144623 9:2553542-2553564 TTCAGAGGGAGGCAGGAGATGGG + Intergenic
1050526289 9:6549514-6549536 TTAAGAGGGAGGGAGAAGTTGGG - Intronic
1051529169 9:18080321-18080343 GTAAGACTGAGGCAGAAGGATGG + Intergenic
1051588964 9:18756688-18756710 GTAAGAAAGAGGCTGTAGGTTGG - Intronic
1051675540 9:19554702-19554724 GAAAGAGGAAGGAAGGAGGAAGG - Intronic
1052492243 9:29184711-29184733 GGGAGAGGGAGGGAGGAGGGAGG - Intergenic
1052664947 9:31483991-31484013 GCAAGAAGGTGGCAGGAGGCAGG + Intergenic
1052946927 9:34176116-34176138 GAAAGAGGGAGGGTGCAGGTTGG + Intergenic
1052960537 9:34292551-34292573 GGATGGGGGAGGCTGGAGGTGGG + Intronic
1053188776 9:36041869-36041891 GTAAGAGGCAGGCAGCCAGTTGG - Intronic
1053578320 9:39376111-39376133 GTAAGAAAGAGGCTGGAGGAAGG - Intergenic
1053620399 9:39809112-39809134 GTAAGATGCTGGGAGGAGGTGGG - Intergenic
1053626301 9:39874822-39874844 GTAAGATGCTGGGAGGAGGTGGG + Intergenic
1053878568 9:42568411-42568433 GTAAGATGCTGGGAGGAGGTGGG - Intergenic
1053894098 9:42725967-42725989 GTAAGATGCTGGGAGGAGGTGGG + Intergenic
1054099904 9:60934922-60934944 GTAAGAAAGAGGCTGGAGGAAGG - Intergenic
1054121303 9:61210545-61210567 GTAAGAAAGAGGCTGGAGGAAGG - Intergenic
1054217587 9:62375879-62375901 GTAAGATGCTGGGAGGAGGTGGG - Intergenic
1054233122 9:62533284-62533306 GTAAGATGCTGGGAGGAGGTGGG + Intergenic
1054263757 9:62898331-62898353 GTAAGATGCTGGGAGGAGGTGGG + Intergenic
1054586439 9:66971963-66971985 GTAAGAAAGAGGCTGGAGGAAGG + Intergenic
1054885000 9:70186830-70186852 GCAAGAGGGAGGCAGGAAGGAGG + Intronic
1054908016 9:70427676-70427698 ATAAGAAGGAGGCGGGAGGCTGG + Intergenic
1055687422 9:78791707-78791729 GGGACAGGGAAGCAGGAGGTAGG + Intergenic
1055730274 9:79273808-79273830 GAAAGAGGAAGGAAGGAGGGAGG + Intergenic
1055766054 9:79664691-79664713 GGCAGCGGGAGGCAGGAGGAGGG - Intronic
1056172806 9:84004617-84004639 GTAATGGGGTGGGAGGAGGTTGG - Intergenic
1056283124 9:85061891-85061913 GTAACTGGGAGGTAGGAGGCAGG + Intergenic
1056507979 9:87275413-87275435 GCAGGAGGGAGGCAGGAGAATGG + Intergenic
1056896227 9:90553195-90553217 GTAAGAGATAAGCAAGAGGTTGG - Intergenic
1056950333 9:91036349-91036371 GTTAGAGCAATGCAGGAGGTGGG + Intergenic
1057134500 9:92677922-92677944 GTAAAAGAGAGGCAGGTGGAGGG - Intergenic
1058638803 9:107063206-107063228 GGAATAGGGAGGCAGGAGCGGGG + Intergenic
1058711566 9:107683652-107683674 GTAACAATGAGGCAGGATGTTGG - Intergenic
1058865024 9:109153975-109153997 ATTAGAGGAAGGCAGGAGGAGGG + Intronic
1059011655 9:110467946-110467968 GTAGGAGCAAGGCAGGGGGTTGG - Intronic
1059336474 9:113572294-113572316 GACAGAGGGAGGCAGGAGGGTGG + Intronic
1059392407 9:114007514-114007536 GTAAGAGGGAGGAGGGAGGCGGG - Intronic
1059654896 9:116348641-116348663 GGAAGAGGATGGGAGGAGGTAGG - Intronic
1059697928 9:116746423-116746445 GGAAGAGGGAGGCAGAGGATAGG - Intronic
1059894194 9:118842079-118842101 GAAAGAGGGAGGCAGAAGCAGGG - Intergenic
1060310284 9:122453422-122453444 CTAAGAGGGACTTAGGAGGTTGG - Intergenic
1060550208 9:124481384-124481406 GGAGGCGGGAGGCAGGAGGCAGG + Exonic
1060555333 9:124504884-124504906 GGAACAGGGAGGCAGGATGGGGG - Intronic
1060592707 9:124828991-124829013 GAAAGAGGAAGGAAGGAGGGAGG - Intergenic
1060705208 9:125792398-125792420 GTAGGAGGTAGCCAGAAGGTAGG + Intronic
1060735737 9:126065561-126065583 GAAGGAGGGAGGGAGGAGGAGGG - Intergenic
1060949933 9:127594990-127595012 GAGGGAGGGAGGGAGGAGGTTGG + Intergenic
1060967679 9:127720891-127720913 GGAGGAGGGAGGAAGGAGGAGGG - Intronic
1061101709 9:128497289-128497311 CTAAGAGGTAGGCAAGAGGCCGG + Intronic
1061192404 9:129089391-129089413 GTCAGAGGCAGGCAGGATTTTGG + Exonic
1061345709 9:130023390-130023412 TTTAGAGAGAGCCAGGAGGTCGG + Intronic
1061505989 9:131032176-131032198 GTAGGAGGGAGGAGGGAGGCAGG + Intronic
1061517375 9:131097469-131097491 GTTTGAGGGAGGCGGGAGGCTGG - Intronic
1061621648 9:131814632-131814654 GGAAGAGGCAGGCAGGAAGGTGG + Intergenic
1061708772 9:132473088-132473110 GTGAGAGGGAGTCAGGGGTTGGG + Intronic
1061747314 9:132749931-132749953 GGAAGACAGAGGAAGGAGGTTGG - Intronic
1061852210 9:133422874-133422896 TGAAGAGGGAGACAGGAGGCAGG - Intronic
1061878061 9:133554701-133554723 GGAGGAGGGAGGCATGAGGGTGG + Intronic
1062050654 9:134444802-134444824 GAAGGAGGGAGGAAGGAGGGAGG - Intergenic
1062144063 9:134979108-134979130 GAGAGAGGGAGGGAGGAGGGGGG + Intergenic
1062328248 9:136023064-136023086 GGAAGAGGGAGGGAGGAGGGAGG + Intronic
1062328260 9:136023094-136023116 GGAAGAGGGAGGGAGGAGGGAGG + Intronic
1062447882 9:136603295-136603317 GGCAGAGGGAGGTTGGAGGTGGG + Intergenic
1062449093 9:136608117-136608139 GAAGGAGGGAGGGAGGAGGGAGG + Intergenic
1062449110 9:136608163-136608185 GAAGGAGGGAGGGAGGAGGGAGG + Intergenic
1062449158 9:136608306-136608328 GAAGGAGGGAGGTAGGAGGGAGG + Intergenic
1062449196 9:136608416-136608438 GTGAGAGGGAGGGAGGAGGGAGG + Intergenic
1062480950 9:136751069-136751091 GAGAGAGGGAGGCAGGAGAGGGG + Intergenic
1062590363 9:137271886-137271908 GACAGAGGCAGGCAGGGGGTGGG - Intronic
1203751357 Un_GL000218v1:83626-83648 GTTGGTGGGAGGCAGGAGGGAGG - Intergenic
1203541026 Un_KI270743v1:87860-87882 GTTGGTGGGAGGCAGGAGGGAGG + Intergenic
1185463143 X:341504-341526 GCAGGAGGGGGGCAGGAGGAGGG - Intronic
1185553774 X:1004299-1004321 GAAAGAGGGAGGGAGGGGGAAGG - Intergenic
1185554786 X:1011930-1011952 GTAAGGCTGAGGCAGGAGGATGG - Intergenic
1185610885 X:1392967-1392989 GGAGGAGGGAGGCGGGAGGGAGG - Intergenic
1185610895 X:1392989-1393011 GGAGGAGGGAGGCGGGAGGGAGG - Intergenic
1185796866 X:2972871-2972893 GTATGAGGGAGAGAGGAAGTGGG + Intergenic
1186253678 X:7697256-7697278 GAAAAAGGGTGGCAGGAGATTGG - Intergenic
1186529661 X:10282403-10282425 GAAAGAGTGAGGGGGGAGGTAGG + Intergenic
1186992512 X:15084907-15084929 GTCACAGTGAGGCAAGAGGTGGG - Intergenic
1187007018 X:15241977-15241999 GAAAGAGGAAGGCAAGAGGAAGG - Intronic
1187026596 X:15441673-15441695 ATGAGGGGGAGGCAGGAGGTGGG + Intronic
1187278675 X:17839251-17839273 GAAAGAGAGAGGGAGGAGGATGG - Intronic
1187971763 X:24665873-24665895 CTCAGAGGTAGGCAGGAGCTGGG - Intronic
1188061581 X:25607181-25607203 TGAAGAGGGAGGCAGGAAGCTGG - Intergenic
1188730900 X:33645477-33645499 GGAAGAGGAAGGAAGGAGGGAGG + Intergenic
1188963899 X:36526979-36527001 GCAAGAGGGAGGGAGGAAGAAGG + Intergenic
1189571412 X:42301917-42301939 GAAAGAGGGAGGAGGGAGGGAGG - Intergenic
1190099397 X:47509584-47509606 GCATGAGGGAGTAAGGAGGTTGG - Intergenic
1190334284 X:49253041-49253063 CTCAGAGGGAGACAGGAGTTTGG + Intronic
1190376989 X:49797638-49797660 GTATGAGGAAGGCAGGATGGAGG + Intergenic
1190581300 X:51894672-51894694 GAAAGAGGGAGGGTGGAGGCAGG - Exonic
1190594609 X:52040709-52040731 GCATCAGGGAGGCAGGAGATGGG + Intergenic
1190732958 X:53236592-53236614 GACAGAGGGAGGGAGGAGGGAGG - Intronic
1191007512 X:55726015-55726037 TAAAGAGGGAAGCAGGAAGTGGG + Intronic
1191870152 X:65738866-65738888 GCAAGAGGCAGGCACCAGGTAGG - Intronic
1191937363 X:66439848-66439870 GAAGGAGGGAGGGAGGAGGGGGG + Intergenic
1192149570 X:68703760-68703782 AAGAGAGGGAGGCAGGAGGTAGG + Intronic
1192169227 X:68844119-68844141 GCTAGCTGGAGGCAGGAGGTGGG + Intergenic
1194065510 X:89255864-89255886 GTCAGAGGGAGGATGGAGGATGG - Intergenic
1194755253 X:97731731-97731753 GTAAGTGGGAGGAGAGAGGTAGG + Intergenic
1195289079 X:103414209-103414231 GGAGGAGGGAGGCAGGGGGAGGG + Intergenic
1195605488 X:106801707-106801729 TTTAGAGGGAGGAAGGAGTTGGG - Intergenic
1195858054 X:109351948-109351970 GAAGGAAGGAGGGAGGAGGTTGG - Intergenic
1195941948 X:110174374-110174396 GAAAGAGGGAGGGAGGGGGGAGG - Exonic
1196032178 X:111102868-111102890 GGAAGTGGGAGTCAGGAGTTGGG - Intronic
1196685061 X:118503830-118503852 GGAAGTGGGAGGCAGGGTGTGGG + Intronic
1196998657 X:121413466-121413488 GTATGAGGGAGGGAGGTGATTGG + Intergenic
1197014738 X:121609775-121609797 GAGAGAGGGAGGGAGGAGCTAGG + Intergenic
1197862046 X:130981142-130981164 GTGAGAGGGTGGAGGGAGGTGGG + Intergenic
1199219327 X:145298881-145298903 GTGGGAGGGTGGCACGAGGTTGG + Intergenic
1199264742 X:145817703-145817725 GGAGGAGGGAGGGAGGAGGGAGG - Intergenic
1199264756 X:145817739-145817761 GGAGGAGGGAGGGAGGAGGGAGG - Intergenic
1199872590 X:151912695-151912717 GTATGAGGGTGGCACGGGGTTGG - Intronic
1200152009 X:153955778-153955800 GCAAGGGGAAGGCAGGAGGCTGG + Intronic
1200256570 X:154585778-154585800 GTAGGAGGGGATCAGGAGGTGGG + Intronic
1200261199 X:154618625-154618647 GTAGGAGGGGATCAGGAGGTGGG - Intronic
1200719679 Y:6589959-6589981 GTCAGAGGGAGGATGGAGGATGG - Intergenic
1200941035 Y:8782067-8782089 GAGAGAGGGAGGGAGGAGGGAGG + Intergenic
1201146022 Y:11066252-11066274 GTGAGAGGGAGGAAGAAGGGAGG + Intergenic
1201165015 Y:11201239-11201261 GTTGGTGGGAGGCAGGAGGGAGG - Intergenic
1201225083 Y:11810849-11810871 GGAAGAGGGAGGCAGAAGAGAGG - Intergenic
1201517639 Y:14835323-14835345 GAAGGAGGGAGGAAGGAGGGAGG + Intronic