ID: 1142000423

View in Genome Browser
Species Human (GRCh38)
Location 16:87661203-87661225
Sequence CCTTGTAAGAGGGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1969
Summary {0: 4, 1: 41, 2: 157, 3: 395, 4: 1372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000423_1142000430 -8 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000423_1142000435 24 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000435 16:87661250-87661272 ATTATCCACCCAGATAATCCAGG 0: 1
1: 1
2: 5
3: 58
4: 311
1142000423_1142000436 25 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000436 16:87661251-87661273 TTATCCACCCAGATAATCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 170
1142000423_1142000431 -7 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000431 16:87661219-87661241 TACAAGGACCCTTGTGGTTCGGG 0: 1
1: 0
2: 2
3: 13
4: 110
1142000423_1142000432 -6 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000423 Original CRISPR CCTTGTAAGAGGGAGGCAGG AGG (reversed) Intronic
900465536 1:2823593-2823615 TCTCCTAAGAGGGAGGCAGGAGG - Intergenic
900536562 1:3180657-3180679 CCTTGAGGGAGGGAGGCAAGGGG + Intronic
900607086 1:3528606-3528628 CCTTATAAGAGGGAGGCAGGAGG + Intronic
900682860 1:3926456-3926478 CCTTCTGAGAATGAGGCAGGGGG - Intergenic
900715644 1:4141791-4141813 GCTTCTAAGAGGGAGGCAGGAGG + Intergenic
900779448 1:4608225-4608247 CTTTTTAAGAGAGAGGCAGAGGG - Intergenic
900783372 1:4632147-4632169 CTTTGTAAGAGGCAGACGGGAGG - Intergenic
900910247 1:5592243-5592265 TCTTATAAGAGGGAGACGGGAGG + Intergenic
901063945 1:6485944-6485966 CCTTGAATGCTGGAGGCAGGGGG + Intronic
901071370 1:6520593-6520615 CCTTGGAAGGCTGAGGCAGGAGG - Intergenic
901143531 1:7050784-7050806 CCTTGTCAGGGTGAGGCAGGCGG + Intronic
901356163 1:8651168-8651190 CTTTGGGAGATGGAGGCAGGAGG + Intronic
901455607 1:9361244-9361266 CTTTGGAAGACCGAGGCAGGAGG - Intronic
901461624 1:9395396-9395418 CCTTATAAGCTAGAGGCAGGAGG - Intergenic
901598431 1:10403346-10403368 CTTTGGGAGACGGAGGCAGGTGG + Intronic
901694535 1:10996996-10997018 CCTTGGAAGGCCGAGGCAGGCGG + Intergenic
901761931 1:11477501-11477523 CCATGTGAGAGGGTGGGAGGAGG - Intergenic
901802844 1:11719145-11719167 CTTTGTAAGGCCGAGGCAGGTGG - Intronic
901826019 1:11861847-11861869 CCTTATAAGAGGGAAGCCAGAGG + Intergenic
901831654 1:11896147-11896169 CTTTGGAAGACGGAGACAGGAGG + Intergenic
901866740 1:12111491-12111513 CTTTAAAAGAGGGAGGCAGGAGG + Intronic
901955191 1:12778980-12779002 CCTCATAACAGGGAGGCAGTAGG + Intergenic
902067105 1:13697776-13697798 CATTATGAGAGGGAGGCAGAGGG + Intergenic
902096143 1:13947559-13947581 CCTGACAAGAGGGAGGCAGAGGG - Intergenic
902173693 1:14633344-14633366 TCTTGTAAGAGGAAGGCAAGAGG + Intronic
902489934 1:16774057-16774079 CCTTACAGGAGGGAGGCAGGAGG + Intronic
902567259 1:17320250-17320272 CTTTATAAGAGGGAGGCAGGAGG - Intronic
902569029 1:17334896-17334918 CTTTGGAAGGCGGAGGCAGGAGG + Intronic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902654728 1:17859497-17859519 CCTGGGAGGAGGGGGGCAGGGGG + Intergenic
902659766 1:17892904-17892926 CCTCGTAGGAGGGAGGCAGAGGG + Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902722381 1:18312662-18312684 CCTTATTGGAGGGAGACAGGAGG - Intronic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
902940484 1:19797380-19797402 CCTGGGAAAAGGGAGGCAGGGGG + Intronic
902988009 1:20167276-20167298 ACATGTAAGGGGTAGGCAGGTGG - Intronic
902990559 1:20184774-20184796 TCTTCTAAGAGGGAGGAGGGAGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903412511 1:23157431-23157453 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
903473220 1:23601809-23601831 CTTTGAAAGACTGAGGCAGGTGG - Intronic
903607054 1:24582476-24582498 CTTTATAAGGGAGAGGCAGGAGG + Intronic
903672324 1:25043823-25043845 CCTTTTCAGATGGATGCAGGAGG - Intergenic
903769720 1:25756342-25756364 CCTGGGCAGAGGCAGGCAGGTGG - Intronic
904098651 1:28002875-28002897 CTTTGGAAGACCGAGGCAGGCGG + Intronic
904332259 1:29767715-29767737 CACTGGAAGAGGGAGGGAGGTGG - Intergenic
904389776 1:30174746-30174768 CCTTACAAGAGGGAGGCAGGAGG + Intergenic
904550946 1:31317266-31317288 CTTTGAAAGGGCGAGGCAGGTGG - Intronic
904590389 1:31611642-31611664 CCTTATAAGAGGGAGGCAAGAGG - Intergenic
904714671 1:32458303-32458325 CCTTGTTGGATGAAGGCAGGTGG + Intergenic
904828168 1:33289093-33289115 CCTTGAGAGAGGGAAGTAGGAGG + Intronic
904916236 1:33972529-33972551 CCTTATAAGAGGGGGGCAGGAGG + Intronic
904968559 1:34400551-34400573 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
904982816 1:34521281-34521303 CCTTATAAGAGGAAGGCAAGAGG - Intergenic
905336112 1:37245630-37245652 TCTTGTAAGAGGGAGACAGGAGG + Intergenic
905344020 1:37299259-37299281 CTTGGGAAGAGGGAGGGAGGAGG + Intergenic
905410186 1:37763367-37763389 CCTTGTATGAGGGGTGCAGGAGG - Intronic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
905526349 1:38642882-38642904 TCTTACAAGAGGGAGGCAGGAGG + Intergenic
905635832 1:39551467-39551489 CTTTGGGAGATGGAGGCAGGAGG - Intergenic
905686175 1:39910230-39910252 CCTTGGGAGACTGAGGCAGGAGG + Intergenic
905788346 1:40775790-40775812 CTTTGGGAGATGGAGGCAGGAGG + Intergenic
905833062 1:41090033-41090055 CTTTGGGAGAGTGAGGCAGGTGG - Intronic
905925775 1:41748666-41748688 CATTGCATGATGGAGGCAGGAGG + Intronic
906236202 1:44212708-44212730 CCTGGAAAGAGAGAGACAGGAGG - Intergenic
906362948 1:45179863-45179885 CCTTATAAGAGGGAGGCAAGAGG + Intronic
906622758 1:47297694-47297716 GCTTGGGAGAGTGAGGCAGGAGG - Intronic
906935632 1:50211798-50211820 CCTTTTAAAAGGGAGGTGGGAGG + Intergenic
907024380 1:51101064-51101086 ACTTGGAAGAGTGAGGCGGGAGG + Intergenic
907040375 1:51253412-51253434 ACTTGGAAGATTGAGGCAGGAGG + Intronic
907463728 1:54621644-54621666 CCTTGTAAGAGGGGTCCAGGAGG + Intronic
907523059 1:55037840-55037862 CCCTGAAGGAGGAAGGCAGGAGG + Intergenic
907932259 1:59011475-59011497 CCTTTTAAGAGAGAGGCAGAGGG + Intergenic
908064239 1:60385352-60385374 CTTTATAAGAGGAAAGCAGGAGG - Intergenic
908416049 1:63914388-63914410 CCTAGGGAGAGGAAGGCAGGAGG + Intronic
908452611 1:64270883-64270905 CCTTGGAAGACCGAGGCAGAAGG + Intergenic
908567925 1:65377804-65377826 CCATGGGAAAGGGAGGCAGGAGG - Intronic
908811863 1:67989660-67989682 ACTTATAAGAGGGAGACAAGAGG + Intergenic
908856431 1:68434870-68434892 ACTTGGAAGACTGAGGCAGGAGG - Intronic
908859151 1:68463813-68463835 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
908979860 1:69942678-69942700 CATTATAAGAGAGAGGCAAGGGG - Intronic
908999122 1:70197384-70197406 ACTTGGAAGACGGAGGCAGGAGG - Intronic
909013798 1:70362456-70362478 CTTTGGAAGACCGAGGCAGGCGG + Intronic
909042808 1:70674223-70674245 CCTTATAAGAGGGGCGCAGAAGG - Intergenic
909454812 1:75838339-75838361 CCTTACAAGAGGGTGGCAGGAGG - Intronic
910213377 1:84816687-84816709 GCTTGGAAGACTGAGGCAGGAGG + Intronic
910240019 1:85076212-85076234 CCTTATAAGATGGTGACAGGAGG - Intronic
910250981 1:85199628-85199650 CTTTGTCGGGGGGAGGCAGGTGG + Intronic
910411112 1:86945823-86945845 CTTTGGAAGGGCGAGGCAGGTGG + Intronic
910498164 1:87856728-87856750 CCTTATAAGAGGAAAGCAGAGGG - Intergenic
910733762 1:90428664-90428686 CCTTTTGAGAGGGAGGCAGAGGG + Intergenic
910806397 1:91193084-91193106 CTTTGGAAGACGGAGGCAGGAGG + Intergenic
911618752 1:100042851-100042873 CTTTGGAAGACTGAGGCAGGTGG - Intronic
911658873 1:100476933-100476955 CCTTAGAAGAGGGACCCAGGGGG + Intronic
911709592 1:101054681-101054703 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
911788848 1:101985179-101985201 CCTTTTAAGAGGAAGGCTGGAGG - Intronic
912282590 1:108332002-108332024 CTTTGTGAGGGTGAGGCAGGTGG + Intergenic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
912507371 1:110165496-110165518 CCTTGGAAGAGGAGGGCAGCAGG + Intronic
912653212 1:111459919-111459941 CTTTGGAAGGGCGAGGCAGGAGG + Intronic
912881421 1:113419971-113419993 CCTTCTAAGAGGGTAGTAGGAGG - Intronic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
913582354 1:120238772-120238794 CCTAGTAAGAGGGACACTGGAGG - Intergenic
913625819 1:120659611-120659633 CCTAGTAAGAGGGACACTGGAGG + Intergenic
914334424 1:146701531-146701553 CCTTATATGAGGGAGGCAGAGGG - Intergenic
914516888 1:148381795-148381817 CTTTGAGAGGGGGAGGCAGGAGG + Intergenic
914564289 1:148850247-148850269 CCTAGTAAGAGGGACACTGGAGG - Intronic
914608537 1:149279992-149280014 CCTAGTAAGAGGGACACTGGAGG + Intergenic
914775970 1:150735695-150735717 ACTTGTAAGGCTGAGGCAGGAGG - Intronic
914786744 1:150839995-150840017 CTTTGGGAGATGGAGGCAGGTGG + Intronic
914991973 1:152506710-152506732 CCTTACAAGAGGGAGGCAAAAGG - Intergenic
915154528 1:153863865-153863887 CTTTGTGAGATCGAGGCAGGTGG - Intronic
915429811 1:155857484-155857506 CCTTGGGAGACGGAGGCGGGCGG + Intronic
915544444 1:156588404-156588426 CTTTGGAAGACCGAGGCAGGCGG - Intergenic
915736796 1:158090327-158090349 GCTGGTAGGAGGAAGGCAGGAGG - Intronic
915936613 1:160093436-160093458 CCTAGTGAGGGGGAGACAGGAGG - Intronic
916022867 1:160809261-160809283 ACTTGGAAGATAGAGGCAGGAGG - Intronic
916077279 1:161209171-161209193 CCTGGGAAGAGGGAGGAATGTGG - Exonic
916181691 1:162089661-162089683 CCTTACAAGAGGGAGGGAGGGGG + Intronic
916224250 1:162474026-162474048 TCTTATGAGAGGGAGGCAGAAGG + Intergenic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916295980 1:163220795-163220817 CCTTACAAGAGCAAGGCAGGAGG + Intronic
916531348 1:165659570-165659592 TCTTCTAAGAGGGAGGCAAAGGG + Intronic
916621722 1:166505295-166505317 ACTTGGGAGATGGAGGCAGGAGG - Intergenic
916632888 1:166636002-166636024 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
916693850 1:167217649-167217671 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
916757108 1:167782755-167782777 CCTTAGAAGAGGGAGGCAGAAGG + Intronic
916801885 1:168223572-168223594 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
917073502 1:171178618-171178640 CTTTGGAAGACCGAGGCAGGTGG + Intergenic
917085905 1:171305860-171305882 CCTTGGAGAAGAGAGGCAGGAGG - Intergenic
917101688 1:171453019-171453041 CTTTGGAAGACTGAGGCAGGTGG + Intergenic
917165735 1:172110790-172110812 CTTTGAAAGGGTGAGGCAGGTGG + Intronic
917302329 1:173589311-173589333 CTTTGGAAGATTGAGGCAGGAGG + Intronic
917864423 1:179179855-179179877 CTTTGGAAGGGCGAGGCAGGGGG + Intronic
917902322 1:179554907-179554929 CCTTATAAGAGGGAGGCAAATGG + Intronic
918057260 1:181032825-181032847 CCTTATTAGAGGGAGGCAAAAGG - Intergenic
918254546 1:182737187-182737209 TCTTATAAGAGAGAGGCAGAGGG - Intergenic
918359561 1:183742136-183742158 TCTTGAAAGAGGCAGGCAGGAGG - Exonic
918516308 1:185367297-185367319 CCTTTTAAGAGAGAGACAGAGGG + Intergenic
918618111 1:186571495-186571517 CTTTGGAAGACTGAGGCAGGTGG - Intergenic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918830241 1:189386468-189386490 CTTTGTGAGACCGAGGCAGGTGG + Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
918992466 1:191715385-191715407 CCTTTCGAGAGGGATGCAGGAGG - Intergenic
919061749 1:192642568-192642590 CTTTGCAAGACTGAGGCAGGAGG - Intronic
919086976 1:192932112-192932134 CCTTATAAGAGGGACACAGGAGG - Intergenic
919303992 1:195806630-195806652 TCTTAAAAGAGGGAGGCAGAGGG + Intergenic
919410096 1:197232037-197232059 CCTTATAAGAGAAAGGTAGGAGG + Intergenic
919461103 1:197878597-197878619 CCTTGTGAGGCTGAGGCAGGTGG - Intergenic
920310427 1:205044999-205045021 GCGAATAAGAGGGAGGCAGGAGG + Intronic
920617028 1:207503603-207503625 CCTTATAAAAGGGAGGCAAGAGG - Intronic
920645293 1:207798847-207798869 CCTTCTAAGAGGGAGGCAGGGGG + Intergenic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921701673 1:218275494-218275516 CCTAGAAAGATGGAGGCAGACGG + Intergenic
921873550 1:220168478-220168500 CCTTGTACCTGGGAGGCAGAGGG - Intronic
921891340 1:220356934-220356956 CTTTGGGAGACGGAGGCAGGCGG - Intergenic
921971231 1:221151382-221151404 CCTAACAGGAGGGAGGCAGGAGG - Intergenic
922169443 1:223142773-223142795 CCTTGGAAAAGGGAGACAGAGGG - Intronic
922268100 1:224006263-224006285 ACTTGGTAGAGGGAGGTAGGAGG - Intergenic
922546542 1:226462087-226462109 CTTCATAAGAGGGAGGCAGAGGG + Intergenic
922597148 1:226822914-226822936 CCTTATAAGAGGGAGGCAGGAGG - Intergenic
922858359 1:228794544-228794566 CTTTATAAGAGGGAGGAAGGGGG - Intergenic
922932582 1:229402058-229402080 CCTTATGAGAGGGAGGCAGGAGG - Intergenic
923144635 1:231189455-231189477 TCTTGTAAGAGGGAGATAGGAGG + Intronic
923206852 1:231767538-231767560 CTTTGGAAGACTGAGGCAGGAGG - Intronic
923363752 1:233238445-233238467 CTTTGAGAGGGGGAGGCAGGAGG + Intronic
923530505 1:234808471-234808493 CCTTACGGGAGGGAGGCAGGAGG - Intergenic
923765852 1:236891724-236891746 CCTTGAAAGGGGAAGACAGGTGG + Intronic
923773906 1:236961358-236961380 CCTTATAAGAGGGAGGCTGAGGG - Intergenic
923873810 1:238025159-238025181 CCTTGTAAGTGTGAGGTAGAGGG - Intergenic
924016098 1:239724893-239724915 CCTTGTGAGGCTGAGGCAGGAGG - Intronic
924289998 1:242526157-242526179 CCTTGGGAGGAGGAGGCAGGAGG + Intergenic
924379879 1:243452668-243452690 CTTTGGAAGGGTGAGGCAGGAGG - Intronic
924398782 1:243654560-243654582 CCTTGGAAGGCTGAGGCAGGAGG - Intronic
924467465 1:244311489-244311511 CCTTGTGAGGCTGAGGCAGGAGG - Intergenic
924624185 1:245686289-245686311 CCTTGCTCGAGGGAGGCAGTGGG - Exonic
924817158 1:247452461-247452483 AGTGGTAGGAGGGAGGCAGGCGG + Intergenic
924948298 1:248860614-248860636 CCTTGTAAGAGAGAAGCAGAGGG - Intergenic
1062840587 10:667108-667130 CCTTGGAAGGCCGAGGCAGGCGG + Intronic
1062993890 10:1847222-1847244 CATCGGAAGAGGGAGGCAGAGGG + Intergenic
1063197543 10:3757816-3757838 TCTAGGAAGAGGGAGGCAGCGGG - Intergenic
1063473097 10:6304762-6304784 CTTTGCAAGGGTGAGGCAGGAGG - Intergenic
1063486541 10:6425709-6425731 CTTTGGTAGAGTGAGGCAGGGGG + Intergenic
1063736546 10:8761944-8761966 TCTTATAAGAAGGGGGCAGGAGG - Intergenic
1063810369 10:9698030-9698052 CCTTATAAGAGGGAGGTATGTGG + Intergenic
1064336025 10:14442173-14442195 TCTTGTAAGTGGGAAGCAGGAGG + Intronic
1064391794 10:14948630-14948652 CTTTGGAAGAATGAGGCAGGAGG + Intronic
1064428947 10:15254981-15255003 CCTTGTGAGAGGGAGCAGGGTGG - Intronic
1064659244 10:17589531-17589553 CTTTGGAAGACTGAGGCAGGAGG - Exonic
1064994539 10:21284953-21284975 ACTTGGAAGACTGAGGCAGGAGG + Intergenic
1065225824 10:23542891-23542913 CTTTGGGAGGGGGAGGCAGGTGG - Intergenic
1065241666 10:23711357-23711379 CCTTACAAGAGGGAGGCAAGAGG + Intronic
1065378828 10:25068558-25068580 CCTAGGAGGAGGGAGGAAGGAGG + Intergenic
1065407279 10:25383076-25383098 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1065508841 10:26457381-26457403 CTTTGGAAGGCGGAGGCAGGAGG - Intronic
1065619748 10:27568986-27569008 CCTTGCAAGAGAGGGGCAGGAGG - Intergenic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1065659272 10:27988933-27988955 TCTTATAAGAGGAAGACAGGAGG + Intronic
1065691564 10:28339327-28339349 CTTTGAAAGACTGAGGCAGGAGG - Intergenic
1065694969 10:28371351-28371373 TCTTATAAGAGGGAGGCAGAGGG - Intergenic
1065695124 10:28372659-28372681 ACTTGTAAGGCTGAGGCAGGAGG + Intergenic
1065902752 10:30223230-30223252 CCAGGTAGGAGGGAGGCAGAAGG - Intergenic
1065988553 10:30982342-30982364 CTTTGTGAGACTGAGGCAGGTGG - Intronic
1065993745 10:31036918-31036940 ACTTGGAAGGTGGAGGCAGGAGG + Intergenic
1066041731 10:31554925-31554947 CCTTGTAATATGGTGGCAGAGGG - Intergenic
1066209425 10:33222766-33222788 CTTTGGGAGACGGAGGCAGGAGG - Intronic
1066423283 10:35281543-35281565 CTTTGGAAGACCGAGGCAGGTGG - Intronic
1066657313 10:37708285-37708307 CCTTATAAGAAAGAGGCAGAGGG + Intergenic
1066725597 10:38389346-38389368 ACTTGGTAGAGGGAGGTAGGAGG + Intergenic
1067089282 10:43258426-43258448 CCATGAAAGAGGAGGGCAGGTGG - Intronic
1067309837 10:45102449-45102471 CCTCATAAGAGGGAGGAAGGAGG - Intergenic
1068437675 10:57013702-57013724 CCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1068635999 10:59348875-59348897 CTTTGTAAGACCGAGGCGGGTGG - Intronic
1068644632 10:59451721-59451743 CTTTATAAAAGGGAGGCAGAAGG + Intergenic
1068674931 10:59760970-59760992 CTTTGAAAGACTGAGGCAGGTGG - Intergenic
1068820301 10:61368666-61368688 CCTTATTAGAAGGAGGCAGGAGG - Intergenic
1068988694 10:63129988-63130010 CCTTACTAGAGGGAGGCAGAAGG + Intergenic
1069018729 10:63462674-63462696 GCTTTTAAGATGGAGGAAGGGGG + Intronic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069125022 10:64619411-64619433 CCTTGTAAAAGAGAGGCAAAAGG - Intergenic
1069352511 10:67546238-67546260 CCTTGGAAGGCTGAGGCAGGAGG - Intronic
1069396343 10:67993408-67993430 ACTTGGGAGAGTGAGGCAGGAGG + Intronic
1069654095 10:70075140-70075162 CCTTAGAAGACGGAGGCAGGGGG - Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069880909 10:71592604-71592626 CCTCATTAGAGGGAGGCAGGGGG - Intronic
1069887267 10:71631731-71631753 CCTTCTAAGAGGGATGCCAGAGG + Intronic
1069931733 10:71887358-71887380 TCTTGAAACTGGGAGGCAGGCGG - Intergenic
1069949917 10:72011639-72011661 CCTTGTGCTAGGGAGGCTGGCGG - Exonic
1070342870 10:75513748-75513770 GTTTGTAAGAGGCAGGCAGAAGG - Intronic
1070376384 10:75835359-75835381 ACTTATAAGAAGGATGCAGGAGG - Intronic
1070384992 10:75916382-75916404 CCTGGCAAGAGAGAGGCAGCAGG + Intronic
1070566539 10:77607542-77607564 CCTTCAAAGAGGGAGGTAGAGGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1070686295 10:78485251-78485273 CCTTGGGAGACTGAGGCAGGTGG + Intergenic
1070747526 10:78943563-78943585 TCTTATAAGAGGGAGGCAGGAGG - Intergenic
1071044443 10:81356517-81356539 CCTCTTCACAGGGAGGCAGGAGG - Intergenic
1071071080 10:81694834-81694856 TCCTTTAAGAGAGAGGCAGGAGG - Intergenic
1071237623 10:83667451-83667473 ACATGGAAGAGGGAGGCAGAAGG + Intergenic
1071270550 10:84002865-84002887 CCTTGTAATAAGGACTCAGGAGG - Intergenic
1071374166 10:84985711-84985733 CCTTATCAGGGGGAGGCAGAGGG + Intergenic
1071584781 10:86809535-86809557 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1071791219 10:88956415-88956437 CCTTCTAAGAGGGAGACAGGAGG - Intronic
1071912046 10:90247454-90247476 CCTTATAAGAGGGAGGGCAGAGG + Intergenic
1071943936 10:90619486-90619508 CCTTATAAGAGCAGGGCAGGAGG - Intergenic
1072036140 10:91564500-91564522 CCTTGGAAGGCCGAGGCAGGAGG + Intergenic
1072083421 10:92055794-92055816 CCTTGGAAGGGTGAGGCAGGAGG + Intronic
1072911892 10:99509500-99509522 GCTTTGAAGATGGAGGCAGGGGG + Intergenic
1072988080 10:100160701-100160723 CTTTGGAAGACTGAGGCAGGTGG + Intronic
1073373243 10:103009580-103009602 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
1073406527 10:103302686-103302708 CTTTGGAAGACCGAGGCAGGTGG - Intergenic
1073687008 10:105765826-105765848 CCTTATGAGAGAGATGCAGGAGG - Intergenic
1073742692 10:106426727-106426749 CTTTGTAACAGGGAGACAAGAGG - Intergenic
1074114821 10:110447862-110447884 CTTTGAAAGACTGAGGCAGGAGG + Intergenic
1074153182 10:110776619-110776641 CCTTCTAAGACGGAAGCAGGAGG - Intronic
1074249984 10:111735413-111735435 CCTTATAAGATAGAGGCAGGAGG - Intergenic
1074404670 10:113170542-113170564 CCTTGTAAGAGAGAGGCAGAAGG - Intergenic
1074425102 10:113343673-113343695 GCATATAAGAGGGAGCCAGGAGG + Intergenic
1074426112 10:113352952-113352974 CTTTGGGAGAGTGAGGCAGGAGG + Intergenic
1074621343 10:115126299-115126321 CTTTGGAAGGTGGAGGCAGGCGG - Intronic
1074737285 10:116448770-116448792 CTTTGTGAGACCGAGGCAGGCGG + Intronic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1075136982 10:119794804-119794826 CCTTCTGGGAGGGAGGGAGGTGG - Intronic
1075182851 10:120227584-120227606 CCTTATAAGGGAGAGGCAGAGGG - Intergenic
1075261503 10:120967273-120967295 CCTTGGAAGACAGAGACAGGAGG - Intergenic
1075361382 10:121838318-121838340 GCTGGTGAGAAGGAGGCAGGTGG - Intronic
1075512600 10:123084428-123084450 CCTTATAGGAGGGAGGGAGAGGG + Intergenic
1075672820 10:124275168-124275190 CCAGATAAGCGGGAGGCAGGGGG - Intergenic
1075838576 10:125477509-125477531 TCTTGCTAGAGGGATGCAGGTGG - Intergenic
1075923440 10:126232216-126232238 CCTTATAAGAGACAAGCAGGAGG + Intronic
1075955112 10:126516938-126516960 CCTTACAAGAGGGAGGAAGAAGG - Intronic
1076008514 10:126967726-126967748 CCTTATAAGAGGAAGACGGGAGG - Intronic
1076023415 10:127092724-127092746 CCTTGGGAGACTGAGGCAGGCGG - Intronic
1076074646 10:127523455-127523477 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1076268756 10:129132288-129132310 CCTTAGAAGAGGGAGGCAGGAGG - Intergenic
1076315088 10:129534211-129534233 CATGGTAAGTGGAAGGCAGGTGG + Intronic
1076413406 10:130267625-130267647 CTTTATAAGAGGGAGACAGAGGG - Intergenic
1076565267 10:131394249-131394271 CCTCATAAGAGGGAGGCAGAAGG - Intergenic
1076635361 10:131878825-131878847 CCTAATTAGAGAGAGGCAGGGGG - Intergenic
1076776461 10:132700572-132700594 CCTTGCTGGAGGGAGGAAGGAGG + Intronic
1077350151 11:2089442-2089464 GGTTATAAGAGGGAGGCAGCTGG + Intergenic
1077379599 11:2223570-2223592 CCTGGTAGGAGGCAGGTAGGGGG + Intergenic
1077482420 11:2822014-2822036 CCTTCTAAGAGGGAGGCAGGAGG + Intronic
1077640428 11:3876650-3876672 CTTTGGGAGATGGAGGCAGGAGG - Intronic
1077666503 11:4115337-4115359 CCTTGTAAGAGAGAGGCTGAGGG + Intronic
1077933545 11:6758721-6758743 CCTTATAAGAGGGAGGTAGCAGG - Intergenic
1078448070 11:11419934-11419956 CTCTGCAAGAGGGAGGCAGCAGG - Intronic
1078581945 11:12545579-12545601 CTTTGGGAGACGGAGGCAGGTGG + Intergenic
1078635860 11:13049468-13049490 GCTTGTCAGAGGGTGGGAGGAGG - Intergenic
1078682428 11:13489618-13489640 CTTTGGGAGGGGGAGGCAGGAGG + Intergenic
1078859322 11:15232737-15232759 TCTTGTAAGAGGGAGGGAAGAGG + Intronic
1079417396 11:20252337-20252359 TCTTATAAGGGGGAGGCAGCAGG - Intergenic
1079494939 11:21031803-21031825 CTTTGGAAGGGCGAGGCAGGCGG + Intronic
1079943630 11:26713977-26713999 CCTTATATGAGGGAGGTAGTGGG - Intronic
1080016512 11:27512528-27512550 TCTTGGAAGACTGAGGCAGGAGG + Intergenic
1080048647 11:27836122-27836144 CCTTATAAGAGAGAGACAGAGGG - Intergenic
1080181912 11:29435680-29435702 CCTTATAAAAAGGAGGCAGGAGG - Intergenic
1080317721 11:30969284-30969306 CCTTAGAAGAGAGAGGCAGAAGG + Intronic
1080687834 11:34530132-34530154 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1080934021 11:36842776-36842798 CCTTATAAGAAAGAGGCAGAGGG - Intergenic
1080956179 11:37098669-37098691 ACTTGTAAAAGGGAGGCAGAGGG - Intergenic
1081152114 11:39645692-39645714 CCTTGTAAGAGAGAGGTAAGAGG - Intergenic
1081208978 11:40308559-40308581 CCTTATAAGAGAAAGGCAGGAGG + Intronic
1081678225 11:44983478-44983500 CCTCATAAGAGGGAGGCAGGAGG + Intergenic
1081839843 11:46191901-46191923 CTTTGTGAGACTGAGGCAGGGGG + Intergenic
1081906038 11:46670698-46670720 CCTTGGGAGGTGGAGGCAGGAGG + Intronic
1082036834 11:47651864-47651886 CTTTATAAAAGGGAGGCAGGAGG - Intergenic
1082663584 11:55946109-55946131 CCTTATAAGAGGGTTGCAGAGGG - Intergenic
1082727384 11:56752418-56752440 CCTTACAAGAGGGAGGCAGAGGG + Intergenic
1082952632 11:58833497-58833519 CCTTCTAAGAGGGAGGCAGAGGG + Intergenic
1083642002 11:64150671-64150693 CTTTGTGGGAGGGAGGAAGGGGG - Intronic
1083664839 11:64268765-64268787 CCCTGGAGGAGGGATGCAGGCGG - Exonic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084035245 11:66505737-66505759 ACTTGAAAGAGTGAGGTAGGAGG + Intronic
1084052648 11:66610460-66610482 CCTTGTAAGAGGGAGGCAGAAGG - Intergenic
1084326829 11:68405221-68405243 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1084453960 11:69256724-69256746 CCTTATGAGAGGGAGGAAGGGGG + Intergenic
1084491648 11:69481816-69481838 CCTTTAAATAGGGAGGGAGGTGG + Intergenic
1084563681 11:69918064-69918086 TCCTGTAAGAGGGAGGCAGGAGG - Intergenic
1084676841 11:70640271-70640293 CTTTATAAGAGAGAGGCAGGGGG + Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1084780567 11:71405505-71405527 CCTTCTAAGACAGAGGCAGGAGG + Intergenic
1084904912 11:72338225-72338247 CCTTGTACCAGGGGGGTAGGGGG - Intronic
1084913461 11:72409732-72409754 CTTTGGAAGACGGAGGCGGGTGG + Intronic
1085027339 11:73243948-73243970 CCTTGAACCCGGGAGGCAGGAGG + Intergenic
1085278086 11:75312692-75312714 CCTGACAAGAGGGAGGCAGGAGG + Intronic
1085336900 11:75703287-75703309 CCTTATAAGAGCGATGCAGAGGG - Intergenic
1085357540 11:75853017-75853039 ACTTGGGAGATGGAGGCAGGAGG - Intronic
1085662197 11:78378732-78378754 ACTTGGGAGATGGAGGCAGGAGG - Intronic
1085673145 11:78488339-78488361 ACGTGAAAGAGGGAGGCATGAGG + Intronic
1085920514 11:80949785-80949807 CTTTGTGAGGGTGAGGCAGGAGG + Intergenic
1086033767 11:82392386-82392408 TCTTGTAAGAGGGAAGCATTGGG + Intergenic
1086037299 11:82432068-82432090 CCTTATAAGAGAAAGGCAGAGGG + Intergenic
1086103574 11:83126651-83126673 CTTTGGGAGAGCGAGGCAGGTGG + Intergenic
1086109029 11:83178550-83178572 CTTTGTAAGGCCGAGGCAGGTGG + Intronic
1086185534 11:84010543-84010565 CCTTGGGAGACGGAGGCAGGAGG - Intronic
1086237289 11:84646476-84646498 CTTTGTCAGAGCCAGGCAGGGGG + Intronic
1086667046 11:89495433-89495455 CCTGGTAAGAGAGAGGCAGAGGG - Intronic
1086926029 11:92641603-92641625 CCTTATAAGAGAAAGGCAGAGGG - Intronic
1087021871 11:93611203-93611225 CCTTTTAAGAGGGAAGCAGAGGG - Intergenic
1087116827 11:94534565-94534587 ACTTGTAGGACTGAGGCAGGAGG - Intergenic
1088070284 11:105775169-105775191 CCTGGTAAGAGGGATGCAAGAGG - Intronic
1088141805 11:106625826-106625848 TCTTATAAGAGGAAGGCAGGAGG - Intergenic
1088527068 11:110768292-110768314 CCTGATAAGAGGGAATCAGGGGG + Intergenic
1088560533 11:111110925-111110947 CTTTGTAAGAGGGAGACAGGAGG + Intergenic
1088816161 11:113422476-113422498 CTTTGGAAGAGGGAAGAAGGAGG + Intronic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1088903823 11:114138989-114139011 CCTTGTAAGAGGAAGGGAGTAGG - Intronic
1089226307 11:116925330-116925352 CCTTGCAAGAGGGAAGCAGGAGG + Intronic
1089254506 11:117187181-117187203 CCATGGGAGAGGCAGGCAGGGGG + Intronic
1089414987 11:118280896-118280918 CTTTGGAAGGGCGAGGCAGGAGG - Intergenic
1089820331 11:121220048-121220070 CCTTGTAAGAGAAAGACAGAGGG - Intergenic
1089820346 11:121220138-121220160 TCTTATAAGAGGGAAGCAGGAGG + Intergenic
1089836414 11:121374331-121374353 TCATGTAAGAGGGGGGTAGGGGG + Intergenic
1089962585 11:122629035-122629057 TGCAGTAAGAGGGAGGCAGGAGG + Intergenic
1090008855 11:123027810-123027832 CGTGGTGAGATGGAGGCAGGAGG + Intergenic
1090086107 11:123652591-123652613 CCTCGTTTCAGGGAGGCAGGTGG + Intronic
1090228770 11:125087033-125087055 CCCTGGAAGAGGGGAGCAGGGGG + Intronic
1090260433 11:125315106-125315128 CCTGCTCAGAGGGAGGCAGGAGG + Intronic
1090368023 11:126224227-126224249 CTTTGGGAGAGTGAGGCAGGCGG + Intronic
1090778963 11:129989957-129989979 CCTTGAAAGGCTGAGGCAGGTGG + Intronic
1091034232 11:132218663-132218685 CCTTCCCAGAGGGAGGTAGGGGG + Intronic
1091060556 11:132457518-132457540 CCTTCTATGGAGGAGGCAGGTGG + Intronic
1091265157 11:134264887-134264909 ACCTGTAAGAGGGAGGAAGGAGG - Exonic
1091340348 11:134807382-134807404 CCTTTCAAGAGGAAGACAGGAGG + Intergenic
1091782393 12:3222225-3222247 CCTGGGAAGAGGGGGGCATGTGG + Intronic
1092118624 12:6027520-6027542 TCTGATCAGAGGGAGGCAGGAGG + Intronic
1092461535 12:8691232-8691254 GCTTGGAAGATTGAGGCAGGAGG - Intronic
1092602960 12:10086960-10086982 CTTTGGAAGACCGAGGCAGGTGG + Intronic
1092612496 12:10187341-10187363 CTTTGTGAGGCGGAGGCAGGTGG - Intronic
1092621898 12:10281137-10281159 CCTTATAAAAGGGATGCAGAGGG + Intergenic
1092825917 12:12398734-12398756 TCTGGGAAGGGGGAGGCAGGTGG - Intronic
1092907189 12:13112053-13112075 CCTTATGAGAGGGAGGCAGAGGG + Intronic
1092982580 12:13811470-13811492 ACTTGGAAGACTGAGGCAGGAGG + Intronic
1093152839 12:15643654-15643676 GCTTGAAACAGGGAGGCAGAGGG + Intronic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1093386872 12:18568032-18568054 CCTTCTGAGAGGGAGGCAGGAGG - Intronic
1093404888 12:18792273-18792295 CCTTCTAAGAGGAAGGCAGGAGG - Intergenic
1093505363 12:19858956-19858978 CTTTATAAGAGAGAGGCAGAGGG + Intergenic
1093929033 12:24936811-24936833 CTTTATAAGAGAGAGGCAGAGGG - Intronic
1094526116 12:31232389-31232411 CCTCGGAGGAGGGAGGCAAGAGG - Intergenic
1095309806 12:40685241-40685263 CCTTATAAGAAGGAGGCAATGGG - Intergenic
1095447649 12:42298164-42298186 CTTTGGGAGATGGAGGCAGGTGG - Intronic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1095729688 12:45493136-45493158 CCCTGTAAGAGAGAGGCAGAGGG - Intergenic
1095755969 12:45767583-45767605 CCTTGGGAGGTGGAGGCAGGAGG + Intronic
1095865644 12:46969174-46969196 TCTTAAAAAAGGGAGGCAGGAGG - Intergenic
1095890603 12:47232232-47232254 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1095906884 12:47387809-47387831 CCTTTTAAGAGGGACCCAGAAGG + Intergenic
1096085055 12:48860019-48860041 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1096222021 12:49836260-49836282 TCTTATAATAGGGAGGCAGAGGG - Exonic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096792136 12:54051935-54051957 CCTTGTGAGAGGGAGACTGAAGG - Intronic
1096843462 12:54392489-54392511 CTTTGAGAGAGCGAGGCAGGCGG - Intergenic
1097047506 12:56198177-56198199 ACTTGGAAGACTGAGGCAGGAGG - Intergenic
1097076077 12:56395847-56395869 CTTTGGAAGATTGAGGCAGGTGG - Intergenic
1097088013 12:56483320-56483342 CTTTGGGAGGGGGAGGCAGGCGG - Intronic
1097560502 12:61199210-61199232 CCTTTCAAGAGGGAAGCAAGAGG - Intergenic
1097672742 12:62559411-62559433 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1098035766 12:66300794-66300816 CCTTGGTAGACTGAGGCAGGAGG + Intergenic
1098350687 12:69556142-69556164 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1098553223 12:71788039-71788061 ACTTGGGAGAGTGAGGCAGGAGG + Exonic
1098569677 12:71974509-71974531 CCTTATCAGAGGGAGGCAGAAGG - Intronic
1098909890 12:76198251-76198273 CCTTACAAGAGGGAGGCAGAGGG - Intergenic
1098921568 12:76306810-76306832 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
1099360170 12:81690937-81690959 CCTTATAAGAAGGAGGCAAAAGG - Intronic
1099589260 12:84566558-84566580 CCTTGTAAGAGAGAGACAAAGGG - Intergenic
1099724246 12:86404480-86404502 TCTTATAAGAGGGAGGGAGAGGG + Intronic
1099863568 12:88249648-88249670 GCTTTTAAGATGGAGGAAGGGGG + Intergenic
1099889119 12:88568401-88568423 CTTTGGAAGACAGAGGCAGGAGG - Intronic
1100146162 12:91680257-91680279 CTTTGTAAGACGAAGGCGGGCGG - Intergenic
1100347999 12:93751619-93751641 CTTTGGAAGGCGGAGGCAGGCGG + Intronic
1100453196 12:94727445-94727467 TCTTATAAGAGCGGGGCAGGAGG - Intergenic
1100547745 12:95619510-95619532 CATTGCAAGGCGGAGGCAGGTGG - Intergenic
1100660075 12:96687174-96687196 CCTTATAAGAGAAAGGCAGGAGG - Intronic
1100930137 12:99599076-99599098 CCTTATAAGAAGGAGACAGAGGG - Intronic
1100934216 12:99644943-99644965 CTTTGTAAGAGAAAGGCAGCAGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1100994450 12:100288389-100288411 CTTTGTAAAAATGAGGCAGGAGG - Intronic
1101054296 12:100896285-100896307 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1101238842 12:102817900-102817922 TCCTGACAGAGGGAGGCAGGAGG - Intergenic
1101283790 12:103287947-103287969 CATTGAAATAGGGAGGCAAGTGG - Intronic
1101338437 12:103818617-103818639 CTTTGGGAGATGGAGGCAGGCGG - Intronic
1101407677 12:104443068-104443090 TCTTGTAAGAGGGAAGCAGGAGG + Intergenic
1101756883 12:107628049-107628071 CCTGGAAAGGTGGAGGCAGGTGG - Intronic
1102055288 12:109892261-109892283 CCTGGTCAGAGGGAATCAGGAGG + Intergenic
1102240888 12:111323926-111323948 GCCTGTAAGGGTGAGGCAGGAGG + Intronic
1102314118 12:111872799-111872821 CCTTATAAGAGGCAGGCAAGAGG - Intronic
1102418713 12:112787107-112787129 CCTTATAGGAGGGAGGCTGGAGG - Intronic
1102445771 12:113001711-113001733 ACTTATAAGATGGAGGCAGGAGG - Intronic
1102448180 12:113019816-113019838 CCTTATAAGAGGGAGGAAGTGGG - Intergenic
1102495399 12:113315855-113315877 CAAGGAAAGAGGGAGGCAGGAGG - Intronic
1102557815 12:113740158-113740180 CCTTATAAAAGGGATGCAGGAGG - Intergenic
1102716979 12:114982358-114982380 CCTTGGGAGACTGAGGCAGGTGG + Intergenic
1102772107 12:115486938-115486960 CTTTATAAGAGAGAGGCAGGAGG + Intergenic
1102898700 12:116619421-116619443 CCTTGTAAGAGGGAGGAGGGAGG + Intergenic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1102924358 12:116815581-116815603 CCTTATTAGAGGAAGGCAAGAGG - Intronic
1102941020 12:116942135-116942157 ACTTGTGAGACTGAGGCAGGAGG - Intronic
1102975069 12:117200934-117200956 TCTCATAAGAGGGAAGCAGGAGG + Intergenic
1103027712 12:117587308-117587330 CCTTATAAGATGGAGGGAGGAGG + Intronic
1103114208 12:118311215-118311237 CCTTGGGAGACCGAGGCAGGTGG + Intronic
1103286485 12:119805889-119805911 CCTTGGGAGGGCGAGGCAGGTGG + Intronic
1103296980 12:119896165-119896187 TCTTTTAAGAGGGAGGCAGAGGG - Intergenic
1103533089 12:121616065-121616087 CCTTGGGAGACTGAGGCAGGCGG - Intergenic
1103552976 12:121749660-121749682 CTTTGGGAGACGGAGGCAGGTGG + Intronic
1103712261 12:122921531-122921553 CTTTGGGAGAGCGAGGCAGGTGG + Intronic
1103766267 12:123282402-123282424 ACTTGAGAGAGTGAGGCAGGAGG + Intergenic
1103840925 12:123863643-123863665 CCTTATAAGAGAAAAGCAGGAGG - Intronic
1103862596 12:124026518-124026540 CCTCCTAAGAGGGAGGCAGGTGG - Intronic
1103881857 12:124172445-124172467 CTTTATAAGAGGGAGGCCAGGGG - Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103956359 12:124579076-124579098 CCTTGTGAGAGGGAGTCAGGAGG - Intergenic
1103963849 12:124625803-124625825 TCTTATAAGAGGGAGGCAGGAGG + Intergenic
1103970809 12:124670303-124670325 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1103996386 12:124833105-124833127 CTTTGACAGAGGGAGGCAGGAGG - Intronic
1104099321 12:125591450-125591472 CCTTGTAAGAGGGAGGCAGCAGG - Intronic
1104193561 12:126508068-126508090 CTTTGAAAGACTGAGGCAGGTGG + Intergenic
1104234558 12:126921020-126921042 CCTTATAAAAGGGAGGCAAGAGG - Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104293845 12:127494027-127494049 CCTTGTAAAAGGGAAGCAGGAGG - Intergenic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1104364787 12:128167093-128167115 TCTTATAAGAGGGAAGCAGGAGG - Intergenic
1104368303 12:128198131-128198153 CTTTACAAGAGGGAGGCAGGTGG + Intergenic
1104485490 12:129148416-129148438 CCTTAAAAGAAGGAGGCAGGAGG + Intronic
1104597990 12:130132960-130132982 CCTTAGAAGAGGGAGGCAGGAGG + Intergenic
1104725399 12:131072500-131072522 CCTTTGAAGAGGGAAGCAGTAGG + Intronic
1104837713 12:131802333-131802355 ACTTGAGAGACGGAGGCAGGAGG + Intergenic
1105023723 12:132835015-132835037 CGTTGTAAGAGGGAAGCAAGAGG - Intronic
1105272379 13:18889984-18890006 CTTAAGAAGAGGGAGGCAGGTGG - Intergenic
1105619467 13:22052942-22052964 ACTTGGAAGACTGAGGCAGGAGG + Intergenic
1105843865 13:24278519-24278541 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1105882145 13:24614535-24614557 CCTGGACAGAGAGAGGCAGGTGG + Intergenic
1106032737 13:26017516-26017538 CGGTGCCAGAGGGAGGCAGGAGG + Intronic
1106334148 13:28767283-28767305 CCTTATAAAAGAGAGGCAAGAGG + Intergenic
1106389360 13:29320149-29320171 CCTTGTAAGAGAGAGGCAGGAGG + Intronic
1106474540 13:30087064-30087086 CTTTGGAAGAACGAGGCAGGAGG + Intergenic
1106670279 13:31897908-31897930 CCTTGTAAGAGGGAGGCAGGAGG - Intergenic
1106684982 13:32049155-32049177 CATTTTAAGAGGGAGGGAAGAGG + Intronic
1106730053 13:32532024-32532046 CTTAATAAGAGGGAGGCAGGAGG - Intronic
1106767493 13:32928747-32928769 CCTTGTAAATTGGAGGCAGAGGG + Intergenic
1107093726 13:36512493-36512515 CTTTGGAAGGTGGAGGCAGGTGG - Intergenic
1107238892 13:38209111-38209133 CTTTGGAAGACCGAGGCAGGTGG + Intergenic
1107489188 13:40864113-40864135 CTTTGTGAGACTGAGGCAGGAGG - Intergenic
1107583279 13:41815462-41815484 CCTTGTAGGAGGGAGAAAGAGGG + Intronic
1107630355 13:42336350-42336372 GCTTTGAAGAGGGAGGAAGGGGG + Intergenic
1107631829 13:42350621-42350643 CCTTATAAGAGGGAAGCAGAGGG + Intergenic
1107709847 13:43141043-43141065 CCTGGCAAGAGTGAGGGAGGAGG - Intergenic
1107990807 13:45817561-45817583 CCTTATACGAGGGAGGCAGAGGG + Intronic
1108121280 13:47189909-47189931 CCTTACAAGAGGTAGGCAGAGGG + Intergenic
1108239379 13:48446199-48446221 CCTTGGAAGGCTGAGGCAGGTGG - Intronic
1108456090 13:50615114-50615136 ACTTGGGAGATGGAGGCAGGAGG + Intronic
1108506304 13:51115644-51115666 CCTTCCAAGAGGCAGGGAGGTGG + Intergenic
1108527031 13:51294153-51294175 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1108557386 13:51607926-51607948 CTTTGTAAGAGGGAGGCAGAAGG + Intronic
1108557794 13:51612800-51612822 ACCTGTAAGGGGGAGGAAGGTGG - Intronic
1108564322 13:51680208-51680230 ACTTGGAAGTGAGAGGCAGGCGG - Intronic
1108592310 13:51922874-51922896 GTTTCTAAGAGGGAGGTAGGAGG - Intergenic
1108600822 13:51993322-51993344 CTTTGGGAGGGGGAGGCAGGAGG + Intronic
1108701764 13:52949863-52949885 CCTGCTCAGAGGGAGGAAGGTGG + Intergenic
1108848396 13:54701302-54701324 CCTTGGAGAAGAGAGGCAGGAGG - Intergenic
1109242411 13:59905716-59905738 CCTTATAAGAGGGAAGCAGGAGG + Intronic
1109384953 13:61616169-61616191 CCTTGTAAGAGATAAGCAGAGGG + Intergenic
1110441985 13:75536539-75536561 CCTTATAAGAGGGAGGAAAAAGG + Intronic
1110464247 13:75782814-75782836 CCTTATGAGAGGGAGGAAGAGGG - Intronic
1110597772 13:77337969-77337991 TCTGATAAGAGGGAGGCAGGCGG + Intergenic
1110872818 13:80472282-80472304 CTTTGAGAGAAGGAGGCAGGTGG + Intergenic
1110885715 13:80632057-80632079 CTTTGGGAGACGGAGGCAGGAGG - Intergenic
1110968852 13:81735603-81735625 CCTTGTAAGAGAAAGGTAGAGGG + Intergenic
1111131620 13:83984138-83984160 CTTTGGAAGATGGAGGCGGGCGG - Intergenic
1111368226 13:87279097-87279119 ACTTGGGAGATGGAGGCAGGAGG - Intergenic
1111820616 13:93209346-93209368 CCTTATAAGAAGGAAGTAGGAGG - Intergenic
1112024533 13:95400194-95400216 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1112082679 13:95991911-95991933 CCTTGGGAGACCGAGGCAGGCGG + Intronic
1112099817 13:96176070-96176092 CCTTGAGAGGCGGAGGCAGGTGG - Intronic
1112175848 13:97023216-97023238 CCTTATAAGAGGGAGGCAGCAGG + Intergenic
1112443227 13:99440275-99440297 TCATGTGAGAGGGAGACAGGGGG + Intergenic
1112977721 13:105341514-105341536 CCTTAGAAGAGAGAGGCAGAGGG - Intergenic
1113106187 13:106773917-106773939 CCTTTTAAGAGGGAGGGAAAGGG + Intergenic
1113187162 13:107701496-107701518 CCAGGTATGAGGGAGGGAGGAGG + Intronic
1113472411 13:110556272-110556294 CCTTAGAAGAGGGAAGCAGAGGG + Intronic
1114169252 14:20255082-20255104 CCTTATTAGAGAGAGGCAGGAGG - Intergenic
1114352652 14:21870361-21870383 GCTTATAATAGGGAGGCAGAGGG - Intergenic
1114658370 14:24329533-24329555 CCTGGAAGGAGGGAGGCAGTAGG + Exonic
1115255586 14:31397765-31397787 CCTCGGAAGACTGAGGCAGGAGG - Intronic
1115816544 14:37170275-37170297 CTTTGTGAGGCGGAGGCAGGCGG - Intronic
1115936156 14:38555059-38555081 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1116539529 14:46082169-46082191 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
1116603193 14:46954624-46954646 TCTTATAAGAGAGAGGCAGGGGG - Intronic
1116664478 14:47757665-47757687 CTTTGGAAGACTGAGGCAGGGGG + Intergenic
1116903844 14:50386679-50386701 CCTTGGGAGACCGAGGCAGGAGG + Intronic
1117105952 14:52397200-52397222 TTTTATAAGAGGGAGGTAGGTGG + Intergenic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117723518 14:58649582-58649604 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1117891902 14:60431080-60431102 GCTTATAAAAGGGAGGCAGTGGG + Intronic
1117961908 14:61171632-61171654 CCAGGAAAGAAGGAGGCAGGAGG - Intergenic
1118009234 14:61592477-61592499 TCTTATAAGAGGGAGGCAGGTGG - Intronic
1118126591 14:62911789-62911811 CACTTTAGGAGGGAGGCAGGTGG + Intronic
1118247852 14:64129062-64129084 CCTTGGGAGACTGAGGCAGGTGG + Intronic
1118377919 14:65192874-65192896 CCTTATCAGAGAGAGGCAGGAGG + Intergenic
1118467286 14:66042497-66042519 GCTTATAAGGGAGAGGCAGGGGG - Intergenic
1118570366 14:67188932-67188954 CTTTGGAAGAGCAAGGCAGGAGG - Intergenic
1118665687 14:68066676-68066698 ACTTGGGAGAGTGAGGCAGGAGG + Intronic
1118885777 14:69864793-69864815 CCTTATAAGAGAGAGGCAAGAGG + Intronic
1119201953 14:72760383-72760405 TCTTATAAAAGGAAGGCAGGAGG - Intronic
1119269021 14:73285089-73285111 CCTTGAGAGGCGGAGGCAGGTGG - Intronic
1119358172 14:74024571-74024593 ACTTGGAAGACTGAGGCAGGAGG - Intronic
1119512580 14:75223051-75223073 ACTTGCAAGACTGAGGCAGGAGG - Intergenic
1119677673 14:76568001-76568023 CCTTATAAGAGAAAGGCAGGAGG + Intergenic
1119689604 14:76661263-76661285 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
1119693199 14:76692748-76692770 TCTTCAAAGAGGGAGGCAGAGGG - Intergenic
1120039659 14:79738279-79738301 CCTTATAAGAGTGAGGCAGAGGG + Intronic
1120195758 14:81480478-81480500 CTTTGGGAGAGCGAGGCAGGAGG + Intronic
1120202464 14:81552953-81552975 TCTTATAAGAGGGAAGCAGGAGG + Intergenic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120282535 14:82457266-82457288 CCTTATAAGAGGGATACAGAGGG + Intergenic
1120305389 14:82763327-82763349 CCTTGGAAGAGTTAGGCCGGGGG - Intergenic
1120330873 14:83091800-83091822 CCTGGTAAGAGTGATGCAAGGGG - Intergenic
1120503598 14:85326591-85326613 CCTTTTAAGAGGGAGGCAAGAGG + Intergenic
1120697957 14:87665394-87665416 TTTTATAAGAGGGAGCCAGGTGG + Intergenic
1120705576 14:87742008-87742030 CATTGTAAAAGGCAGGCAGGAGG - Intergenic
1120758412 14:88265317-88265339 TCTTATAAGAAGGAAGCAGGAGG + Intronic
1120846116 14:89126392-89126414 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
1121073606 14:91047942-91047964 TCTTGTAAGAGGGAGACAGGAGG - Intronic
1121270795 14:92636804-92636826 CTTTGGGAGAAGGAGGCAGGAGG + Intronic
1121346843 14:93142401-93142423 ACTTGAAAGACTGAGGCAGGAGG + Intergenic
1121418970 14:93799001-93799023 TCTTGAAAGAGGGAGGGAGAGGG - Intergenic
1121533902 14:94677954-94677976 CCTTGTAGGAGGGAGCCTGCAGG - Intergenic
1121615358 14:95310385-95310407 CCTTATAAGAAGGAAGCAGGAGG - Intronic
1121742653 14:96264945-96264967 CCTTATAGGAGGGAGGCAGGAGG + Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1121800539 14:96770457-96770479 CCTTATAAGAGAGAGGCAAGAGG + Intergenic
1121902223 14:97704081-97704103 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
1121908539 14:97768749-97768771 CCTTGTAAGAGGGAGGAAAGGGG + Intergenic
1121917041 14:97844709-97844731 CTTTGTAAAAGGAAGGAAGGAGG + Intergenic
1122147752 14:99703337-99703359 CATTGGAGGAGGGAGACAGGAGG - Intronic
1122206448 14:100150290-100150312 CTGGGTAAGAGGGAGGCAGTGGG - Intronic
1122448662 14:101785562-101785584 CATTACAAGAGGGAGGCAGGAGG - Intronic
1122483064 14:102060242-102060264 CCTTATAAGAGAAAGGCAGAAGG + Intergenic
1122550533 14:102546708-102546730 CTTTGGGAGACGGAGGCAGGTGG + Intergenic
1123099276 14:105785134-105785156 ACTTGGAAGAGTGAGGCAGGAGG - Intergenic
1123208395 14:106735941-106735963 CCATGGATGAGGGAGGCAGGTGG + Intergenic
1202941666 14_KI270725v1_random:154097-154119 CTTTGGAAGGTGGAGGCAGGCGG + Intergenic
1123630474 15:22257290-22257312 CGGTGTAAGAGGGAGGTAGTGGG - Intergenic
1123676171 15:22712142-22712164 CTTTGGGAGACGGAGGCAGGTGG + Intergenic
1124159567 15:27256101-27256123 CTTTGTAAGAGGGAGGCAAGAGG + Intronic
1124349729 15:28946324-28946346 CCTTATAAGAAGGAAGCTGGAGG + Intronic
1124642773 15:31406896-31406918 CCTCATAAGAGGGAGGCGAGAGG - Intronic
1125214824 15:37259550-37259572 CCTTACAAGAGGGAGGCAGAAGG - Intergenic
1125242861 15:37596733-37596755 CCTTTTTAGAGAGAGGCAGTTGG - Intergenic
1125269997 15:37928532-37928554 TTTTATAAGAGGGAGGCAGGAGG + Intronic
1125356314 15:38820407-38820429 CACTGAAAGAGGGAGGCAGGAGG - Intergenic
1125387295 15:39151886-39151908 CTCCATAAGAGGGAGGCAGGAGG - Intergenic
1125391719 15:39199782-39199804 CCTTATAAGAGGAAGACAAGAGG - Intergenic
1125747761 15:42008706-42008728 CCTGGGAGGAGGGAGGCAGAGGG + Intronic
1126055373 15:44725121-44725143 ACTTGGAAGGCGGAGGCAGGAGG + Intergenic
1126074971 15:44900384-44900406 CCTTGTAAGAGGGAGATAGAGGG + Intergenic
1126083393 15:44987432-44987454 CCTTATAAGAGGGAGATAGAGGG - Intergenic
1126117659 15:45223505-45223527 TCTTGTAAGAGAAAGGCAGAGGG - Intergenic
1126157761 15:45581444-45581466 CTTTGTGAGACCGAGGCAGGCGG + Intergenic
1126324680 15:47463973-47463995 CCTTATGAGAGAGAGGCAGAGGG - Intronic
1126369182 15:47927655-47927677 CCTTGTAAGAATGATACAGGAGG - Intergenic
1126518851 15:49565818-49565840 CCTTGTAAGAGGGCAGCTGAGGG + Intronic
1126564898 15:50084836-50084858 CCTTATCAGAGGGAGGCAGGAGG - Intronic
1126589027 15:50320713-50320735 TCTTATAAGAGGGAGACAGGAGG + Intronic
1127102778 15:55584352-55584374 CCTTGGAAGGCTGAGGCAGGTGG - Intronic
1127495649 15:59509526-59509548 CCTTATAAGAGGGAGGCAATAGG + Intronic
1127718733 15:61678634-61678656 CCTTATAAGAGAAAGACAGGAGG + Intergenic
1128543627 15:68553364-68553386 CTTTGTAACAGGGAGGCAGGAGG + Intergenic
1128612526 15:69085315-69085337 CCTTATAAGAGGGAGCTAGGAGG + Intergenic
1128633532 15:69288284-69288306 CCTTTTAAGAAGGAGGCAGGAGG - Intergenic
1128878859 15:71224806-71224828 CCTTATAAGTGGGAGGTAGGAGG - Intronic
1129118934 15:73383183-73383205 CCTTATAAGAGGGAGACAGAGGG + Intergenic
1129347853 15:74935489-74935511 ACTTGGAAGGTGGAGGCAGGAGG + Intronic
1129350896 15:74955557-74955579 CGTTGACAGAGGAAGGCAGGGGG - Exonic
1129433638 15:75520019-75520041 CCTTGGGAGACAGAGGCAGGAGG + Intronic
1129532811 15:76282209-76282231 CCTTATAAGAGGGACACAGAAGG + Intronic
1129669397 15:77598730-77598752 GCTGGTAAGAGGGAAGCCGGAGG + Intergenic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1129713110 15:77831502-77831524 CTTTGGGAGATGGAGGCAGGTGG - Intergenic
1129736859 15:77971349-77971371 CCTTGGGAGACTGAGGCAGGCGG + Intergenic
1129908059 15:79203629-79203651 CCCCATAAGATGGAGGCAGGTGG - Intergenic
1130019255 15:80213494-80213516 CCTTATAAGAGAGAGGCAGTGGG + Intergenic
1130067560 15:80617284-80617306 CCTCATAAGGGGAAGGCAGGAGG - Intergenic
1130159497 15:81384631-81384653 CCTTATAAGAGGGATGAAGGAGG + Intergenic
1130181499 15:81633916-81633938 TCTTAGAAGAGGGAGGCAGAAGG + Intergenic
1130196318 15:81783237-81783259 TCTTGTAAGAGGGACACAGGAGG + Intergenic
1130710081 15:86271390-86271412 CCTTGTGAAAGGGAGGTAGAGGG - Intronic
1130977311 15:88787372-88787394 CCTTATAAGAGAGAGGTAGAGGG - Intergenic
1130992555 15:88884776-88884798 CCTGTTTAGAGGGAGGCAGAGGG + Intronic
1131007743 15:88992173-88992195 CCTAGGAAGAGGGAGTTAGGAGG + Intergenic
1131042899 15:89288882-89288904 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1131233842 15:90679765-90679787 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1131238686 15:90719232-90719254 CCTTGGGAGGCGGAGGCAGGCGG - Intronic
1131379671 15:91953609-91953631 CCTGGTATGATGGAGGCAGTTGG + Intronic
1131424912 15:92337954-92337976 CCTTACAAAAGGGTGGCAGGAGG - Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131785119 15:95904295-95904317 CTTTGGAAGACAGAGGCAGGTGG + Intergenic
1131948156 15:97650986-97651008 CTTTGGAAGACAGAGGCAGGAGG + Intergenic
1132155020 15:99489585-99489607 CCTTATGAGAGGGAGGCAGGAGG - Intergenic
1132512536 16:351661-351683 CCTTGGAAGGCTGAGGCAGGTGG + Intronic
1132570802 16:643071-643093 CTTTCTGAGAGGTAGGCAGGGGG - Intronic
1132743691 16:1428165-1428187 CCTTGTTGGAGGGAGGCAGGAGG - Intergenic
1133105083 16:3502197-3502219 CTTTGGAAGACCGAGGCAGGCGG + Intronic
1133205057 16:4228193-4228215 CTTTGGAAGACTGAGGCAGGTGG + Intronic
1133213624 16:4277106-4277128 CTTTGGAAGACCGAGGCAGGAGG + Intergenic
1133309763 16:4837190-4837212 CCTTGGGAGACCGAGGCAGGTGG + Intronic
1133407577 16:5537661-5537683 GCTTTGAAGATGGAGGCAGGAGG - Intergenic
1133734238 16:8601973-8601995 CCTTCTAAGAGGCAGGTAAGAGG - Intergenic
1133852200 16:9516041-9516063 CCTTGTAAGAGTGAGGCAGAGGG + Intergenic
1134005542 16:10816710-10816732 CCTTATAAGAAAGAGGCACGGGG + Intronic
1134053305 16:11152786-11152808 CAGTGTCAGAGGGAGGCTGGAGG - Intronic
1134240143 16:12499918-12499940 CTTTGTGAGACTGAGGCAGGTGG - Intronic
1134348636 16:13415426-13415448 CCTTATTGGAGGGAGGAAGGTGG + Intergenic
1134393267 16:13839450-13839472 CCTTGTAAGATGGTGACAGTGGG - Intergenic
1134482626 16:14632404-14632426 CTTTGTAAGGCTGAGGCAGGAGG + Intronic
1134636604 16:15796729-15796751 CCTTATAAGAGAGAGGTAGGGGG + Intronic
1134788850 16:16970071-16970093 TCTTATAAGAGGATGGCAGGAGG + Intergenic
1135029826 16:19029616-19029638 CCTTGGAAGGCCGAGGCAGGAGG - Intronic
1135085061 16:19468627-19468649 CTTTATAAGAGGCAGGCAGGAGG + Intronic
1135314656 16:21434329-21434351 CCTTGGGAGGGTGAGGCAGGAGG + Intronic
1135353094 16:21746485-21746507 CCTTTTAAGAAGGAGCAAGGAGG + Intronic
1135367579 16:21866609-21866631 CCTTGGGAGGGTGAGGCAGGAGG + Intronic
1135444235 16:22504553-22504575 CCTTGGGAGGGTGAGGCAGGAGG - Intronic
1135451581 16:22562608-22562630 CCTTTTAAGAAGGAGCAAGGAGG + Intergenic
1135731199 16:24896384-24896406 ACTTGAAAGACTGAGGCAGGAGG + Intronic
1135884651 16:26295045-26295067 CCTTTTAAGAGGGAGGCGGGAGG - Intergenic
1136058250 16:27706756-27706778 GCTTGTTGGTGGGAGGCAGGAGG - Intronic
1136275192 16:29175634-29175656 CCTTGTAGGAGGGAGGCGGGAGG + Intergenic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1136311321 16:29413011-29413033 CCTTGGGAGGGTGAGGCAGGAGG + Intergenic
1136324769 16:29514804-29514826 CCTTGGGAGGGTGAGGCAGGAGG + Intergenic
1136439454 16:30254789-30254811 CCTTGGGAGGGTGAGGCAGGAGG + Intergenic
1136489223 16:30594781-30594803 CCTTATAAAAGGGAGGCAAGAGG + Intergenic
1137254561 16:46764273-46764295 ACTTGGAAGGGTGAGGCAGGAGG + Intronic
1137941911 16:52696198-52696220 CCTTCTAAGAATGAGGCAGAGGG - Intergenic
1137984392 16:53095300-53095322 CTTTGGGAGGGGGAGGCAGGAGG + Intronic
1138197129 16:55059917-55059939 CCTCATACGAGGGAGGCAGAAGG + Intergenic
1138624753 16:58241909-58241931 CCTTACAAGAGGGAGGCAGAAGG - Intronic
1138626971 16:58260158-58260180 CCTTATCAGTGGGAAGCAGGAGG + Intronic
1138649913 16:58454064-58454086 AAGTGGAAGAGGGAGGCAGGAGG - Intergenic
1138661221 16:58518486-58518508 CTTTGTGATAGGGAGGGAGGAGG + Exonic
1138831053 16:60374837-60374859 CCTTGCAAGAAGGAGGCATGAGG + Intergenic
1139084776 16:63571528-63571550 CCTTGTCAGAGGGAGGCAGAAGG + Intergenic
1139413433 16:66785284-66785306 CTTTGGAAGACTGAGGCAGGCGG - Intronic
1139509656 16:67419876-67419898 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1139767971 16:69248388-69248410 CTTTGGGAGACGGAGGCAGGTGG + Intronic
1139858841 16:70003937-70003959 CCTTGGGAGGGTGAGGCAGGAGG + Intergenic
1139885960 16:70207089-70207111 CCTTGGGAGGGTGAGGCAGGAGG + Intergenic
1139999194 16:71009701-71009723 CCTTATATGAGGGAGGCAGAGGG + Intronic
1140029608 16:71324928-71324950 TCTTGTAAGAGGAAGACAGTCGG + Intergenic
1140198812 16:72878072-72878094 ACTTGGAAGACTGAGGCAGGAGG + Intronic
1140235285 16:73153366-73153388 CTTTGGGAGACGGAGGCAGGAGG - Intergenic
1140264893 16:73412080-73412102 ACTTGGGAGAGCGAGGCAGGTGG + Intergenic
1140377288 16:74454773-74454795 CCTTGGGAGACCGAGGCAGGAGG - Intronic
1140422992 16:74836052-74836074 CCTTCTAAGAAGGAGGCAGGAGG - Intergenic
1140575275 16:76160528-76160550 CAGTAGAAGAGGGAGGCAGGAGG - Intergenic
1140598279 16:76442129-76442151 CCTTATAAAAGGGAAGTAGGAGG + Intronic
1140735629 16:77895469-77895491 CTATGTAAGAGAGAGGCAGGAGG + Intronic
1140743726 16:77963284-77963306 TTTTCAAAGAGGGAGGCAGGAGG + Intronic
1140759016 16:78094636-78094658 GCCTGTCAGAGGGAGGCAGGAGG - Intergenic
1140782262 16:78307422-78307444 TCTTATGAGAGGGAGGCAGAGGG + Intronic
1140904418 16:79398213-79398235 CCTTATAAGAAAGTGGCAGGAGG - Intergenic
1140934951 16:79661870-79661892 CCACATAAGAGGGAGGCAGGAGG - Intergenic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141005832 16:80350703-80350725 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1141029104 16:80572273-80572295 CCTTAGGAAAGGGAGGCAGGAGG + Intergenic
1141041167 16:80673856-80673878 CCTTGTAAGAGGGAGGCAGGGGG + Intronic
1141159278 16:81618339-81618361 ACTCACAAGAGGGAGGCAGGAGG - Intronic
1141187859 16:81800877-81800899 CCTTGCAGGAGGGAGGCAGGAGG + Intronic
1141222074 16:82080373-82080395 CCTTATAAGAAAGAGGCATGAGG + Intronic
1141269195 16:82523380-82523402 TCTTATAAAAGGGAGGGAGGAGG - Intergenic
1141444134 16:84047303-84047325 CCTTCTAACACGGATGCAGGAGG + Intergenic
1141490788 16:84371271-84371293 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1141551094 16:84807214-84807236 CCTTGTAAGAGGGAGGCCAGAGG - Intergenic
1141683056 16:85555279-85555301 CCTGGGCAGAAGGAGGCAGGAGG - Intergenic
1141747513 16:85935710-85935732 CGTTGTGAGAGGGAGGCAGGAGG + Intergenic
1141972616 16:87493357-87493379 CGGTGTAAGAGGGAGGTAGTGGG + Intergenic
1142000423 16:87661203-87661225 CCTTGTAAGAGGGAGGCAGGAGG - Intronic
1142079551 16:88141702-88141724 CCTTGTAGGAGGGAGGCGGGAGG + Intergenic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142104956 16:88297698-88297720 CCTCATAAGAGGGAGGCAGAGGG - Intergenic
1142160386 16:88554557-88554579 CCTCGTAAGAGGCGGGCAGCAGG - Intergenic
1142409344 16:89908144-89908166 GCTGGGAGGAGGGAGGCAGGAGG - Intronic
1203142777 16_KI270728v1_random:1779425-1779447 CTTTGGGAGATGGAGGCAGGCGG + Intergenic
1142773864 17:2120474-2120496 CTTTGGACGAGTGAGGCAGGAGG + Intronic
1142787738 17:2237536-2237558 CCTTGTGAGAGGGAGGAGGACGG - Intronic
1143297512 17:5882592-5882614 CCTTATAAGACGGGGGCAGAGGG - Intronic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1143368040 17:6421154-6421176 CCTTATAAGAGGGAGACAGGAGG + Intronic
1143392328 17:6566883-6566905 CTTTGGGAGAGCGAGGCAGGCGG + Intergenic
1143409266 17:6698613-6698635 CTTTGTAACAGGGAAGTAGGGGG - Intronic
1143893086 17:10117258-10117280 CCTTATGAGAGGGAGGCAGGAGG - Intronic
1143943112 17:10563911-10563933 CCTTGGGAGACCGAGGCAGGTGG - Intergenic
1144468893 17:15519361-15519383 CTTTGGAAGGGTGAGGCAGGAGG + Intronic
1144588785 17:16506076-16506098 CCTTAGAAGATGGGGGCAGGAGG - Intergenic
1144764670 17:17725852-17725874 CCTTTTGAGAGGGAGGGGGGCGG + Intronic
1144946214 17:18970927-18970949 TCTTGTGAGATGAAGGCAGGGGG + Exonic
1145048522 17:19639527-19639549 CTTTGGGAGATGGAGGCAGGAGG + Intergenic
1145218428 17:21069416-21069438 CCTCATAAGAGGGGGGCAGGAGG + Intergenic
1145275954 17:21430606-21430628 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145313800 17:21716519-21716541 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145712242 17:26988493-26988515 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145814777 17:27787826-27787848 TCTGGAAAGAGAGAGGCAGGTGG + Exonic
1145848000 17:28060513-28060535 CTTTGGAAGACGGAGGCAGGAGG - Intronic
1145932853 17:28698362-28698384 CCTGGTGAGGGTGAGGCAGGTGG - Intronic
1146290189 17:31601170-31601192 CTTTATAAGAGGGAGGCAGGAGG + Intergenic
1146299551 17:31677584-31677606 CCTTATAAGAAGGAGCCAGGAGG - Intergenic
1146324518 17:31874300-31874322 ACTTTAAAGACGGAGGCAGGCGG + Intronic
1146482002 17:33212294-33212316 CCTTGTAAGAGGGAGGCAGAAGG + Intronic
1146510988 17:33448477-33448499 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1146515244 17:33483933-33483955 CCTTGGAAGAGGGAGACAGGAGG + Intronic
1146839233 17:36138364-36138386 TGTTGTAAGAGGGACCCAGGGGG - Intergenic
1146911726 17:36652781-36652803 CTTTGGAAGGTGGAGGCAGGCGG - Intergenic
1146959914 17:36965386-36965408 CCTTATAAGAGGAAGGCAATAGG - Intronic
1147009487 17:37433548-37433570 ACTTGTATGGTGGAGGCAGGAGG + Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1147141787 17:38464570-38464592 CCTGGGGAGAGGGAGGAAGGAGG + Intronic
1147166567 17:38596564-38596586 CCTGGCATGAAGGAGGCAGGCGG - Intronic
1147197449 17:38777003-38777025 CCTTGGAAGGGTGAGGCAGGAGG - Intronic
1147201838 17:38807511-38807533 CTTTGGGAGACGGAGGCAGGAGG + Intronic
1147209647 17:38864921-38864943 CCTTACAAGAGGGAGGCAGGAGG + Intergenic
1147279776 17:39349477-39349499 CCTTGGAAGGTTGAGGCAGGAGG + Intronic
1147372929 17:40006121-40006143 CTTTGTGAGACCGAGGCAGGTGG - Intergenic
1147871828 17:43592855-43592877 CTTTGGAAGACGGAGGCAGGCGG + Intergenic
1148045904 17:44744166-44744188 CTTTGGAAGACTGAGGCAGGTGG + Intronic
1148222013 17:45869731-45869753 CCTTGTAAGAGGCACGCAGGAGG + Intergenic
1148371915 17:47106343-47106365 CCTTATCAGAGGGAGGCAGTGGG - Intergenic
1149391491 17:56196021-56196043 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
1149419622 17:56496618-56496640 TCTTATAAGAGTGAGGCAGAGGG - Intronic
1149445723 17:56711892-56711914 CCTTGGAAGACTGAGGAAGGAGG - Intergenic
1149469650 17:56905712-56905734 CCTTGGGAGACCGAGGCAGGAGG + Intronic
1149675012 17:58452000-58452022 CTTTGTGAGACTGAGGCAGGAGG + Intronic
1149818132 17:59747312-59747334 CATTGGGAGAGGGAGGCAGGGGG + Intronic
1149909718 17:60555971-60555993 CTTTGGAAGGCGGAGGCAGGAGG - Intergenic
1149911971 17:60574997-60575019 CTTTGTAAGAGGAAAGCAGAAGG + Intronic
1149921982 17:60668671-60668693 CTTTGGAAGACCGAGGCAGGTGG + Intergenic
1149988994 17:61369945-61369967 CCTCGGAAGAGGGAGGCTGCCGG - Intronic
1150050101 17:61953463-61953485 CCTAATAAGAGGGAGGCAGTAGG + Intronic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150075631 17:62189442-62189464 CCTTATAACCTGGAGGCAGGTGG + Intergenic
1150091507 17:62329906-62329928 ACTTGGGAGAGTGAGGCAGGTGG + Intergenic
1150282529 17:63937739-63937761 ACTTGGAAGACCGAGGCAGGAGG + Intergenic
1150304632 17:64073885-64073907 CCTTGGGAGGGTGAGGCAGGAGG - Intronic
1150339613 17:64356023-64356045 CCTTGTAAGAGGGAGTTGGGGGG - Intronic
1150417057 17:64996237-64996259 CTCTGTAAGAGGGAGACAGAGGG + Intergenic
1150459055 17:65331931-65331953 CTTTATAAGAGGGAGACGGGAGG + Intergenic
1150480793 17:65508096-65508118 CTTTGAAAGACTGAGGCAGGTGG + Intergenic
1150718424 17:67592927-67592949 ACTTGTGAGACTGAGGCAGGAGG + Intronic
1150744654 17:67806760-67806782 ACTTGTGAGACGGAGGTAGGAGG - Intergenic
1150794609 17:68227686-68227708 CTCTGTAAGAGGGAGACAGAGGG - Intergenic
1150934508 17:69620611-69620633 TCTTGTAAGAGGAAGGCAGTAGG - Intergenic
1151192478 17:72408505-72408527 CTTTATAAGAGAGAGGCAGAGGG + Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151752550 17:76048499-76048521 CCTGAGAAGAGGGAGGCAGATGG + Intronic
1151867395 17:76813117-76813139 TCTTGTAAGAGGGAAGCAGGAGG + Intergenic
1152057200 17:78039319-78039341 CCTGGTAAGAGGTAGGGAGTGGG - Intronic
1152075555 17:78157553-78157575 CTTTGGAAGACCGAGGCAGGCGG + Intronic
1152148124 17:78581482-78581504 CCTTGTAAGAGAGAGACAAAGGG - Intergenic
1152174622 17:78779632-78779654 CTTAATAAGAGGGAGGTAGGAGG + Intronic
1152246688 17:79188226-79188248 CCCTGGCAGAGGGAGGCAGAGGG - Intronic
1152396696 17:80037133-80037155 CCTTGCAGGAGGGAGGCGCGGGG - Intronic
1152987478 18:333935-333957 CTTTGCAAGACTGAGGCAGGAGG + Intronic
1153003807 18:480068-480090 CCTTGTAAGAGAGAGGCAGAGGG - Intronic
1153142497 18:1989794-1989816 TCTTATAAGAGAGAGGCAGAGGG - Intergenic
1153195403 18:2590568-2590590 CCTTATAAGATAGAGGCAGAGGG - Intronic
1153260677 18:3221261-3221283 CTTTGTGAGACTGAGGCAGGTGG - Intergenic
1153304577 18:3620169-3620191 CCTTATAAGAGGGAGGCAGGAGG + Intronic
1153322414 18:3786080-3786102 TCTTATAAAAGGGAGGCAGGAGG - Intronic
1153382005 18:4450816-4450838 CCTAGGGAGAGGGAGGAAGGTGG + Intronic
1153435205 18:5061635-5061657 CCATATAAGAGGGAGACAGGAGG - Intergenic
1153505282 18:5790486-5790508 CCTTGTAAGAGGGAGCCAGGAGG + Intergenic
1153685956 18:7545542-7545564 CTTTATAAGAGAGAGGCAGAGGG - Intergenic
1153780518 18:8491430-8491452 CCTTATGAGAGGAAGGCAGGAGG + Intergenic
1153842413 18:9018670-9018692 CCTTCTAAGGGGGAGGCAGAAGG + Intergenic
1153939660 18:9967384-9967406 ACCTGTAACAGGAAGGCAGGAGG - Intergenic
1154035998 18:10802724-10802746 CTTTGGAAGACCGAGGCAGGCGG + Intronic
1154088095 18:11327064-11327086 CCTTATAAGAAGGAGGCAAAAGG + Intergenic
1154137022 18:11788626-11788648 CTTTGGAAGACGGAGGCAGGCGG + Intronic
1154156922 18:11951113-11951135 CCTTCAGAGAGGGAGGCGGGAGG + Intergenic
1154240493 18:12649166-12649188 CTTTGTGAGACTGAGGCAGGTGG + Intronic
1154271401 18:12923440-12923462 CTTTGGAAGACCGAGGCAGGTGG + Intronic
1154272362 18:12931262-12931284 CCTTGTAAGGGGGTTGCAGGAGG - Intergenic
1154301866 18:13201250-13201272 CCTTATAGGAGGGAAGCAAGAGG - Intergenic
1154393623 18:13966988-13967010 CTTTGGAAGACTGAGGCAGGTGG + Intergenic
1154464159 18:14627568-14627590 CTTAAGAAGAGGGAGGCAGGTGG - Intergenic
1154983287 18:21522227-21522249 CCTTGGAAGGCCGAGGCAGGTGG + Intronic
1155201429 18:23521096-23521118 CTTTGGGAGAGCGAGGCAGGCGG - Intronic
1155437021 18:25824189-25824211 GCTTTGAAGATGGAGGCAGGGGG - Intergenic
1155498219 18:26463210-26463232 CTTTGGAAGGTGGAGGCAGGAGG + Intronic
1155498372 18:26464351-26464373 CCTTATTTGAGGGAGGCAGGAGG - Intronic
1155865324 18:30957648-30957670 CCTTCTAAGAAAGAGGCAAGAGG + Intergenic
1155888519 18:31237922-31237944 CTTTGTAAGGCTGAGGCAGGAGG - Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156271534 18:35538266-35538288 CTTTATGAGAGGGAGGCAGTGGG - Intergenic
1156299243 18:35821188-35821210 TTTTATAAGAGGGAGGCAGACGG + Intergenic
1156841124 18:41610701-41610723 CATTCTAAGAGAGAGGCAAGAGG - Intergenic
1156914886 18:42454129-42454151 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1157242698 18:46025996-46026018 CTTTGAAAGGGTGAGGCAGGTGG - Intronic
1157368206 18:47085857-47085879 TTTTGTAAGACTGAGGCAGGAGG + Intronic
1157658789 18:49420410-49420432 CCTTGGGAGACCGAGGCAGGTGG - Intronic
1157717973 18:49902266-49902288 CCTCCTAAGAGGGAGGCTGGAGG - Intronic
1157870425 18:51225396-51225418 CCTCATAAGAGGAAGTCAGGAGG + Intergenic
1158310243 18:56150545-56150567 CCTTATAAAAGGGATACAGGAGG - Intergenic
1158364788 18:56721552-56721574 CTTCGTAAGAGGGAAGCAAGAGG - Intronic
1158453109 18:57584246-57584268 ACTTGGAAGACTGAGGCAGGAGG + Intronic
1158534632 18:58296608-58296630 CCTTGTAAGAGAGATGCAGAAGG - Intronic
1158708674 18:59817697-59817719 CTTTGGAAGAGTGAGGCTGGAGG + Intergenic
1158774316 18:60557804-60557826 CCCTATAAGAGAGAGACAGGAGG - Intergenic
1158998483 18:62948079-62948101 CCTTGGGAGACTGAGGCAGGTGG + Intronic
1159103217 18:63978017-63978039 CCTTAAAAGAGAGAGGCAGGAGG - Intronic
1159180083 18:64891973-64891995 CCTTACAAGAGGAAGGCAGGGGG + Intergenic
1159449676 18:68584287-68584309 CCTGGCAAGAGGGAGGCTGAGGG - Intergenic
1160115355 18:76074165-76074187 CCTAAGAAGAGGGAGGCAGAGGG - Intergenic
1160196981 18:76763780-76763802 CTTTGGAAGGAGGAGGCAGGAGG - Intergenic
1160265276 18:77336446-77336468 CCTTCTAAGAGGGAGGCAGCAGG + Intergenic
1160415833 18:78709963-78709985 ACCTGTAAGAGGGAGGAAGTGGG + Intergenic
1160421329 18:78748448-78748470 ACTTGGGAGACGGAGGCAGGAGG - Intergenic
1160592968 18:79954150-79954172 CTTTGTAAGAGGGAGGCAGAAGG + Intergenic
1160984511 19:1832098-1832120 CCTTTAAAGAGGGAGGCAGGAGG + Intronic
1161347904 19:3777283-3777305 CCATGAATGGGGGAGGCAGGAGG + Intergenic
1161352983 19:3804044-3804066 CCTGGAAATTGGGAGGCAGGGGG - Exonic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1161908131 19:7172787-7172809 CCTTGGGAGGGCGAGGCAGGTGG + Intronic
1161953713 19:7481571-7481593 CCTTATAGGAGGGAGGAAGGAGG + Intronic
1162175324 19:8825954-8825976 CCTTATAAAAGGGAAACAGGAGG + Intronic
1162288618 19:9760952-9760974 CTTTGGGAGACGGAGGCAGGTGG + Intronic
1162594086 19:11613597-11613619 CTTTGGGAGATGGAGGCAGGAGG - Intronic
1162761027 19:12888143-12888165 CATTGGAAGACTGAGGCAGGAGG + Intergenic
1162917648 19:13882849-13882871 CCTTGGAAGGGTAAGGCAGGGGG + Exonic
1162982048 19:14246777-14246799 CTTTGGAAGACCGAGGCAGGTGG + Intergenic
1163486475 19:17590195-17590217 CCTTAGAAGAGGGAGACAAGAGG - Intergenic
1163786616 19:19277983-19278005 TCTGGTGAGAGGGAGGCAGATGG - Intronic
1163852179 19:19670350-19670372 TCTTGGAAGACTGAGGCAGGAGG - Intronic
1163874752 19:19858625-19858647 CTTTGGAAGAGTGAGGCAGGTGG + Intergenic
1164165257 19:22668135-22668157 CTTTGGAAGATTGAGGCAGGTGG - Intergenic
1164505228 19:28854689-28854711 CCTCATAGGAGGGAGGCAGGAGG + Intergenic
1164892274 19:31834536-31834558 CCTTGGCAGAGAGAGGGAGGGGG - Intergenic
1165552751 19:36602683-36602705 CTTTGTGAGACTGAGGCAGGTGG + Intronic
1165590990 19:36969709-36969731 CCTTAAAAGAGGAAGGCAGGAGG - Intronic
1165747220 19:38237029-38237051 CCCTTTAAGAGGGAGGCAGAGGG - Intergenic
1165999367 19:39869165-39869187 CCTTATAAGAGAGAAGCAGAGGG + Intronic
1166092408 19:40518665-40518687 CTTTGGAAGACGGAAGCAGGTGG - Intronic
1166145053 19:40828371-40828393 CCTTTTTAGAGGGAGGCAGGAGG + Intronic
1166229428 19:41417257-41417279 CTTTGGAAGGGTGAGGCAGGTGG - Intronic
1166425881 19:42677254-42677276 AAGTGAAAGAGGGAGGCAGGAGG - Intronic
1166583848 19:43927929-43927951 CTTTGGGAGAGTGAGGCAGGCGG + Intronic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1167009622 19:46798556-46798578 CCTTATAAGAGAGGGGCAGAAGG - Intergenic
1167025090 19:46910219-46910241 ACTTGGAAGGGTGAGGCAGGAGG - Intergenic
1167090927 19:47343116-47343138 CCTTTTAAGAGGGAGGCAGGAGG + Exonic
1167199020 19:48051091-48051113 CCTTATAAGAGCAAGGCGGGAGG + Intronic
1167281673 19:48572819-48572841 CCATGGAGGAGGGAGGCAGGAGG + Intronic
1167382590 19:49147306-49147328 ACTTGGAAGACTGAGGCAGGAGG + Intronic
1167440926 19:49508385-49508407 CCTTTGGAGAGGGAGGCAGGCGG + Intronic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1167746884 19:51356950-51356972 CCTTATAAGAGAGAGACAGAGGG - Exonic
1167782603 19:51609140-51609162 CTTTGGGAGAGTGAGGCAGGAGG - Intergenic
1167800327 19:51736460-51736482 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1168019669 19:53600052-53600074 GCTTGGAAGACTGAGGCAGGAGG + Exonic
1168030215 19:53673539-53673561 CTTTGGAAGGTGGAGGCAGGAGG - Intergenic
1168105646 19:54164401-54164423 TCTTGGAAGAGGAAGCCAGGGGG - Intronic
1168152309 19:54455712-54455734 CCTGGTTGGAGGGAGGCCGGTGG + Intronic
1168250606 19:55139566-55139588 CCTTATAAGAGGAAGGCCAGAGG - Intronic
1168270290 19:55246059-55246081 GTTTGGAGGAGGGAGGCAGGAGG - Intronic
1168276495 19:55281494-55281516 ATTTGTGAGAAGGAGGCAGGAGG - Intergenic
1168311700 19:55464020-55464042 CCTTGAAAGGCCGAGGCAGGAGG - Intergenic
1168451328 19:56468808-56468830 CTTTATAAAACGGAGGCAGGAGG + Intronic
1168580711 19:57553659-57553681 CCTTGGGAGACTGAGGCAGGAGG - Intronic
1168666446 19:58208524-58208546 CCTTAGGAGAGGGAGGCTGGAGG + Intronic
925322679 2:2987734-2987756 CCCTGTCAGAGGGTGGAAGGTGG - Intergenic
925393542 2:3516183-3516205 CCTTGTAAGAGAGATGGAGCTGG + Intronic
925879707 2:8342113-8342135 TCATATAAGAGGGAGGCAGTCGG + Intergenic
926544785 2:14226155-14226177 CCTTATAAGAGTGAGACAGGGGG - Intergenic
926620565 2:15043311-15043333 CCTTGGAAGGTGGAGGCAGCAGG - Intergenic
926769291 2:16353686-16353708 CCTTGTGAGAGGGAACAAGGAGG - Intergenic
926817386 2:16813508-16813530 CCTTTGAAGAGAGAGGCAGAGGG - Intergenic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
926839442 2:17062816-17062838 CCTTGTAAGAAGGAGGCAGGAGG - Intergenic
927676734 2:25111679-25111701 CATTATAAGAGGGACGCAGGAGG + Intronic
927970142 2:27300624-27300646 CTTTAGAAGAGCGAGGCAGGGGG + Intronic
927987195 2:27420333-27420355 CCATGTAAGAGGAAGGCAGAGGG - Intergenic
928241751 2:29592515-29592537 CCTGGGAAGAGGGATGCTGGAGG + Intronic
928364913 2:30692911-30692933 CCTTACAAGAGGGAGGCAAGAGG + Intergenic
928517096 2:32054077-32054099 ACTTGGAAGATTGAGGCAGGAGG - Intergenic
928556183 2:32427527-32427549 CCTTGGGAGACGGAGGCGGGCGG - Intronic
928600241 2:32897354-32897376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
928835325 2:35537384-35537406 CCTTATAAGAGAGTGGCAGGAGG + Intergenic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
929451752 2:42042626-42042648 CTGAGTAGGAGGGAGGCAGGAGG + Intergenic
929454487 2:42056176-42056198 CCCTGGTAGAAGGAGGCAGGAGG + Intronic
929571914 2:43028085-43028107 CCTTGGAAGAGGGATGCAGAAGG - Intergenic
929959388 2:46485003-46485025 CCTTGTAAAAGGGAGGCAGGAGG + Intergenic
930010170 2:46931498-46931520 CTTTCTAAGAGGGAAACAGGAGG + Intronic
930035438 2:47082479-47082501 CCTTATATAAGGCAGGCAGGAGG + Intronic
930322462 2:49873853-49873875 CCTTATAAGAAAGAGGCAGAAGG + Intergenic
930597259 2:53403653-53403675 CCTTCTAAGAGGGATGCAGAGGG - Intergenic
931099996 2:58987552-58987574 CTTTGAGAGACGGAGGCAGGAGG + Intergenic
931386126 2:61799083-61799105 CTTTGTAAGAGATAGGCAGAGGG + Intergenic
931630919 2:64297811-64297833 CCTTGGAAGAGAGAGGGAGGAGG + Intergenic
931940411 2:67245892-67245914 TCTTGTAAGAGGGGAGCAGAGGG + Intergenic
932102260 2:68911937-68911959 CCCAGTAAGAGGGAAGCATGGGG - Intergenic
932145562 2:69313054-69313076 CATTGTAAGAGGGAGGCAGAAGG - Intergenic
932232391 2:70093608-70093630 CTTTGGAAGGCGGAGGCAGGCGG + Intergenic
932340386 2:70959642-70959664 CTTTGGAAGTGGCAGGCAGGTGG - Intronic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
932630552 2:73339520-73339542 CTTTGTGAGAGGGAGGAATGTGG - Intergenic
932650442 2:73550101-73550123 CTTTGGAAGGTGGAGGCAGGCGG - Intronic
932861439 2:75297007-75297029 CCTCATAAGAGGGAGGAAGGAGG - Intergenic
932925253 2:75965769-75965791 TCTTATAAGAGGGACACAGGAGG - Intergenic
933150536 2:78909669-78909691 CCTTATAAGAGGGAGGTACAAGG + Intergenic
933377755 2:81501839-81501861 CCTAGTAAGAGGAAGGAAAGAGG - Intergenic
933500841 2:83109316-83109338 CCTTATAAGAAGGAGACAGAGGG - Intergenic
933527254 2:83457238-83457260 TTTTGTATGAGGGAGACAGGAGG + Intergenic
933786996 2:85851156-85851178 CTTTGGAAGGTGGAGGCAGGTGG - Intronic
933799466 2:85949220-85949242 CCTTGAAATAGGAAGGCAGTTGG - Intergenic
934032870 2:88064259-88064281 CCTTATAGGAGGAAGGCAGGAGG - Intergenic
934151297 2:89150112-89150134 CCTTATAATTGGGAGGGAGGAGG + Intergenic
934215961 2:90031798-90031820 CCTTATAATTGGGAGGGAGGAGG - Intergenic
934579175 2:95424834-95424856 CCGTGTGAGAGGGAGTGAGGTGG - Intergenic
934600271 2:95651890-95651912 CCGTGTGAGAGGGAGTGAGGTGG + Intergenic
934688441 2:96338602-96338624 CCTTGTAAGAGGAAGGTCGTCGG + Intronic
934910014 2:98243575-98243597 CTTTGGAAGAGCGAGGCAGGTGG - Intronic
935296782 2:101656635-101656657 CCTTATCAGAGCGAGGCAGGAGG + Intergenic
935462139 2:103349771-103349793 CCTTGTAAGAGTCATGCAGTAGG + Intergenic
935471051 2:103461419-103461441 CCCTGTAAGAGAGAGGCAGAAGG - Intergenic
935621819 2:105136630-105136652 CCTTCTAAAAGGGTAGCAGGAGG - Intergenic
935689974 2:105722276-105722298 CATTTTAAGAGGGAGGTAGAAGG - Intergenic
935727709 2:106038087-106038109 CCTTATAACAGGGAGGCAGAGGG + Intergenic
936004056 2:108866236-108866258 CCTTATAAAAGGGAGGCAGAAGG - Intronic
936103355 2:109602960-109602982 ACTTGGAAGACTGAGGCAGGAGG + Intronic
936135358 2:109888318-109888340 CCTTATAAGAGGGATGCAGGAGG + Intergenic
936209339 2:110483167-110483189 CCTTATAAGAGGGATGCAGGAGG - Intergenic
936428526 2:112438406-112438428 CCTTATAAGAGGGATGTAGGAGG - Intergenic
936450320 2:112628915-112628937 CTTTGGGAGATGGAGGCAGGAGG - Intergenic
936533622 2:113293895-113293917 CCATGTGAGAGGGAGTGAGGTGG + Intergenic
936710404 2:115124184-115124206 CTTTGGGAGATGGAGGCAGGAGG - Intronic
936713806 2:115162086-115162108 CCTGGGAAGCGGGAGGCGGGCGG - Intronic
936936270 2:117841044-117841066 CCTCATGAGAGGGAGGCAAGAGG + Intergenic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937160297 2:119754780-119754802 CCTTATAAAAGGGAGGCAAGAGG + Intergenic
937178052 2:119962209-119962231 CTTTGGGAGACGGAGGCAGGTGG + Intronic
937231046 2:120398425-120398447 CATTCTATGTGGGAGGCAGGAGG + Intergenic
937242607 2:120472018-120472040 CCCTGTTAGAGGAAAGCAGGAGG + Intergenic
937257645 2:120566300-120566322 CCCTGGAAGAGGAAGGCATGGGG - Intergenic
937342018 2:121097132-121097154 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
937349650 2:121152903-121152925 CCTGGAAGGAGGGCGGCAGGTGG - Intergenic
937374542 2:121326739-121326761 CTTTGGAAGGTGGAGGCAGGTGG - Intergenic
937426787 2:121806606-121806628 CTTTATGAGAGGGAGGGAGGAGG + Intergenic
937734065 2:125268278-125268300 CTTTGTAAGAGAGAGGCAAGAGG + Intergenic
937754976 2:125526196-125526218 CCTTATAAGAGGGAGGCCGGGGG + Intergenic
937760337 2:125593160-125593182 CCCTGTGAGAAGGAGGGAGGTGG + Intergenic
938898262 2:135774599-135774621 CTTTGGAAGACTGAGGCAGGCGG + Intronic
938977353 2:136492574-136492596 CCTTATAAAAGACAGGCAGGGGG - Intergenic
939135233 2:138285733-138285755 CCCTGTAAGAGAGAGGCAGAGGG - Intergenic
939171226 2:138698743-138698765 ACTTGGGAGATGGAGGCAGGAGG + Intronic
940165067 2:150761841-150761863 TCTTATCAGAGGGAAGCAGGAGG - Intergenic
940208413 2:151230415-151230437 CCTTGTAAGAGGGAAGAAAGAGG + Intergenic
940275806 2:151939418-151939440 CCTTGGAAGAGGTTTGCAGGAGG + Intronic
940338660 2:152556394-152556416 CCTTTTAGGAGGTAGGCAGCAGG + Intronic
940358417 2:152770347-152770369 ATTTGGAAGACGGAGGCAGGAGG - Intergenic
940415758 2:153418129-153418151 GCTCATAAGAGGGAGGCAGGAGG + Intergenic
940495190 2:154418439-154418461 CCTTATAAAAGGGAAGCAGAGGG + Intronic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
941063831 2:160878466-160878488 CTTTATAAGAGGGAAGCAGGAGG - Intergenic
941168121 2:162105126-162105148 CCTTTTAAGAGGGAAGCAAGAGG - Intergenic
941240612 2:163031979-163032001 CTTTAGAAGAGGGAAGCAGGAGG + Intergenic
941403259 2:165057862-165057884 CCTTGAGAGACTGAGGCAGGAGG - Intergenic
941454933 2:165703802-165703824 CCTTATGAGAGGGAAGCAAGAGG + Intergenic
941661755 2:168202539-168202561 GCTTGTTAGAGGGAGTCATGTGG - Intronic
941811781 2:169762572-169762594 CCTTATAAGAGTTAGGCAGAGGG - Intronic
942020474 2:171863006-171863028 ACTTGGGAGAGTGAGGCAGGAGG - Intronic
942093272 2:172514426-172514448 GCCTGTTAGAGAGAGGCAGGAGG + Intergenic
942149921 2:173065212-173065234 CTTTGGAAGGTGGAGGCAGGTGG + Intergenic
942227371 2:173829188-173829210 CCTGGTAGGAGGGAGCCAGAGGG + Intergenic
942330743 2:174821386-174821408 CCTTATAAAAGGGAGGCGAGAGG - Intronic
943244431 2:185428109-185428131 CCTTGTAAGATGCAGGCTGTTGG + Intergenic
944191277 2:197006859-197006881 CTTTGTGAGGTGGAGGCAGGAGG + Intronic
944248398 2:197556721-197556743 CCTTGTAAGAGGAAGTCAGAAGG - Intergenic
944312061 2:198244440-198244462 CCTTATAAGAGGGTGGTAGGAGG + Intronic
944345547 2:198660998-198661020 CTTTATAAGAGAGAGGCAGAGGG - Intergenic
944463075 2:199972434-199972456 CCTTATAAAAGGGAGGCAGGCGG + Intronic
944509020 2:200446093-200446115 CCTTGGAAGGCCGAGGCAGGAGG + Intronic
944551152 2:200845639-200845661 CTTTGTAAGGCCGAGGCAGGAGG + Intergenic
944639866 2:201714036-201714058 CTTTGTGAGACCGAGGCAGGAGG + Intronic
944643549 2:201754254-201754276 CTTTGGAAGACTGAGGCAGGTGG - Intronic
944644981 2:201770678-201770700 AAGTGGAAGAGGGAGGCAGGAGG + Intronic
944832646 2:203548433-203548455 CTTTATAAGAGGGAGGCAGGGGG - Intergenic
944840613 2:203620458-203620480 CCTTGTAAGAGAAAGGCAGAGGG + Intergenic
944922349 2:204428710-204428732 CCTTATAAGAGGAAGGCAAGAGG + Intergenic
944922932 2:204434359-204434381 CCTTATAAGACAAAGGCAGGTGG + Intergenic
944923627 2:204440381-204440403 CCTTATAATAGGGAAGCAGGAGG + Intergenic
944931908 2:204528512-204528534 CCTTATAAGAGGGAGGCAGGGGG + Intergenic
945118748 2:206436864-206436886 CCTTGGAAGGCCGAGGCAGGCGG - Intergenic
945352351 2:208796121-208796143 CCTAGTAAGAGGGAGGTAGGAGG + Intronic
945543808 2:211123699-211123721 TCTTATAAGAGGGAGACAAGAGG - Intergenic
945578185 2:211558372-211558394 CTTTGTAAGTGGGAGGCAGAAGG - Intronic
945579338 2:211573111-211573133 CCTTATAAAAGAGAGGCAGAAGG + Intronic
945681974 2:212925107-212925129 CCTTATGAGAGAGAGGCAGAGGG - Intergenic
945683148 2:212937516-212937538 CCTTGTAAGAGGGAGGTGGGAGG + Intergenic
945742911 2:213685300-213685322 TCTTGTAAGAAGGAGAAAGGTGG + Intronic
946382798 2:219360158-219360180 CTTTGTAAGACTGAGGCAGGAGG - Intergenic
946447657 2:219753600-219753622 CCTTATAAGAGTGAGGCAAGAGG - Intergenic
946539759 2:220671255-220671277 GCTTGAAACTGGGAGGCAGGCGG - Intergenic
946604992 2:221393754-221393776 ACTTGGGAGAGTGAGGCAGGAGG + Intergenic
946698809 2:222388958-222388980 CCTTATAAGAGTGAGGCAGGAGG + Intergenic
946728189 2:222682958-222682980 CTTTGGAAGACCGAGGCAGGTGG + Intronic
946893992 2:224304242-224304264 CCTTTTAAGAGGGAGGCAGAGGG + Intergenic
946989429 2:225311523-225311545 TCTTATAAGTGGGAGGCAGAGGG + Intergenic
947012136 2:225578174-225578196 CCTTGGGAGGCGGAGGCAGGTGG - Intronic
947591357 2:231388019-231388041 CTTTGGGAGACGGAGGCAGGAGG - Intergenic
947979052 2:234393306-234393328 CCTTGTAAGAGGGAGGAAGAGGG - Intergenic
948006934 2:234617331-234617353 CCTTGTCATCGGAAGGCAGGTGG + Intergenic
948026569 2:234782735-234782757 TCTTCTAAGAGGGAGGCAGGAGG + Intergenic
948115183 2:235490207-235490229 CCTTATACGAGGAAGGCAGGAGG - Intergenic
948154557 2:235770976-235770998 CCTTATAATAGGGAGGGAGAAGG + Intronic
948254551 2:236556462-236556484 CCTTATATGACGGGGGCAGGGGG + Intergenic
948339426 2:237237619-237237641 CTTTGGGAGATGGAGGCAGGCGG + Intergenic
948426913 2:237894397-237894419 CATTGTGGGAAGGAGGCAGGAGG + Intronic
948435188 2:237948511-237948533 CCTTATAAGAGTGAGGCAGGCGG - Intergenic
948963997 2:241362138-241362160 CTTTGGGAGACGGAGGCAGGTGG - Intronic
949010320 2:241674654-241674676 CCGCATAACAGGGAGGCAGGCGG - Intergenic
1168881809 20:1212602-1212624 CCTTATAAGAGGTAGACAGAGGG - Intergenic
1168950167 20:1792539-1792561 CCATATAAGAGGGAGACAGAGGG - Intergenic
1169347026 20:4836691-4836713 CTTTGGGAGAGTGAGGCAGGAGG + Intergenic
1169453015 20:5728382-5728404 CCTTATAAGAGGGAGATAGGAGG + Intergenic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1169634438 20:7672499-7672521 CCTTCTAAAAGGGAGACATGTGG + Intergenic
1169634680 20:7676269-7676291 CGCTATAAGAGGGAGACAGGAGG - Intergenic
1169997118 20:11570980-11571002 CCTTCTAAGAGGGAGGCAAGAGG - Intergenic
1170221819 20:13949419-13949441 CCTTGGGAGGCGGAGGCAGGCGG + Intronic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1170520308 20:17178374-17178396 CCTTATAAGAGAGAGACAGAGGG + Intergenic
1170730358 20:18969547-18969569 ACTTGGAAGACTGAGGCAGGAGG - Intergenic
1170773700 20:19357109-19357131 CCTTGTAAGAGAGAGGCAGTGGG + Intronic
1170866467 20:20162185-20162207 TCTGCTAAGAGGGAGGCAGCAGG - Intronic
1170896560 20:20420188-20420210 GGTAGTAAGAGGGTGGCAGGAGG + Intronic
1170916485 20:20631466-20631488 CCTTATAAGAGGGTGGCAGGAGG + Intronic
1171230977 20:23484792-23484814 CCTTATAAGAGAGAAGCAGGAGG + Intergenic
1171802213 20:29633557-29633579 CCTTGTAAAAAGGAGACAGAGGG - Intergenic
1171841762 20:30222040-30222062 CCTTGTAAAAAGGAGACAGAGGG + Intergenic
1172012453 20:31853576-31853598 ACTTGGGAGAGTGAGGCAGGAGG + Intronic
1172051092 20:32118870-32118892 CTTTGTAAGGCCGAGGCAGGTGG - Intronic
1172094087 20:32452250-32452272 CCTGTTTGGAGGGAGGCAGGGGG + Exonic
1172309468 20:33906494-33906516 CCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1172490844 20:35336445-35336467 CCTTTTAAGAGAGAGGCGGAAGG + Intronic
1172687265 20:36765565-36765587 CTTTGGAAGGCGGAGGCAGGCGG + Intronic
1172769858 20:37375479-37375501 CCTTGTGAGGCAGAGGCAGGAGG - Intronic
1173010610 20:39178310-39178332 CCTTTTAAGAGAGAGGCAGAGGG + Intergenic
1173044215 20:39493916-39493938 CCTTGTAAGAGACAGGCAGAGGG + Intergenic
1173072661 20:39784298-39784320 TCCTATAAGAGGGATGCAGGAGG + Intergenic
1173155730 20:40606978-40607000 CTTTATAAGAGGGAGACAGAAGG - Intergenic
1173376418 20:42487569-42487591 CCTTATAAGAGGGAGGCAAGAGG + Intronic
1173540133 20:43844772-43844794 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1173779091 20:45738577-45738599 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1173838890 20:46143985-46144007 ACTTGGAAGACTGAGGCAGGAGG + Intergenic
1173983471 20:47242462-47242484 CCTTCTAAGAGGAGGGCAGGGGG + Intronic
1174037449 20:47677022-47677044 CCTGGGCAGAGGGAGGGAGGTGG + Intronic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174073662 20:47916677-47916699 CCTTGTAAGAAGGAGGCAGGAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174132885 20:48358520-48358542 CCTTGAACTAGGGAGGAAGGAGG + Intergenic
1174419788 20:50391909-50391931 CCTTATGAGAGGGAGGCGGGAGG + Intergenic
1174433550 20:50489074-50489096 CCTTATAAAAGGGAAGCAAGAGG - Intergenic
1174481204 20:50832801-50832823 CCTTACAAGAGGGAGGCAGGAGG - Intronic
1174533130 20:51230406-51230428 CCTTAGAAGAGTGAGGCAGAGGG - Intergenic
1174628982 20:51940106-51940128 ACTTATAAGAGGGAGGCGGCAGG + Intergenic
1174776750 20:53350053-53350075 CCTTATACAAGGGAGGGAGGAGG - Intronic
1175039603 20:56035754-56035776 CCTTAGAGAAGGGAGGCAGGAGG - Intergenic
1175131447 20:56792702-56792724 CCTTGCGAAGGGGAGGCAGGAGG + Intergenic
1175172490 20:57090345-57090367 CCTTATAAGACGGAGGTAGGAGG + Intergenic
1175296481 20:57912377-57912399 CCTTGGGAGAGGGAGGAAGTGGG - Intergenic
1175495978 20:59414562-59414584 CCTTATAAGATGGACACAGGAGG - Intergenic
1175658481 20:60792323-60792345 CCTTAACAGAGGGAGGCAGGAGG - Intergenic
1175723701 20:61302860-61302882 CCTTCCAAAAGGGAGGCCGGAGG + Intronic
1175765939 20:61592993-61593015 CCTTATAGGAGGGGGGCAGGAGG + Intronic
1175931112 20:62494170-62494192 CCTTATAAGAGACAGGCAGAGGG - Intergenic
1175958259 20:62622317-62622339 CCATCTAGGAAGGAGGCAGGAGG + Intergenic
1176221892 20:63973660-63973682 CCTTATAAGAGAGAGACAGAGGG + Intronic
1176295165 21:5068067-5068089 CCTTGTAAGAGGAAGGCAAGGGG - Intergenic
1176513564 21:7766809-7766831 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1176701132 21:10051651-10051673 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1176810376 21:13530820-13530842 CTTAAGAAGAGGGAGGCAGGTGG + Intergenic
1177126517 21:17200583-17200605 CCTTGTGAAAGAGAGGCAGAGGG - Intergenic
1177315951 21:19461227-19461249 CCTTGTAAGGGGGAGGCCAGAGG + Intergenic
1177420702 21:20853139-20853161 CCTTATAAGAGGGAGACGGAAGG - Intergenic
1177504497 21:22002199-22002221 CGTTGTAGGAGGGACTCAGGGGG - Intergenic
1177606265 21:23381468-23381490 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1177767702 21:25476762-25476784 CCTTGGGAGGTGGAGGCAGGAGG + Intergenic
1177772186 21:25529431-25529453 CCTTGTAAGAGAAAGACAGAGGG - Intergenic
1177881915 21:26704362-26704384 CCTTATAAAAGGGAGGCTGAAGG - Intergenic
1178029024 21:28503838-28503860 CCTTATAAGAGGGAAGCAGGTGG + Intergenic
1178392869 21:32213872-32213894 CTTGATAAGAGGGAGTCAGGAGG - Intergenic
1178445107 21:32632774-32632796 CTTTGTAAGGCTGAGGCAGGTGG + Intronic
1178621067 21:34176531-34176553 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178647677 21:34397333-34397355 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1178839633 21:36128488-36128510 CTTTATGAGAGGGAGGCAGAAGG - Intergenic
1179065852 21:38024329-38024351 CTTTGTAACAGGGAGGCAGAGGG + Intronic
1179211431 21:39327793-39327815 CCTTGGGAGACTGAGGCAGGAGG + Intergenic
1179670263 21:42941941-42941963 CTTTGGAAGGTGGAGGCAGGAGG + Intergenic
1179861884 21:44194061-44194083 CCTTGTAAGAGGAAGGCAAGGGG + Intergenic
1179942991 21:44651613-44651635 CCTTATCAGAAGGAGGGAGGAGG - Intronic
1180084849 21:45503990-45504012 CCCTGCAAGAGAGAGACAGGCGG - Exonic
1180160295 21:45996154-45996176 CCAGGTAAGTGGGAGGCAGAAGG - Intronic
1180630143 22:17223372-17223394 ACTTGGAAGACTGAGGCAGGTGG - Intergenic
1180642341 22:17309424-17309446 CTTTGTAGGAGGCAGGCACGAGG - Intergenic
1180792339 22:18582423-18582445 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1181101683 22:20544926-20544948 CCTCCTAAGAGGGAGGCAGAAGG - Intronic
1181110597 22:20600646-20600668 ACTTCTAGGAGGGAGGCTGGTGG - Intergenic
1181156723 22:20926866-20926888 CCTTGGGAGGCGGAGGCAGGTGG + Intronic
1181229398 22:21412896-21412918 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
1181249252 22:21521967-21521989 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1181389299 22:22568049-22568071 CCTTTCGAGAGGGAGGCAGGGGG + Intergenic
1181568726 22:23754865-23754887 CTTTGGGAGACGGAGGCAGGTGG + Intergenic
1181676610 22:24458112-24458134 TCTTGGAAAAGTGAGGCAGGAGG - Intergenic
1181935841 22:26437805-26437827 CCCTGAAAGAGGCAGGAAGGAGG - Intronic
1181938813 22:26458711-26458733 CTTTGTGAGACCGAGGCAGGAGG + Intronic
1182069108 22:27450910-27450932 CCTTATAAGGGGGAGACAAGAGG + Intergenic
1182070036 22:27457064-27457086 GCTTGTAAGAGTGACTCAGGTGG - Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182106316 22:27692304-27692326 CCTTGTAAGAGGAAGGCAGGAGG + Intergenic
1182170904 22:28228454-28228476 CTTTGGAAGACCGAGGCAGGGGG + Intronic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1182205715 22:28623193-28623215 CCTTGGAAGGCTGAGGCAGGAGG - Intronic
1182221055 22:28759080-28759102 CTTTGGAAGACCGAGGCAGGCGG + Intergenic
1182224860 22:28789618-28789640 CTTTGTGAGACTGAGGCAGGAGG + Intergenic
1182409087 22:30167207-30167229 CCTTGTAAGACAGAGGCAATGGG - Intronic
1182611494 22:31551672-31551694 CTTTGGGAGAGCGAGGCAGGTGG - Intronic
1182850317 22:33468356-33468378 CCTTGGAAGACTGAGGCAGGAGG + Intronic
1182924604 22:34110515-34110537 CCTTGTAAGAGGAAGACAGGAGG - Intergenic
1183088815 22:35507255-35507277 CTTTGAAAGACCGAGGCAGGCGG - Intergenic
1183244980 22:36686476-36686498 GCATGTAAGAGGGAGGAAGGCGG + Intronic
1183304671 22:37076261-37076283 CAGTGTCACAGGGAGGCAGGAGG - Intronic
1183473083 22:38019769-38019791 CTTTGGGAGATGGAGGCAGGTGG + Intronic
1183514900 22:38259453-38259475 CCTCGTAGGAGGAAGGCAGGAGG + Intronic
1184065757 22:42119519-42119541 CTTTGGAAGACCGAGGCAGGCGG + Intergenic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184364359 22:44040485-44040507 CCTTATGAGAAGGAGGCAGGAGG + Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1184464953 22:44663527-44663549 CCTTATAAGAGGTGGGCAGGAGG - Intergenic
1184494072 22:44827107-44827129 CTTTACAAGAGGGAGGTAGGAGG + Intronic
1184529254 22:45044040-45044062 CCTTATGAGAGGGAGGCAGAGGG + Intergenic
1184638194 22:45852764-45852786 CCTTATAAGATGGTGGCTGGAGG - Intergenic
1185106388 22:48872178-48872200 CCCTGTCATGGGGAGGCAGGAGG - Intergenic
1185150689 22:49162071-49162093 CTTTGGGAGACGGAGGCAGGTGG + Intergenic
1185292415 22:50033732-50033754 ACTTTTAAAAGGGAGCCAGGAGG + Intronic
949098384 3:113780-113802 CCTTATAAGAGGGAGGCAAGGGG - Intergenic
949135380 3:558824-558846 CTTTGTAAGGCTGAGGCAGGCGG - Intergenic
949407874 3:3733756-3733778 CCTTACAAGAGGGAGGCGGAGGG - Intronic
949551017 3:5113135-5113157 CTTTGGAAGGTGGAGGCAGGCGG - Intergenic
949994075 3:9602544-9602566 CTTGGCAAGAGGGAGGCTGGGGG - Intergenic
950586048 3:13893062-13893084 CTTTGGAAGGGTGAGGCAGGCGG + Intergenic
950729271 3:14942671-14942693 CTTTGGAAGACTGAGGCAGGTGG - Intergenic
950921594 3:16700369-16700391 CCCTGTAAGAGGGAAGCAGGAGG - Intergenic
951369561 3:21828952-21828974 CCTTGTAAGAGGGAGACAAGAGG - Intronic
951605770 3:24433337-24433359 CCTTATAAAAAGGATGCAGGAGG + Intronic
951785118 3:26410047-26410069 CTTTGGAAGACGGAGGCAAGAGG + Intergenic
952126228 3:30304214-30304236 CCTTGTAAGATGGCGGAAGAGGG - Intergenic
952196828 3:31084628-31084650 CCTTATAAGAGGAAGTCAAGAGG + Intergenic
952206460 3:31185435-31185457 ATTTGTAAGAGGGAGCCAGAGGG + Intergenic
952234085 3:31461121-31461143 CCTTTCAAAAGGGAGGCAGGAGG + Intergenic
952290170 3:32007612-32007634 CCGTATAAGAGAGAGGCAGAGGG - Intronic
952721651 3:36540023-36540045 TCTTAGAAGAGGGAGACAGGAGG + Intronic
953163275 3:40441915-40441937 CCTTGGAAGGCTGAGGCAGGAGG + Intergenic
953242022 3:41158115-41158137 CTTTGGGAGACGGAGGCAGGCGG + Intergenic
953370759 3:42386407-42386429 CCTTAAAAGAGGGAGGCGGGGGG - Intergenic
953386421 3:42508766-42508788 CCTTGTAGTTGGGAGGCAAGAGG - Intronic
953685362 3:45073992-45074014 CTTAGTAAGAGAGAGTCAGGGGG + Intergenic
953752310 3:45618161-45618183 CGTGGTTGGAGGGAGGCAGGAGG + Intronic
953858917 3:46525492-46525514 CTTTGTGAGGGTGAGGCAGGAGG - Intronic
954095205 3:48320670-48320692 CTTGGTGTGAGGGAGGCAGGGGG + Intronic
954262045 3:49446494-49446516 CTTTGTGAGGGCGAGGCAGGCGG - Intergenic
954531734 3:51326866-51326888 CTTTGGGAGATGGAGGCAGGTGG - Intronic
955148201 3:56341216-56341238 CTTTGTAAGATGGAGGAAGGTGG - Intronic
955177919 3:56635716-56635738 ACTTGGAAGACTGAGGCAGGAGG - Intronic
955315356 3:57934181-57934203 CTTTGGCAGGGGGAGGCAGGAGG - Intergenic
955632140 3:60986011-60986033 CGTTATAAGGGGGAGACAGGAGG - Intronic
955745611 3:62137381-62137403 CCTTCTAAGTGAGAGGCAAGAGG + Intronic
955994443 3:64665386-64665408 CATTGTAAGTGGGAGGACGGAGG - Intronic
956032155 3:65050266-65050288 CATTGTAAGAGGGAGGGAGAGGG - Intergenic
956196470 3:66657801-66657823 CCTTATTAGAGGGATGTAGGAGG - Intergenic
956736169 3:72239943-72239965 CCTTGGAGGAGGGAGCCATGAGG - Intergenic
956775512 3:72562159-72562181 CCTTATAACAGGGAGGCAGGAGG + Intergenic
956824168 3:72982337-72982359 CCTTGGGAGATTGAGGCAGGTGG + Intronic
956899807 3:73703704-73703726 CCTTATAAAAGAGAGGCTGGAGG - Intergenic
956958974 3:74375567-74375589 CCTTATAAGAGAGAGGCAGGAGG + Intronic
956974594 3:74565403-74565425 CCTTCTAAGAGAGAGGCAGGAGG - Intergenic
957631739 3:82724720-82724742 CCTTCTAAGAGGGAGGCAGGAGG + Intergenic
957682858 3:83460141-83460163 CCTTATAAGAGACAGGCAGAGGG + Intergenic
957860299 3:85940073-85940095 CTTTGGGAGATGGAGGCAGGAGG + Intronic
957884080 3:86260644-86260666 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
957905450 3:86547878-86547900 CCTGGAGAGAGGGAGCCAGGTGG - Intergenic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958727591 3:97924709-97924731 CCCTGTAAGAGGAAGGTAGGAGG - Intronic
959231546 3:103660105-103660127 CCTTATAAGAGAAAGGCAGCGGG + Intergenic
959283435 3:104377551-104377573 CTTTATACAAGGGAGGCAGGAGG + Intergenic
959539143 3:107521042-107521064 CTTTGTGAGATGGAGGCGGGTGG - Intergenic
959544475 3:107578240-107578262 CACTGTAAGAGGGAGACATGGGG + Intronic
960037550 3:113117101-113117123 CTTTGGAAGGGTGAGGCAGGCGG - Intergenic
960170958 3:114460448-114460470 TCTTATAAGAGAGAGGCAGGAGG + Intronic
960255889 3:115511269-115511291 CCTTTAAAGAAGGAGGCTGGAGG + Intergenic
960432591 3:117587741-117587763 CCTTATAAGAGAGAGGCAACAGG - Intergenic
960726910 3:120679623-120679645 CATTATAAGAGGGAGGCAAAGGG + Intronic
960790969 3:121430515-121430537 CTTTATAAGAGGGAAGCAGATGG - Intergenic
960966781 3:123111049-123111071 CTTTGTGGGTGGGAGGCAGGTGG + Intronic
961056447 3:123793014-123793036 GCTTGTAGGAGGGGGTCAGGTGG - Intronic
961194534 3:124990580-124990602 CTTTGGAAGATGGAGGCAGGAGG - Intronic
961226623 3:125255488-125255510 CTTTGTGAGGTGGAGGCAGGTGG - Intronic
961261420 3:125605265-125605287 CCTTGGAGAAGAGAGGCAGGAGG - Intergenic
961325048 3:126104757-126104779 GCTTGAAAGATGGGGGCAGGGGG + Intronic
961473573 3:127133681-127133703 CCTTATAAGAGGGAGGCCAGAGG - Intergenic
961611445 3:128143081-128143103 CCTTATAAGAGAGTGGCAGGAGG - Intronic
961958556 3:130829794-130829816 CCTTTTCAGATGGTGGCAGGTGG - Intergenic
962422811 3:135242832-135242854 CCTTGGAAGGTGGAGGCAGGTGG + Intronic
962444882 3:135455384-135455406 CATGATAAGAGGGAGGAAGGAGG - Intergenic
962541303 3:136385203-136385225 CTTTGGGAGGGGGAGGCAGGAGG + Intronic
962873830 3:139520290-139520312 ACATGCACGAGGGAGGCAGGTGG + Intronic
962888187 3:139647564-139647586 CCTTATAAAAGGGAGGTAAGGGG + Intronic
962906606 3:139809136-139809158 CCTTGGAAGACCGAGGGAGGAGG + Intergenic
963128025 3:141833216-141833238 CCTCATAAAAGGGAGGCAGGAGG + Intergenic
963268782 3:143265685-143265707 CCTTGTAAGGGGGAGACCTGAGG + Exonic
963372537 3:144419547-144419569 CTCTGTAAGATGGAGGCAAGAGG - Intergenic
963463576 3:145648600-145648622 CCCTATAAGAGGGAGGCTGGAGG + Intergenic
963686770 3:148444961-148444983 CCTTGTCAGAGGGATGCAGGAGG + Intergenic
964113669 3:153113017-153113039 CTTTGGGAGAGGGAGGCGGGTGG + Intergenic
964163961 3:153678959-153678981 CCTTGGAAGACTGAGGCGGGTGG + Intergenic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
964716255 3:159725506-159725528 CTTTGGAAGGCGGAGGCAGGCGG - Intronic
964808263 3:160635299-160635321 CATGATAAGAGGGAGGCAGTAGG + Intergenic
964862692 3:161220026-161220048 CCTTGTAAGAGGGGTGCGGGGGG + Intronic
965885539 3:173441525-173441547 TCTGGTAATAGGGAGGCAGGAGG + Intronic
965905589 3:173701342-173701364 CCTTGTAAGAGGGAGGCAAGAGG + Intronic
966401718 3:179554269-179554291 CATTGGAAGGCGGAGGCAGGTGG + Intergenic
966829161 3:183991186-183991208 ACTTGGGAGATGGAGGCAGGAGG + Intronic
966990442 3:185224836-185224858 CCTTATAAGAGGGAAGCAGAAGG - Intronic
967122115 3:186391455-186391477 CCTTATAAGTGGGAGACAGATGG + Intergenic
967548460 3:190760861-190760883 CCTTATGAGAGGGACGTAGGAGG - Intergenic
967965967 3:194960491-194960513 CCTTGTGAGAAGGAGCCATGAGG + Intergenic
967968488 3:194982637-194982659 CCTTATCAGAGTGAGGCAGAGGG + Intergenic
968000068 3:195199366-195199388 CTTTGGGAGAGTGAGGCAGGTGG + Intronic
968113328 3:196068367-196068389 CCTTGCAAGGCTGAGGCAGGGGG + Intronic
968171033 3:196510692-196510714 GCTTGTAAGCGAGACGCAGGGGG - Intronic
968505010 4:967530-967552 GCTGGTAAGGGGGAGGCTGGGGG - Exonic
968509303 4:988329-988351 CCCTGTGAGGGGGAGGCACGAGG + Exonic
968728989 4:2261067-2261089 CCTTTTAAGGGGGCGGGAGGAGG - Intronic
968929413 4:3570635-3570657 CCTTTTAAGAGGGAGGCAGGAGG + Intergenic
969010754 4:4060210-4060232 CTTTGGAAGGGTGAGGCAGGAGG - Intergenic
969050580 4:4370057-4370079 CCTTATAAGAGGGAGTCAGGGGG + Intronic
969105282 4:4802853-4802875 CCTCGTAAGAGGGAAGCAAGAGG + Intergenic
969146931 4:5132008-5132030 CCTCATAAGAGGGAGGCATTTGG + Intronic
969257941 4:6015294-6015316 CCTTGTAAGAGGAGGAGAGGAGG + Intergenic
969280239 4:6166051-6166073 CCTTCTAAGAGTGAGGCACAGGG - Intronic
969302619 4:6306113-6306135 CCTTGTAAGAGGGAGGCTGGAGG + Intergenic
969342741 4:6552592-6552614 CCTTATAAGAGGGAGGTAGGAGG - Intronic
969440980 4:7216668-7216690 CCTTAAAAGAGGGAGGCAGGAGG - Intronic
969483540 4:7459331-7459353 CCTTGTACTAGGGAGACATGAGG + Intronic
969520981 4:7677642-7677664 GCTTGTGAGTGGGAGGCAGCAGG + Intronic
969607371 4:8209293-8209315 TTTTGTAGGAGGAAGGCAGGAGG + Intronic
969622090 4:8283789-8283811 CCTCGTCACAGGGAGGCTGGAGG - Intronic
969641223 4:8399854-8399876 CTTTGGAAGACTGAGGCAGGAGG + Intronic
969743305 4:9049682-9049704 CTTTGGAAGGGTGAGGCAGGAGG + Intergenic
969839444 4:9869976-9869998 CCTTGTAAGAGTGTGGAAGATGG + Intronic
969998387 4:11338778-11338800 CCTTATAAGAGAGAGTCAGGAGG - Intergenic
970580033 4:17466689-17466711 CCTTATAAAAGGGAGGCAGAAGG + Intronic
970586290 4:17517605-17517627 CCTTCTAAGAAGGAAGAAGGAGG - Intronic
970588157 4:17534149-17534171 TCTTTTAAGAGAGAGGCAGAAGG - Intergenic
970602827 4:17653855-17653877 CCTTATAAGAGGGCCGTAGGAGG + Intronic
970612636 4:17739797-17739819 CCTTGCAAGGCTGAGGCAGGTGG - Intronic
970906542 4:21223153-21223175 CCTTATAAGTGGGAGGCAAGTGG + Intronic
971051940 4:22871694-22871716 CCTTGGAAGGCTGAGGCAGGTGG - Intergenic
971260998 4:25057107-25057129 CCTTACAAGAGGGAGGTAGGAGG - Intergenic
971596170 4:28531736-28531758 CCTTATAAGAGACAGGCAGGAGG + Intergenic
971700420 4:29966509-29966531 CCTTGTGTCAGGGAAGCAGGAGG - Intergenic
972180620 4:36460457-36460479 CCTTCTAAGAAGAAAGCAGGAGG - Intergenic
972247930 4:37265726-37265748 CCTTATAAGAGGGAGGCATAAGG - Intronic
972418412 4:38864899-38864921 CCTTGTGAGGCTGAGGCAGGAGG + Intergenic
972667369 4:41180190-41180212 CCTTGTAAGAGATAGCGAGGAGG - Intronic
972881951 4:43435660-43435682 CCCTGTTAAAGGGAGACAGGAGG - Intergenic
972946029 4:44256671-44256693 CTTTGTAAGCAGGAGGCAGGAGG + Intronic
973044909 4:45524191-45524213 CTTTGGGAGACGGAGGCAGGCGG + Intergenic
973116575 4:46467572-46467594 CCCTATAAGAGGGAGGTAGAAGG + Intronic
973180991 4:47267549-47267571 CCTTGTGAGGCCGAGGCAGGCGG + Intronic
973208604 4:47589044-47589066 CCTTATAAGAAAGAGGCAGAGGG + Intronic
973711608 4:53635071-53635093 CTTTGGAAGACTGAGGCAGGAGG - Intronic
973760052 4:54107376-54107398 TCTAGTGAGAGGGAGGCAAGGGG + Intronic
974075868 4:57168076-57168098 CTTTGGGAGAGCGAGGCAGGTGG + Intergenic
974093285 4:57334916-57334938 CCTTATGAGAGGGAGGCAGAAGG + Intergenic
974165482 4:58195880-58195902 TCTTGTAAGATGGAGGCAGAGGG + Intergenic
974214002 4:58821006-58821028 CCTTGGAAGGTGGAGTCAGGTGG + Intergenic
974340719 4:60611888-60611910 CTTTGTTAGGTGGAGGCAGGCGG - Intergenic
974480875 4:62441451-62441473 CTTATTAAGAGGGAGGCAAGAGG - Intergenic
975400839 4:73938001-73938023 CCTTGGGAGACTGAGGCAGGAGG - Intergenic
975454976 4:74579418-74579440 TTTTATAAAAGGGAGGCAGGAGG - Intergenic
975564557 4:75740088-75740110 CTTTGGAAGACAGAGGCAGGAGG + Intronic
975851200 4:78574173-78574195 CTTTGGGAGGGGGAGGCAGGAGG + Intronic
975968480 4:80004627-80004649 CCTTATAAAAGGGAGACAGAGGG - Intronic
976179436 4:82385108-82385130 CCTTGTAAGAGGGGGACAGGAGG + Intergenic
976247020 4:83014442-83014464 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
976258688 4:83125070-83125092 CTTTGGAAGGCGGAGGCAGGCGG + Intronic
976328489 4:83800212-83800234 ACTTGGAAGACTGAGGCAGGAGG - Intergenic
976619477 4:87113755-87113777 CTTTGGAAGACTGAGGCAGGAGG + Intronic
976709678 4:88055580-88055602 CTTTGGAAGACTGAGGCAGGAGG - Intronic
976830709 4:89310524-89310546 CCTTCCAGGAGGGATGCAGGAGG - Intergenic
977104940 4:92870090-92870112 ACTTGGAAGACTGAGGCAGGAGG + Intronic
977156655 4:93582289-93582311 CCTTTTAAGAGACAGTCAGGAGG - Intronic
977269544 4:94899175-94899197 CCTCATGAGAGGGAGGCAGAGGG - Intronic
978581566 4:110236719-110236741 CCTTACAACAGGGAGGCAGAGGG - Intergenic
978996185 4:115156477-115156499 TCATGTAAGAGGGTGGCAAGAGG - Intergenic
979194239 4:117900870-117900892 CCTTCTAAGAGGGAAGTAGGTGG - Intergenic
979259788 4:118635558-118635580 CTTTGGGAGGGGGAGGCAGGCGG + Intergenic
979845853 4:125510721-125510743 CCTTATAAGAGAGATGGAGGAGG - Intergenic
980081326 4:128347527-128347549 CTTTGAAAGATTGAGGCAGGAGG - Intergenic
980307764 4:131086028-131086050 CCTTAGAAGAGTGAGGCAGAGGG - Intergenic
980678775 4:136126939-136126961 TGTTGTAGGAGGGAGCCAGGAGG + Intergenic
980785815 4:137553333-137553355 CCTTGGAAGGAGGAGGCAGGCGG + Intergenic
980869515 4:138594799-138594821 CCTTTAATGAGGGAGGCAGAGGG - Intergenic
980935929 4:139225843-139225865 CCTTGGAAGGCTGAGGCAGGAGG + Intergenic
980975947 4:139610568-139610590 CCTTATAAGAGGGACACAGAGGG + Intergenic
981034928 4:140159732-140159754 CCTTGGAAGGCCGAGGCAGGCGG + Intergenic
981072226 4:140555711-140555733 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
981072746 4:140561580-140561602 CTTTGGGAGATGGAGGCAGGAGG - Intronic
981098141 4:140802729-140802751 CCTTCTAAGAGGGAGGCAAAAGG - Intergenic
981148469 4:141353396-141353418 CTTTGAAGCAGGGAGGCAGGAGG + Intergenic
981568856 4:146130985-146131007 CCTGGTAAGTGAGCGGCAGGTGG + Intergenic
981925930 4:150139106-150139128 CCTTGTGAGGCTGAGGCAGGAGG - Intronic
982081752 4:151796974-151796996 GCTTGGAAGAAGGTGGCAGGTGG + Intergenic
982214437 4:153068126-153068148 CCTTGTAAGAAGAAGACATGTGG - Intergenic
982873342 4:160612563-160612585 TTTTATAAAAGGGAGGCAGGAGG - Intergenic
983090629 4:163497668-163497690 CCATGTAAGAGGAAGGCAGGAGG - Intronic
983394473 4:167176151-167176173 CATGATAAAAGGGAGGCAGGAGG - Intronic
983583339 4:169330446-169330468 CCTGGGCAGAGAGAGGCAGGGGG - Intergenic
983610990 4:169644823-169644845 CCTTAAAAGAGGGAGGCAGGAGG + Intronic
983633110 4:169870113-169870135 CCTTGGAAGAGGGAGGAAGGCGG + Intergenic
983854010 4:172618963-172618985 CCTTGGAAGGCCGAGGCAGGCGG - Intronic
983866450 4:172772877-172772899 CCTTATAAGAGGGAAGAAGAGGG + Intronic
983907413 4:173198309-173198331 CCTTGGGAGACCGAGGCAGGCGG - Intronic
984248166 4:177300534-177300556 CCTCATAAAAGGCAGGCAGGAGG - Intergenic
984252375 4:177349490-177349512 CTTTATAAGAGAGAGGGAGGGGG - Intronic
984379133 4:178967938-178967960 CCTTGTAAGAGGAAAGCAGGAGG + Intergenic
984461852 4:180047281-180047303 CCTTATATGAAGGATGCAGGAGG + Intergenic
984494196 4:180474011-180474033 CTTTATAAGAGGCAAGCAGGGGG - Intergenic
984709368 4:182872309-182872331 CCTTACAAGAGAGAGGCAGGAGG - Intergenic
985192534 4:187391489-187391511 CCTTCTAAGAGAGAAGCAGAGGG - Intergenic
985234228 4:187855408-187855430 CCTTAGAAGAGGGTGGCATGAGG + Intergenic
985629117 5:1005604-1005626 CCCTGGAAGAGGCAGGCAGGGGG + Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
986517686 5:8581070-8581092 AATGTTAAGAGGGAGGCAGGTGG - Intergenic
986631640 5:9779534-9779556 TCATGTAATAGGGAGGCAAGAGG + Intergenic
986688846 5:10297324-10297346 CTTTGGGAGACGGAGGCAGGTGG + Intronic
986704483 5:10443856-10443878 CCTTGGAAGAAGGAGGCAGAGGG - Intronic
986791365 5:11164140-11164162 CCTTATGAGAGGGAGGTAGGAGG - Intronic
986986848 5:13510191-13510213 CCATATGAGAGGAAGGCAGGAGG + Intergenic
987036093 5:14019816-14019838 CTTTGTAGGAAGGAGGAAGGTGG + Intergenic
987150882 5:15038537-15038559 CCTCATAAGAGGAAGGTAGGAGG - Intergenic
987180975 5:15368148-15368170 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
987188063 5:15445235-15445257 CCTTATTAGAGGAAGGCAGGAGG + Intergenic
987382773 5:17301014-17301036 CTTTGGAAGGTGGAGGCAGGCGG - Intergenic
987387864 5:17347352-17347374 CCTTATGGGAGGAAGGCAGGTGG - Intergenic
987588898 5:19896429-19896451 CCTTCTAAGAGAGAGGCAAGGGG + Intronic
988012912 5:25513591-25513613 CCTTGGAAGGCTGAGGCAGGTGG + Intergenic
988440572 5:31228180-31228202 CCTTAAAAGAGGGAGGCAGGTGG - Intronic
988584048 5:32493548-32493570 ACTTGGAAGACTGAGGCAGGAGG - Intergenic
988631815 5:32939742-32939764 ACTTGGGAGATGGAGGCAGGAGG - Intergenic
988709965 5:33763290-33763312 CCTTATAAGAGGAAGGCAAGAGG + Intronic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
988884650 5:35542958-35542980 CATTTTAAGAGGAAGGCAGAGGG + Intergenic
989001614 5:36766684-36766706 CCTTATAAGAGAGAGTCAGAGGG - Intergenic
989002222 5:36773429-36773451 CCTCATAAGAGAGAGGCAGATGG + Intergenic
989116444 5:37958495-37958517 CCTTGTAAGAGGGTGGCAAAAGG - Intergenic
989650830 5:43688248-43688270 CATTATAAGAGGGAGGCAGGAGG + Intronic
989708878 5:44372348-44372370 CCTTATAAGAGAGAAGCAGAGGG - Intronic
990183953 5:53192624-53192646 CCTCATAAGAGAGAGGCAGAGGG + Intergenic
990200072 5:53362028-53362050 CTTTGGAAGGCGGAGGCAGGAGG + Intergenic
990220191 5:53579814-53579836 CCTTATAAGAAGGATGCAGGTGG + Intronic
990232232 5:53725851-53725873 CCTTATAAGAGGGAAGCAGACGG - Intergenic
990374094 5:55152010-55152032 CCCTGTAAGAGGAAGGCAGAGGG + Intronic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
990431858 5:55743310-55743332 CCTTATAATAGAGAGGCAGAGGG - Intronic
990655141 5:57946689-57946711 CATTATAAGAGGGAGTCAGGTGG + Intergenic
990741460 5:58916474-58916496 CCTTATAAGACAAAGGCAGGTGG + Intergenic
991039883 5:62164114-62164136 CCTTATAAAAGGAAGGCAGAGGG + Intergenic
991181036 5:63751456-63751478 CCTTGTATGAAGGGTGCAGGGGG + Intergenic
991362750 5:65837862-65837884 CTTTGTAAGGCCGAGGCAGGAGG - Intronic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
991505093 5:67316269-67316291 GCTTGGAAGACTGAGGCAGGAGG + Intergenic
992183803 5:74224374-74224396 CCTTGTAATAGAGAGACAGAGGG + Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992356187 5:75986294-75986316 CCCTGAAAGATGGATGCAGGAGG + Intergenic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
993081843 5:83310780-83310802 CCTTATTAGAGGGAGGAAGAAGG + Intronic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
993849422 5:92988143-92988165 CATTTTAAGAGAGAGGCAGAGGG + Intergenic
993858179 5:93101086-93101108 CCTTATAAGAGGAAGACAGGAGG + Intergenic
993951583 5:94182501-94182523 CTTTGGAAGGGCGAGGCAGGTGG - Intronic
994275925 5:97837221-97837243 CCTTACAAGAGGGAGGTAGGAGG - Intergenic
994371332 5:98970877-98970899 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
994739024 5:103595199-103595221 CCTTATAAGAGGGAGATATGGGG - Intergenic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
995261948 5:110114344-110114366 CCTTATAAGAGGGACAGAGGAGG - Intergenic
995307301 5:110668357-110668379 CCCTCTAAGAGGGAGCCTGGAGG + Intronic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
995532759 5:113107523-113107545 CCTTTGGAGATGGAGGCAGGTGG + Intronic
995587122 5:113659734-113659756 CCTTTTTAGAGGGAGGCAGATGG + Intergenic
995759412 5:115547567-115547589 CTTTGGGAGGGGGAGGCAGGTGG - Intergenic
995775846 5:115724280-115724302 CTTTGGAAGGCGGAGGCAGGTGG - Intergenic
995820045 5:116219466-116219488 CCTTATAAGAGAGAGGCAGAGGG + Intronic
995864355 5:116675632-116675654 CCTTGGAGCGGGGAGGCAGGAGG - Intergenic
996141428 5:119913814-119913836 CCTTGGGAGTGGAAGGCAGGAGG - Intergenic
996431866 5:123389741-123389763 CTTTGGAAGACCGAGGCAGGTGG - Intronic
996482617 5:123991815-123991837 CCTTATAGGAGGAAGGCACGAGG + Intergenic
996624045 5:125548280-125548302 CCTCATAAGAGGGAGGTAGGAGG - Intergenic
997053669 5:130413777-130413799 CCTTATAAAAGGGAGGCAGAGGG - Intergenic
997170596 5:131715375-131715397 ACTTGGAAGGGTGAGGCAGGAGG + Intronic
997205449 5:132046056-132046078 CCTTGTAAGAGGGAATTAGGAGG - Intergenic
997254453 5:132417711-132417733 CCTTATAAGAGGGAGGCAGGGGG - Intronic
997392980 5:133532095-133532117 CCTTCTAAAAGAGAGGCAGGAGG + Intronic
997830578 5:137146238-137146260 CCTGGGGAGAGGGAGGAAGGAGG - Intronic
997970514 5:138397592-138397614 CTTTGGAAGACCGAGGCAGGCGG + Intronic
998094264 5:139388421-139388443 CCTTGGAGGAGGGAGGTGGGGGG + Intronic
998188702 5:140003415-140003437 CCTTGTAAGAGGGAGGTAGGAGG + Intronic
998261645 5:140636239-140636261 CTTTGGGAGATGGAGGCAGGTGG - Intergenic
998431210 5:142071862-142071884 CTTTGGAAGACTGAGGCAGGTGG - Intergenic
998618051 5:143762521-143762543 TCTTCAAAGAGGGATGCAGGAGG - Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
998868907 5:146533226-146533248 CTTTGGGAGATGGAGGCAGGCGG - Intergenic
999029155 5:148270788-148270810 TCTTATCAGAGGGAGGCAGGAGG + Intronic
999194019 5:149769855-149769877 CTTTTTAAGAGGGAGGCAGAAGG - Intronic
999210668 5:149885929-149885951 CCTTATAAGAGGGAAGCAAGAGG - Intronic
999327011 5:150649893-150649915 CCATGGTAGAGGGAGGCAGGCGG - Exonic
999615703 5:153420879-153420901 GATTGTTTGAGGGAGGCAGGGGG - Intergenic
999660977 5:153862563-153862585 CCTTATAAGACAGAGGCAGAGGG - Intergenic
999833374 5:155341996-155342018 ACTTGTAAGACTGAGGCAGGAGG - Intergenic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000050146 5:157555940-157555962 ATTTATAAGAGGGAGGCAGAAGG - Intronic
1000123943 5:158225284-158225306 CCTTGTAAGAAAGACGCAAGAGG + Intergenic
1000150151 5:158492254-158492276 CCTTGGTAGAGGGAGGCAGCAGG + Intergenic
1000397926 5:160795687-160795709 CCTTATAAGAGAAAGGCAGAGGG + Intronic
1000805531 5:165785989-165786011 CCTTGGGAGACCGAGGCAGGTGG - Intergenic
1001038441 5:168314822-168314844 CCTGGCATGAGGGTGGCAGGAGG + Intronic
1001423162 5:171602183-171602205 ACTTGGAAGACTGAGGCAGGAGG - Intergenic
1001471220 5:172014162-172014184 CTTTGGGAGATGGAGGCAGGCGG + Intergenic
1001658550 5:173373179-173373201 CCTTATAAAAGGGAGGCAAGAGG + Intergenic
1001789814 5:174446366-174446388 CCTTGTAAGAGAGAGGCAGAGGG + Intergenic
1001813140 5:174645963-174645985 CCTTGTAAGAGAGAGGTAGAGGG - Intergenic
1002080008 5:176732259-176732281 CCTTATAATCGGGAGGCAGGGGG - Intergenic
1002362914 5:178687406-178687428 CTTTGGAAGGGCGAGGCAGGAGG - Intergenic
1002441960 5:179269061-179269083 CCTTGCAAGAGGGAAGCACAGGG + Intronic
1002478024 5:179480476-179480498 CCTTCTAGGAGGAAGGCAGGAGG - Intergenic
1002489426 5:179563913-179563935 CTTTGGAAGACCGAGGCAGGTGG - Intronic
1002582180 5:180215583-180215605 ACGTGGAAGAGGGAGGCAGAAGG + Intergenic
1002682298 5:180976185-180976207 CCATGCAAGAGAGAGTCAGGAGG - Intergenic
1002840677 6:902647-902669 CTTTGGGAGATGGAGGCAGGAGG - Intergenic
1002939018 6:1699651-1699673 CCTTATAGGAGGAAGGCAGGAGG - Intronic
1003027682 6:2571412-2571434 CCTTATAAGAGGGAACCAGAGGG - Intergenic
1003032410 6:2613443-2613465 TCTTGTAAAAGAGAGGCAGGAGG - Intergenic
1003073250 6:2960892-2960914 CCTTCTAAGAGGGAGGGAGGGGG + Exonic
1003312626 6:4982955-4982977 CTTTGGAAGACCGAGGCAGGCGG - Intergenic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003384610 6:5655624-5655646 TCTTATAAGAGGGAGGCAGGAGG - Intronic
1003416216 6:5910728-5910750 CTTTATAAGAGGGAGGCAGCAGG - Intergenic
1003535196 6:6970206-6970228 CATTGGAGGAGGGAGGCTGGAGG + Intergenic
1003539918 6:7009651-7009673 CTTTGCAAGGCGGAGGCAGGCGG + Intergenic
1003747106 6:9014857-9014879 CCTTACAAGAGGGAGGTAGAGGG + Intergenic
1003837442 6:10086994-10087016 CCTTGCAAGACTGAGGCAGGAGG + Intronic
1003854763 6:10262111-10262133 CATTATAAGAGGAAGGCAGTGGG - Intergenic
1004166157 6:13258244-13258266 GCTTCTAGGGGGGAGGCAGGAGG + Intronic
1004199183 6:13532195-13532217 CCTTAAAAAAAGGAGGCAGGAGG - Intergenic
1004216407 6:13708315-13708337 ACTTGGGAGATGGAGGCAGGGGG + Intronic
1004218371 6:13723303-13723325 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1004222401 6:13758105-13758127 CCTTATAAGAGAGAGGGAGGAGG + Intergenic
1004471983 6:15937677-15937699 CCTTATAAAAGAGAGGCAGAGGG + Intergenic
1004571857 6:16853832-16853854 CTTTGAAAGACCGAGGCAGGAGG + Intergenic
1004925432 6:20411461-20411483 CCTTCTAAGAGCCAGGCAGAGGG - Intronic
1005348097 6:24910052-24910074 CCCTGTAAGAGGGAGCTAGAAGG + Intronic
1005781011 6:29192284-29192306 CCATATAAGAGGGAGGCTGGAGG - Intergenic
1006304906 6:33213104-33213126 GCTGGAAAGAGGGAGGGAGGTGG + Intergenic
1006352926 6:33534402-33534424 ACTTGGAAGATTGAGGCAGGAGG + Intergenic
1006527491 6:34619596-34619618 CTTTGTAAGGCTGAGGCAGGAGG - Intronic
1006607302 6:35267338-35267360 CCTTGGGAGACCGAGGCAGGTGG - Intronic
1007291690 6:40792049-40792071 CTTTATAAGAATGAGGCAGGAGG + Intergenic
1007517811 6:42427492-42427514 CTTTGGAAGATGGAGGCAGGAGG - Intronic
1007556511 6:42770923-42770945 CTTTGTAAGGCCGAGGCAGGCGG - Intronic
1008354319 6:50533436-50533458 CTTTGAAAGACTGAGGCAGGAGG - Intergenic
1008445938 6:51590793-51590815 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1008511615 6:52281430-52281452 CTTTGGAAGATGGAAGCAGGAGG + Intronic
1008957902 6:57235749-57235771 CTTTATAAGAGGGAAGCAAGAGG + Intergenic
1009231125 6:61062196-61062218 TCTTATAAGAGGGAGGTGGGAGG + Intergenic
1009281199 6:61753894-61753916 TCTTATAAGAGGGAAGCAGAGGG + Intronic
1009386191 6:63085833-63085855 CCTCGGAAAAGAGAGGCAGGAGG + Intergenic
1009474281 6:64068961-64068983 CTTTGTAAAAGGGAGGAAGAGGG + Intronic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010158447 6:72822963-72822985 CCTCGTAAAAAGGAAGCAGGAGG - Intronic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1011497980 6:87955172-87955194 CATGGTGAGAGGGAGGAAGGAGG - Intergenic
1011597125 6:89026602-89026624 CCTTGTAAAAGGAAGGCAGGAGG + Intergenic
1011703111 6:89973523-89973545 CCTTAAAAGAGGGAGGCAGGAGG - Intronic
1011800306 6:91005207-91005229 CCATGTCAGAGGGACACAGGAGG - Intergenic
1012205745 6:96458354-96458376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1012604792 6:101144691-101144713 CCTTTGCAGAGGGAGGCAGCTGG + Intergenic
1012676773 6:102124260-102124282 CCTTATAAAAGGGAAGCAGGAGG + Intergenic
1013055384 6:106577745-106577767 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1013130362 6:107226912-107226934 CTTTGGAAGACTGAGGCAGGCGG - Intronic
1013192209 6:107813117-107813139 CTTTGGAAGGTGGAGGCAGGAGG + Intronic
1013204318 6:107933063-107933085 ACTTTTAACAGGGAGGCAGAAGG + Intronic
1013245953 6:108287451-108287473 CTTTGGAAGGGTGAGGCAGGAGG - Intergenic
1013534169 6:111048211-111048233 CTTTGGAAGACTGAGGCAGGTGG - Intergenic
1013575431 6:111479752-111479774 CTTTGGAAGACAGAGGCAGGAGG - Intronic
1013993586 6:116281085-116281107 TCTTATAAGAAGGAGGCAGGAGG + Intronic
1014159478 6:118151622-118151644 CCTTGGGAGACTGAGGCAGGAGG - Intronic
1014164866 6:118212444-118212466 CTTTGTGAGGGTGAGGCAGGAGG + Intronic
1014593031 6:123295718-123295740 CTTTGGAAGACCGAGGCAGGTGG + Intronic
1014601328 6:123416944-123416966 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1014713227 6:124833904-124833926 CCTTTTAAGAGGGAAGCAGAAGG + Intergenic
1014740351 6:125142248-125142270 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1014742146 6:125158071-125158093 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1014787232 6:125632993-125633015 CCTGGTAAGAGGGAAGGATGAGG - Intergenic
1015173056 6:130276065-130276087 CCTTATAACAGGGAAACAGGAGG + Intronic
1015715303 6:136186170-136186192 GTTTGGAAGATGGAGGCAGGAGG + Intronic
1015889356 6:137954413-137954435 CCTTATCAGAGGGAGGCAGTAGG - Intergenic
1016081380 6:139861641-139861663 CTTTGGAAGGCGGAGGCAGGCGG + Intergenic
1016150518 6:140735711-140735733 CTTTGTGAGGGTGAGGCAGGTGG - Intergenic
1016152557 6:140760724-140760746 CCTTGGAAGACCGAGGCGGGCGG - Intergenic
1016191915 6:141279041-141279063 CCTTGTAAGAGAGGGTCAGATGG - Intergenic
1016285659 6:142469844-142469866 CCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1016396453 6:143628571-143628593 CCTTATAAGAGGGAGGCGAAGGG - Intronic
1017112171 6:150942148-150942170 CCTTGGGAGGCGGAGGCAGGAGG + Intronic
1017112784 6:150948565-150948587 CTTTGGAAGGTGGAGGCAGGTGG - Intronic
1017565419 6:155679740-155679762 CCTTGCAGGATGAAGGCAGGAGG + Intergenic
1018000738 6:159576462-159576484 CATTGTAAGACAGAGGCAGAGGG - Intergenic
1018367810 6:163139271-163139293 CCTTATGAGAGGGAAGCAGAGGG - Intronic
1018698375 6:166407958-166407980 AATTGGAAGAGGGAGGCAGGAGG + Intergenic
1018712561 6:166507143-166507165 CCTGGGAAGAGGGAGGGAAGAGG - Intronic
1018754692 6:166838884-166838906 CCTCATAAGAGGAAGGCAGCAGG + Intronic
1018830478 6:167438725-167438747 CCTTAGAAGAGGGAGGCAGAGGG - Intergenic
1019214357 6:170433756-170433778 TCTCATAACAGGGAGGCAGGAGG + Intergenic
1019376666 7:696515-696537 CTTTGGGAGATGGAGGCAGGTGG - Intronic
1019469232 7:1209549-1209571 ACCTGTGAGAGGGACGCAGGTGG + Intergenic
1019541244 7:1552219-1552241 CTTTGGGAGACGGAGGCAGGAGG - Intronic
1019681220 7:2350888-2350910 CTTTGGGAGAGTGAGGCAGGAGG - Intronic
1019915937 7:4132476-4132498 CCTTGGGAGACCGAGGCAGGTGG + Intronic
1020260391 7:6527517-6527539 CCTTGGAAGTGAGAGGCAGGGGG + Intronic
1020367645 7:7397309-7397331 CTTTATAAGAGGGAGGCAAAAGG - Intronic
1020535478 7:9391065-9391087 TCTTATAGGAGGCAGGCAGGAGG - Intergenic
1020669973 7:11094457-11094479 TCTTGTAAGAGAGAAGTAGGAGG - Intronic
1020801837 7:12741651-12741673 CCTTATAAAAGGGAGGTGGGAGG + Intergenic
1020807533 7:12808797-12808819 CCTTGGGAGCTGGAGGCAGGAGG - Intergenic
1021066382 7:16179471-16179493 CCTTATAAAAGGGAGGTAGATGG + Intronic
1021118564 7:16771504-16771526 CCTTGGAAGAGGGAGGAAAGAGG + Intronic
1021367939 7:19804840-19804862 CCTTGGAAGGCTGAGGCAGGAGG - Intergenic
1021693902 7:23257426-23257448 CCTTGGAAGGCGGAGGCGGGTGG + Intronic
1021726114 7:23549691-23549713 ACTTGAAAGAATGAGGCAGGAGG - Intergenic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1022582328 7:31567880-31567902 CTTTGGGAGATGGAGGCAGGTGG + Intronic
1022637100 7:32146508-32146530 GAGTGAAAGAGGGAGGCAGGAGG - Intronic
1022726989 7:32990235-32990257 CTTTGTAAAAGGGAGGCAGGGGG + Intronic
1022791277 7:33691705-33691727 AATCCTAAGAGGGAGGCAGGAGG + Intergenic
1022828214 7:34038220-34038242 ACTTATAAAAGGGAAGCAGGAGG + Intronic
1023006505 7:35875545-35875567 ACTTGGTAGAGGGAGGTAGGAGG - Intronic
1023047665 7:36224936-36224958 CCTTGTAAGAGACAGGAAGAAGG + Intronic
1023062576 7:36342867-36342889 CTTTGGGAGATGGAGGCAGGCGG - Intronic
1023123965 7:36936564-36936586 CCTTGGAAGACTGAGGCAGGAGG - Intronic
1023303032 7:38793841-38793863 CTTTATGAGAGGGAGGCAGAGGG - Intronic
1023415910 7:39932212-39932234 CTTTGTAAGGCTGAGGCAGGGGG + Intergenic
1023633626 7:42186964-42186986 CATTGGAAGACTGAGGCAGGAGG + Intronic
1024052048 7:45630698-45630720 CCTTATAAAAATGAGGCAGGAGG - Intronic
1024052235 7:45633159-45633181 CTTTGGAAGACCGAGGCAGGTGG - Intronic
1024067710 7:45755418-45755440 ACTTGGTAGAGGGAGGTAGGAGG + Intergenic
1024194184 7:47042765-47042787 GCTGGTAACAGGGAAGCAGGAGG - Intergenic
1024271960 7:47649398-47649420 CCTAGCTACAGGGAGGCAGGAGG + Intergenic
1024496669 7:50056400-50056422 CCTTCTAAGAGGAAGGCAAGAGG - Intronic
1024633973 7:51271784-51271806 CTTTGGAAGACCGAGGCAGGAGG + Intronic
1024858698 7:53812377-53812399 CTTTGGGAGGGGGAGGCAGGCGG - Intergenic
1025003910 7:55340870-55340892 CCTTATAAGAGGGAGCCGGAAGG - Intergenic
1025046593 7:55697398-55697420 CTTTGTAAAAGGGAGGCAGGCGG - Intergenic
1025192633 7:56907716-56907738 CCTTGTAAGAGAAGGGCAGGAGG - Intergenic
1025231815 7:57207666-57207688 CTTTATAAGAGTGGGGCAGGAGG - Intergenic
1025679312 7:63669204-63669226 CCTTGTAAGAGAAGGGCAGGAGG + Intergenic
1025946890 7:66111505-66111527 CTTTGGAAGATGAAGGCAGGTGG - Intronic
1026151413 7:67790827-67790849 CTTTGGGAGAGTGAGGCAGGTGG + Intergenic
1026359303 7:69588310-69588332 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1026361895 7:69609446-69609468 CCTTATAAAAGGGAGGTGGGAGG - Intronic
1026442091 7:70453752-70453774 CCTTATAGGAGAGAGGCAGGCGG - Intronic
1026539252 7:71266137-71266159 CCTTATAAGAGGTATACAGGAGG - Intronic
1026613585 7:71882298-71882320 CTTCATAAGAGGAAGGCAGGAGG - Intronic
1026622797 7:71965134-71965156 ACTTGGAAGGTGGAGGCAGGAGG - Intronic
1026645542 7:72164936-72164958 CTTTGGAAGACTGAGGCAGGAGG - Intronic
1026648293 7:72192325-72192347 TCTTCTAAGACCGAGGCAGGAGG - Intronic
1026654944 7:72248572-72248594 CCTTATAAGAGGGAGGCTGGAGG - Intronic
1026793853 7:73353186-73353208 CCTCGTAAAAGGGAGGCAGGAGG - Intronic
1026839509 7:73661794-73661816 TCTTATAAGAGGGAGGAAGGAGG - Intergenic
1026971513 7:74471290-74471312 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1027337207 7:77164104-77164126 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1027499401 7:78929660-78929682 CCTTATAAGAGGGACCCAGAAGG - Intronic
1027550011 7:79579241-79579263 CCTTATTAGAGGGAGGTAAGAGG + Intergenic
1027566883 7:79806345-79806367 ATTTATAAGAGAGAGGCAGGGGG + Intergenic
1027639913 7:80720153-80720175 CCTTGTGAGGTCGAGGCAGGTGG - Intergenic
1027910144 7:84240405-84240427 CCTTATAAGAGAGAGGGCGGGGG + Intronic
1028086557 7:86644290-86644312 CCTTATAAGAGGGAGGGTGGGGG + Exonic
1028278999 7:88897256-88897278 TCTTGTAAGAGGGATGCAGAGGG + Intronic
1028510849 7:91624811-91624833 CCTTAGAAGAGGGAAGCAGAGGG - Intergenic
1028559105 7:92154079-92154101 CCTTGGAAAACCGAGGCAGGTGG - Intronic
1028592768 7:92515748-92515770 CCTTGGGAGACTGAGGCAGGCGG + Intronic
1028949992 7:96623949-96623971 CCTTGTAAGAGAAAGCCAGAGGG - Intronic
1029070041 7:97888215-97888237 CTTTGGAAGGGTGAGGCAGGAGG - Intergenic
1029127621 7:98305664-98305686 CTTTGGGAGATGGAGGCAGGAGG - Intronic
1029333711 7:99881964-99881986 CTTTGGGAGATGGAGGCAGGTGG + Intronic
1029485625 7:100838242-100838264 CTTTGGAAGGTGGAGGCAGGAGG - Intronic
1029531718 7:101129755-101129777 CTTTGGAAGATTGAGGCAGGAGG + Intronic
1029574465 7:101394137-101394159 CCTTGTAAGAGGGTAGCAAGAGG + Intronic
1029670233 7:102025116-102025138 CCTAGTAAGAGACAGGCAGGAGG - Intronic
1030402324 7:109067663-109067685 CCTTGGAAGGCTGAGGCAGGTGG + Intergenic
1031399100 7:121310019-121310041 CCTTACAAGAGGGAGGCACAAGG + Intergenic
1031587241 7:123546977-123546999 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1031759838 7:125698908-125698930 GCTTTTAACAGGGAGGCAGGAGG - Intergenic
1031910406 7:127511110-127511132 CCTTCTAAGAGGAAGGCAGGAGG + Intergenic
1032121194 7:129158144-129158166 CCTTCTAAGAAGGAGGCAAGAGG - Intronic
1032166996 7:129553203-129553225 GTTAGTAAGAAGGAGGCAGGGGG - Intergenic
1032318114 7:130859948-130859970 CCTTGGGAGGGTGAGGCAGGTGG + Intergenic
1032739660 7:134725798-134725820 CATCATAAGAGTGAGGCAGGAGG + Intergenic
1032792783 7:135254639-135254661 CCTTGTCCCAGGCAGGCAGGAGG + Intronic
1032890015 7:136183936-136183958 ACTTACAAGAGGGAGGCAGAGGG + Intergenic
1033189637 7:139265665-139265687 GCTTAGAAGAGGGAGGCAGAAGG + Intronic
1033247256 7:139728184-139728206 CCTTGAGAGTGTGAGGCAGGAGG - Intronic
1033331599 7:140421298-140421320 ACTTGGAAGATTGAGGCAGGAGG - Intronic
1033400459 7:141018309-141018331 CTTTGGAAGATGGAGGCAGGTGG - Intergenic
1033566734 7:142586031-142586053 CCTTATAAGAGATAGCCAGGGGG + Intergenic
1033612167 7:142973855-142973877 CTTTGGAAGGCGGAGGCAGGTGG + Intergenic
1034079420 7:148262620-148262642 CTTTATAGGAGGGAGGCAAGAGG - Intronic
1034448134 7:151123695-151123717 CCCAGGAGGAGGGAGGCAGGAGG + Intronic
1034594132 7:152172450-152172472 CTTTGGGAGGGGGAGGCAGGTGG + Intronic
1034762531 7:153686506-153686528 CTTTGGAAGGCGGAGGCAGGCGG - Intergenic
1034786084 7:153927067-153927089 CTTTGGAAGACGAAGGCAGGAGG + Intronic
1034955316 7:155330136-155330158 CTTTCTAAGAGGGAGGCAGAGGG + Intergenic
1035111764 7:156488456-156488478 CCTTGTAGGTGGGAGGGATGTGG - Intergenic
1035141875 7:156770668-156770690 CTTTTAAAGGGGGAGGCAGGAGG + Intronic
1035468304 7:159093900-159093922 CCCTGAAAGAGGGAGTCACGAGG - Intronic
1035903388 8:3481662-3481684 CCATATAAGAGAGAGGCAGAGGG + Intronic
1036123109 8:6039221-6039243 CCTTATCAGACAGAGGCAGGAGG - Intergenic
1036429670 8:8678541-8678563 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1036666872 8:10751204-10751226 CTTTGGAAGGGTGAGGCAGGTGG - Intronic
1036814698 8:11892956-11892978 CTTTGGGAGGGGGAGGCAGGTGG - Intergenic
1036885729 8:12551516-12551538 CTTTGGAAGGGTGAGGCAGGAGG - Intergenic
1037034943 8:14154736-14154758 CCTTCAAAGAGGGAGAGAGGAGG - Intronic
1037044555 8:14282227-14282249 CCTTTAAAGAGGGATACAGGCGG - Intronic
1037105026 8:15096329-15096351 CTTTGGGAGATGGAGGCAGGTGG - Intronic
1037241821 8:16786076-16786098 CCTTATAAGAGAAAGGTAGGGGG + Intergenic
1037352162 8:17971986-17972008 CTTTGGAAGGCGGAGGCAGGAGG - Intronic
1037479489 8:19290828-19290850 CCTTGAAAGGCCGAGGCAGGTGG + Intergenic
1037505367 8:19524179-19524201 CCTTGGAAGGATGAGGCAGGAGG + Intronic
1037509382 8:19566207-19566229 TCTTGTAAGAGAGAGGCAGAGGG + Intronic
1037545748 8:19920137-19920159 CCTTGGAAGGCTGAGGCAGGAGG - Intronic
1037928696 8:22865013-22865035 CCGTGAGAGAGGGAGGCAGGCGG + Intronic
1038025887 8:23590416-23590438 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1038165292 8:25080216-25080238 AAGTGAAAGAGGGAGGCAGGAGG - Intergenic
1038637024 8:29295747-29295769 CTTTGGGAGATGGAGGCAGGTGG - Intergenic
1038701828 8:29856109-29856131 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1038947991 8:32382976-32382998 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1039008188 8:33064358-33064380 CCTTGGGAGGTGGAGGCAGGTGG - Intergenic
1039372625 8:37002105-37002127 CCCTGTAAGAGGGAGGCAAGAGG - Intergenic
1039513185 8:38108041-38108063 CTTTGGAAGGGTGAGGCAGGAGG - Intronic
1039550785 8:38441339-38441361 CATTGTGAGAGGTAGGGAGGAGG - Intronic
1039957729 8:42220096-42220118 CTTTGAGAGAGTGAGGCAGGAGG + Intergenic
1040496789 8:47972798-47972820 CCTTGTGAGGCCGAGGCAGGTGG - Intronic
1040636111 8:49274857-49274879 CCGGCTAAGATGGAGGCAGGCGG - Intergenic
1041395998 8:57391773-57391795 TCTTATAAAAGGGAGGCAAGTGG + Intergenic
1041639209 8:60178857-60178879 CTTTGGGAGACGGAGGCAGGAGG - Intergenic
1041692807 8:60705206-60705228 CCTGGAAACAAGGAGGCAGGAGG + Intronic
1041721574 8:60980899-60980921 CCTCATAAGAGAGAGGCAGAGGG + Intergenic
1041734043 8:61091142-61091164 CCTTACAGGAGGGATGCAGGAGG + Intronic
1041936226 8:63334959-63334981 TTTTATAAGAGGGAGGCAGAGGG - Intergenic
1041958482 8:63583727-63583749 CCTTTTAAGAAGGAGGGGGGTGG + Intergenic
1042127691 8:65555256-65555278 CTTTATAAGAGGGAGGCAGGAGG - Intergenic
1042212207 8:66392056-66392078 CTTTGGAAGAGAGAGGCAGGTGG - Intergenic
1042216723 8:66435518-66435540 CCTTATAAAAGGGAGGCAGAGGG - Intronic
1042255793 8:66802443-66802465 CTTTGCAAGACTGAGGCAGGAGG + Intronic
1042346639 8:67734163-67734185 CTTGATAAGAGGGAGGCTGGTGG - Intronic
1042350232 8:67769509-67769531 CCTTGTAAGAGGGATGCAGGAGG + Intergenic
1042858146 8:73287832-73287854 TATATTAAGAGGGAGGCAGGAGG + Intergenic
1042946965 8:74164836-74164858 CTTTGGAAGGTGGAGGCAGGAGG + Intergenic
1043186511 8:77158426-77158448 CCTTGTAAGAGAGAGACAGAGGG + Intergenic
1043433320 8:80215187-80215209 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1043471503 8:80567422-80567444 CTTTGGAAGACTGAGGCAGGCGG - Intergenic
1043564271 8:81530769-81530791 CCTTTTAAGAGGGAGGAAGAGGG + Intronic
1044512348 8:93097168-93097190 CTTAGGAAGAGGGAGGCAGAGGG - Intergenic
1044531321 8:93310686-93310708 TCTAATAAGAGGGAGGCAGGAGG + Intergenic
1044828362 8:96220354-96220376 TTTTATAAGAGGGAGGCAGGAGG + Intergenic
1044879439 8:96708094-96708116 GCTTGGAAGATGGAGGAAGGGGG - Intronic
1044942696 8:97359759-97359781 CCTGGTAAGGGAGAGGCAGAGGG + Intergenic
1044997862 8:97854339-97854361 CCTTGGAAGAAGGAGACAGGAGG + Intergenic
1045323820 8:101101956-101101978 CCCTATAAGAGGGAGGTATGAGG - Intergenic
1045478508 8:102574293-102574315 CCTTAGAAGAGGGAGGCAGAAGG + Intergenic
1045529907 8:102974624-102974646 CTTTGTAAGAGGCAGGCAGGAGG - Intronic
1045651753 8:104347915-104347937 TCTTATAAGAGGGAGGCAGGAGG + Intronic
1045677698 8:104626560-104626582 CCTTCTAAGAGAGAAGCAGGGGG - Intronic
1045870952 8:106926355-106926377 CTTTGTGAGACTGAGGCAGGTGG - Intergenic
1045987911 8:108271144-108271166 CCTTATAAGACAGAGGCAGTGGG - Intronic
1046222823 8:111237730-111237752 CCCTATAAGAGGGAGGGAGAGGG - Intergenic
1046414771 8:113898585-113898607 CCTTATATGAGGGAGGGAGGAGG - Intergenic
1046629525 8:116609491-116609513 TCTTGTAAAAGGAAGGCAAGAGG - Intergenic
1046631225 8:116624896-116624918 ACTTATAAGAGGGAGGCAAGAGG - Intergenic
1046821997 8:118643986-118644008 CCTTATGAAAGGGATGCAGGAGG - Intergenic
1046886675 8:119375181-119375203 CCTAATAAGAAGGAGGCAGGAGG + Intergenic
1047002440 8:120586540-120586562 CCTTATAAGAGGGAGGCAGGAGG - Intronic
1047063475 8:121253581-121253603 CCTTAGAAGAGGGAGGAAGAAGG - Intergenic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047201521 8:122771601-122771623 CTTTATAAGAGGGAGGCAAAAGG - Intergenic
1047222090 8:122926870-122926892 CATTCTAAGAGAGAGGCAGAGGG - Intronic
1047222872 8:122932640-122932662 CCTTATGAGAGGGAGACAGGAGG - Intronic
1047237873 8:123058283-123058305 CCTTGTGAGGGGGAGGAAGAAGG - Intronic
1047319421 8:123765710-123765732 CCTTATTAGAGGGAGGCAGGGGG - Intergenic
1047485361 8:125325706-125325728 CTTTGGAAGACCGAGGCAGGAGG + Intronic
1047613346 8:126542367-126542389 CTTTACCAGAGGGAGGCAGGAGG - Intergenic
1047632425 8:126722786-126722808 GCTTGTAGGAGGGAAGAAGGGGG - Intergenic
1047655250 8:126970352-126970374 CCTTAAAAGATGGAGGCAGGAGG - Intergenic
1047671694 8:127154925-127154947 CTATGTAAAAGTGAGGCAGGTGG + Intergenic
1047704702 8:127486140-127486162 ACTGGGAAGAGTGAGGCAGGAGG + Intergenic
1047717756 8:127611268-127611290 CCTTGTAAGAGAAGGGCAGAGGG + Intergenic
1047738584 8:127788630-127788652 CTTCGTAAGATTGAGGCAGGTGG - Intergenic
1047771786 8:128035744-128035766 CCTTATTAGAGGGAGGCAGAGGG + Intergenic
1048048403 8:130794485-130794507 CCTTGGAAGGCCGAGGCAGGCGG - Intronic
1048131080 8:131698293-131698315 CTTTGTAAGGCTGAGGCAGGAGG + Intergenic
1048218001 8:132514304-132514326 CCTTATAAGAGGATGCCAGGTGG - Intergenic
1048237842 8:132709552-132709574 CCTTTAAAGAGGGAGGTAGAGGG + Intronic
1048292857 8:133193807-133193829 CCTTGGACCAGGGAGGCAGGAGG - Intronic
1048322434 8:133410586-133410608 CCTTAGGAGAGGGAGGCAGGAGG + Intergenic
1048356228 8:133656230-133656252 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
1048404376 8:134104912-134104934 CCTTAAAAGAGGGAGGAAGGAGG + Intergenic
1048455585 8:134575326-134575348 CCTTATAAAAGGAAGGCAGGAGG + Intronic
1048773241 8:137918482-137918504 CCTTCGAAGACAGAGGCAGGAGG + Intergenic
1048917817 8:139201420-139201442 CCTTATAAGAGAGAGGCAGAAGG - Intergenic
1048922731 8:139245787-139245809 TCTTTTAAGGGGTAGGCAGGGGG + Intergenic
1048974830 8:139665373-139665395 CTTTATAAGAGGGAGGCAGGAGG - Intronic
1049080207 8:140437070-140437092 ACTTGTGAGGGTGAGGCAGGAGG - Intronic
1049087157 8:140487711-140487733 CTTTGGAAGGCGGAGGCAGGTGG - Intergenic
1049358525 8:142200647-142200669 CCTTTTAAGAGGAAGGCAGGTGG + Intergenic
1049543544 8:143219187-143219209 CCCTGTAAGAAGGAGGCCGAGGG - Intergenic
1049569467 8:143362133-143362155 CTTTGGGAGACGGAGGCAGGCGG + Intergenic
1049643322 8:143725188-143725210 CCTTGAGAGAGGGAGGGAGCGGG + Exonic
1049732015 8:144183270-144183292 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
1050186840 9:2983591-2983613 CCTTGTAAGAGGGAGGCAGGAGG + Intergenic
1050265985 9:3890160-3890182 ATTTGTGAGAGTGAGGCAGGTGG - Intronic
1050523443 9:6525317-6525339 ACTTGTGAGGGTGAGGCAGGAGG + Intergenic
1050588513 9:7138708-7138730 CCTTGGGAGACTGAGGCAGGAGG + Intergenic
1050642515 9:7683483-7683505 CTTTATAAGAGAGAGGGAGGCGG + Intergenic
1050646359 9:7723789-7723811 CCTTATAAGAGTGGGGCAGGAGG + Intergenic
1050753053 9:8963855-8963877 CTTTGGAAGACCGAGGCAGGAGG - Intronic
1051107740 9:13599343-13599365 CTTTGGAAGATTGAGGCAGGAGG + Intergenic
1051112593 9:13656267-13656289 CCATGTCGAAGGGAGGCAGGTGG + Intergenic
1051301725 9:15658622-15658644 CCTTATAACAGGGAGGCAGGAGG + Intronic
1051589166 9:18758635-18758657 CCTTAGAAGAGGGAGGCAGGAGG - Intronic
1051724285 9:20072665-20072687 CTTTTTAAGAGAGATGCAGGAGG + Intergenic
1051734966 9:20188631-20188653 CCTTACAAGAGGGAGGCAGAAGG + Intergenic
1052183108 9:25555430-25555452 CCTTATAAGAGGGAGGTAGGGGG - Intergenic
1052293178 9:26867345-26867367 CCTTATATGAGGGAAACAGGAGG - Intronic
1052312202 9:27079699-27079721 CCTTATAAGAGGGAGACAAGGGG + Intergenic
1052528102 9:29647662-29647684 CCTTGTGAGGGGGAGCCTGGTGG - Intergenic
1052684966 9:31744080-31744102 CCTTATAAGAGAGAGGAAGGAGG - Intergenic
1052738743 9:32373085-32373107 TCTTATAAGAGAGAGGCAAGAGG + Intergenic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1053710388 9:40801174-40801196 ATTTGCAAGAGGGAGGAAGGAGG - Intergenic
1053804107 9:41784072-41784094 CCTTTTAAGAGGGAGGCAGGAGG + Intergenic
1053894963 9:42733703-42733725 CTTTGGGAGAGTGAGGCAGGTGG - Intergenic
1054141175 9:61531387-61531409 CCTTTTAAGAGGGAGGCAGGAGG - Intergenic
1054166218 9:61732744-61732766 CCTTGTAAAAAGGAGACAGAGGG - Intergenic
1054192413 9:61995568-61995590 CCTTTTAAGAGGGAGGCAGGAGG + Intergenic
1054420296 9:64921963-64921985 ATTTGCAAGAGGGAGGAAGGAGG - Intergenic
1054460865 9:65461823-65461845 CCTTTTAAGAGGGAGGCAGGAGG - Intergenic
1054645993 9:67593123-67593145 CCTTTTAAGAGGGAGGCAGGAGG - Intergenic
1054919218 9:70525148-70525170 ACTTGTAAAAGTGAGGCAGGAGG - Intergenic
1055199444 9:73641572-73641594 CCTTATAAAAGGAAGACAGGAGG - Intergenic
1055245697 9:74239898-74239920 CCTTATAAGAGGGAGCCAGGAGG + Intergenic
1055250017 9:74292840-74292862 CCTTGGAAGGCCGAGGCAGGTGG + Intergenic
1055439461 9:76324167-76324189 CTTTGGAAGGGCGAGGCAGGTGG - Intronic
1055445691 9:76380051-76380073 CCTTGGGAGACTGAGGCAGGAGG + Intergenic
1055827926 9:80349041-80349063 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1056220706 9:84448285-84448307 CCTTACCAGAGGGAGGCAGGAGG + Intergenic
1056227148 9:84506663-84506685 CCATTCAAGAAGGAGGCAGGAGG + Intergenic
1056233339 9:84568915-84568937 CCTTCTAAGAAGGAAGCAGAGGG + Intergenic
1056335056 9:85560116-85560138 TGTTGGAAGATGGAGGCAGGTGG + Intronic
1056493869 9:87136429-87136451 CCTGATAAGAGGGAGGTTGGGGG + Intergenic
1056512089 9:87315931-87315953 TCTTATAAGAGGGAGGGAGAGGG + Intergenic
1056665904 9:88580396-88580418 CTTTGGAAGACCGAGGCAGGTGG - Intronic
1056746219 9:89306170-89306192 CCTTAGAGGAGGGAGACAGGAGG - Intergenic
1056983801 9:91342294-91342316 TCATACAAGAGGGAGGCAGGAGG - Intronic
1057081741 9:92178723-92178745 CCTTGTGGGAGGGAGTGAGGGGG + Intergenic
1057146504 9:92762959-92762981 GCGTGTGATAGGGAGGCAGGGGG - Intronic
1057169453 9:92952478-92952500 CTTTGGAAGGGCGAGGCAGGCGG - Intronic
1057200283 9:93136061-93136083 CCTTCTAAGAGGAAGCCGGGAGG + Intergenic
1057234410 9:93347024-93347046 CTTTGGAAGACCGAGGCAGGTGG + Intergenic
1057405354 9:94765354-94765376 CTTTGGAAGACAGAGGCAGGAGG + Intronic
1057415580 9:94859400-94859422 CCTTGTAAGAGGCAGGCAAAGGG - Intronic
1057794621 9:98146361-98146383 GCTGGTTAGAGGGAGGCTGGAGG - Intronic
1057863424 9:98660828-98660850 TCTTATAAGAAGGAGGCAGGAGG - Intronic
1057887733 9:98843648-98843670 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1057954307 9:99395683-99395705 CCTTTCAAGAGCAAGGCAGGAGG + Intergenic
1057977100 9:99617528-99617550 ACTTGGAAGATGGTGGCAGGAGG - Intergenic
1058136007 9:101308235-101308257 CCTTATAAGAGACAGGCAGGAGG + Intronic
1058156277 9:101519400-101519422 CTTTGGGAGGGGGAGGCAGGTGG - Intronic
1058283837 9:103151191-103151213 TGTTGTGAGAGGGATGCAGGGGG + Intergenic
1058886180 9:109322754-109322776 CCTTATAAGAGGGAAGCGGGAGG + Intergenic
1058892747 9:109374967-109374989 GCTAGTAGGAGGGAGGCAAGGGG - Intergenic
1059014114 9:110495394-110495416 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1059022630 9:110593093-110593115 CTTTGGGAGATGGAGGCAGGAGG - Intergenic
1059032446 9:110713501-110713523 CTTTGGAAGACTGAGGCAGGTGG - Intronic
1059075981 9:111194515-111194537 CCTTATAAAAGTGAGGCAGAAGG - Intergenic
1059306681 9:113358917-113358939 CTTTGGAAGACTGAGGCAGGAGG + Intronic
1059336472 9:113572290-113572312 TCATGACAGAGGGAGGCAGGAGG + Intronic
1059541677 9:115136598-115136620 ACTTGAAAGAGAGAGGCTGGGGG + Intergenic
1059561285 9:115337059-115337081 CCTTATAAGAAGGAGGCAAAGGG - Intronic
1059717600 9:116928089-116928111 ATTTGGAAGAGGGAGGCAGTTGG - Intronic
1059983584 9:119799530-119799552 CTTTATAAGAGGGAGGCTGGAGG - Intergenic
1060007792 9:120015678-120015700 CCTGGTGGGTGGGAGGCAGGTGG - Intergenic
1060151476 9:121291661-121291683 CTTTGGGAGACGGAGGCAGGTGG - Intronic
1060541033 9:124430273-124430295 TCTTACAAGAGGGAGGCAGGAGG + Intergenic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1061103907 9:128514228-128514250 ACTTGTGAGACTGAGGCAGGAGG + Intronic
1061146873 9:128804970-128804992 CTTTGGGAGAGGGAGGTAGGCGG - Intronic
1061162159 9:128901796-128901818 CCCTGTAGGGGGCAGGCAGGTGG + Intronic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061755751 9:132811325-132811347 CCTTATAAGAAGGAGGTAAGAGG + Intronic
1061784881 9:133021640-133021662 CTTTGGGAGACGGAGGCAGGCGG + Intergenic
1061927913 9:133815186-133815208 CCAGGGAAGAGGGAGGCGGGCGG - Intronic
1062067262 9:134535465-134535487 CCTTACAACAGGGAGGCAGGGGG - Intergenic
1062126864 9:134868653-134868675 CCTTGCAGATGGGAGGCAGGGGG - Intergenic
1062144904 9:134983538-134983560 CCTTATGAGAGGGAGGCAGGAGG + Intergenic
1062171429 9:135137039-135137061 CCTTATAAAAGGGAGTTAGGAGG + Intergenic
1202786148 9_KI270719v1_random:21706-21728 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1185554787 X:1011934-1011956 CTTTGTAAGGCTGAGGCAGGAGG - Intergenic
1185572538 X:1145845-1145867 CTTTGGGAGAGGGAAGCAGGAGG + Intergenic
1185650915 X:1647614-1647636 CCTTATGAGAGGGAGGCAAGAGG - Intergenic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1185882107 X:3750694-3750716 CCTTATAAGAGGGAAGTAGGAGG + Intergenic
1185882591 X:3754740-3754762 CCTTCTAAGAGGGAGGCAGGAGG + Intergenic
1185894591 X:3846268-3846290 CCTTGGGAGACCGAGGCAGGAGG - Intergenic
1185899709 X:3884692-3884714 CCTTGGGAGACCGAGGCAGGAGG - Intergenic
1185904825 X:3923121-3923143 CCTTGGGAGACCGAGGCAGGAGG - Intergenic
1186022739 X:5274639-5274661 CCTTGGGAGACTGAGGCAGGTGG - Intergenic
1186055066 X:5641591-5641613 CCTTCTAAGCTGAAGGCAGGAGG - Intergenic
1186103643 X:6182675-6182697 CCTTACAAGAGGGAGGCAGGAGG + Intronic
1186139366 X:6554815-6554837 CTTTATAAGAGAGAGGTAGGAGG + Intergenic
1186145250 X:6618161-6618183 CCTTATAAGAAAGAGGCAAGAGG + Intergenic
1186197091 X:7120308-7120330 CCTTATAAGAGGCGGCCAGGAGG + Intronic
1186329253 X:8514691-8514713 AAGTGGAAGAGGGAGGCAGGAGG + Intergenic
1186361683 X:8848923-8848945 CCTCATTAGAGGGAGGCAAGTGG + Intergenic
1186412121 X:9353280-9353302 CCTGGTAAGAGAGAGACATGTGG + Intergenic
1186428543 X:9484836-9484858 CCTTGGAAGGCTGAGGCAGGAGG + Intronic
1186489361 X:9959521-9959543 TCTTGTGTGAGGGAGGCAAGAGG - Intergenic
1186497421 X:10022710-10022732 CCTTACTAGAGGGAGGGAGGAGG + Intronic
1186513818 X:10151036-10151058 CATTATAAAAGGGAGGCAGGAGG - Intergenic
1186526077 X:10249518-10249540 CCTTAGAAGAAAGAGGCAGGAGG + Intergenic
1186594041 X:10961204-10961226 TCTTATAAGAGGGAGGCAGGAGG + Intergenic
1186698883 X:12068022-12068044 CCTTATAAGAGGGAGTCAGTAGG + Intergenic
1186894163 X:13989344-13989366 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
1186894880 X:13995736-13995758 CCTTATAAGAGGGAGGGAGGTGG - Intergenic
1187093075 X:16117821-16117843 TCTTATAAGTGGGAGGCAGTGGG + Intergenic
1187167639 X:16819556-16819578 CTTTGGCAGAGAGAGGCAGGTGG - Intronic
1187168877 X:16831322-16831344 GCTCGGAAGAGTGAGGCAGGAGG + Intronic
1187295870 X:17999981-18000003 CCTTATAAGAGGAAGACAGAGGG - Intergenic
1187492690 X:19766864-19766886 CCTTATAAGAGGGAAGCACATGG - Intronic
1187506258 X:19880786-19880808 CCTCATAAAAGGCAGGCAGGTGG + Intronic
1187922693 X:24220524-24220546 CTTTGGGAGGGGGAGGCAGGTGG - Intergenic
1187948110 X:24446178-24446200 TCTTATAAGAGGGAGACAGGAGG + Intergenic
1188014938 X:25098041-25098063 CCTTGGGAGACTGAGGCAGGTGG - Intergenic
1188152485 X:26695197-26695219 TCTTATAAGAGGGAGGCAGAAGG + Intergenic
1188290528 X:28382205-28382227 TCTTGTAAGAGGGACTCAGGAGG - Intergenic
1188999585 X:36929382-36929404 CTTTGGGAGGGGGAGGCAGGTGG + Intergenic
1189058892 X:37730672-37730694 CCTAGTCAGTGGGAGGCTGGTGG - Exonic
1189229403 X:39440525-39440547 GCCTGCAAGATGGAGGCAGGAGG + Intergenic
1189246703 X:39568882-39568904 CTTTATTAGAGGGAGGCAGGAGG - Intergenic
1189454683 X:41175275-41175297 CTTTGTGAGGGTGAGGCAGGAGG + Intronic
1189483069 X:41407972-41407994 CTTTCTGAGAGGGAGGCAAGAGG - Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1189536279 X:41938596-41938618 GTTTATAAGGGGGAGGCAGGAGG - Intergenic
1189705167 X:43752347-43752369 TCTCTTAAGAGGGAGGCAGGAGG - Intergenic
1189929293 X:45990882-45990904 CGCTGTAAGAGGTGGGCAGGAGG - Intergenic
1190179835 X:48182854-48182876 CTTTGGGAGACGGAGGCAGGTGG - Intergenic
1190259572 X:48789641-48789663 CCTCTGAAGAGGGTGGCAGGTGG - Intronic
1190517063 X:51234793-51234815 TCTTGTAAGAGGGAAGAAGCAGG + Intergenic
1190577877 X:51859724-51859746 CCTTATAAGAGAGAGGCAGGAGG + Intronic
1190703926 X:53009631-53009653 ACTTGGAAGACTGAGGCAGGAGG + Intergenic
1191631761 X:63329835-63329857 CCTTATAAGAGGGAGGCATGTGG + Intergenic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1191801936 X:65091165-65091187 CCTTATAAGAGGGAGACAGAAGG + Intergenic
1191844566 X:65537169-65537191 CCTTTTAAAATGGAGGCTGGGGG - Intergenic
1192207283 X:69104990-69105012 CCTCAGAAGAGAGAGGCAGGGGG + Intergenic
1192473306 X:71418338-71418360 CTTTGTGAGACTGAGGCAGGAGG - Intronic
1195272462 X:103245400-103245422 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1195509098 X:105693715-105693737 CCTTATAAGAGAGAGGCAGAAGG + Intronic
1195604331 X:106785444-106785466 CCTTATAAGAGGGAGAGAGAGGG + Intronic
1195664559 X:107416982-107417004 CCTTATAAGAGGGATGCAGAGGG + Intergenic
1195781409 X:108469386-108469408 CTTTGGAAGACCGAGGCAGGAGG - Intronic
1195901633 X:109803790-109803812 CTTTGGAAGGCGGAGGCAGGCGG - Intergenic
1196352569 X:114749203-114749225 CCTTGGAATGCGGAGGCAGGAGG + Intronic
1196391061 X:115207881-115207903 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196391151 X:115208905-115208927 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196648712 X:118146982-118147004 CTTTGAAAGACTGAGGCAGGAGG + Intergenic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1196770769 X:119291147-119291169 CCCTGTAAGAGGGAGGCAGGAGG + Intergenic
1196831639 X:119780438-119780460 CTTTGGAAGACTGAGGCAGGAGG - Intergenic
1197630807 X:128855519-128855541 CCTTGGGAGACTGAGGCAGGCGG + Intergenic
1197959019 X:131983597-131983619 ACTTGGAAGGTGGAGGCAGGAGG + Intergenic
1197985603 X:132263640-132263662 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1198181258 X:134211772-134211794 CTTTGGAAGACTGAGGCAGGAGG + Intergenic
1198279484 X:135127646-135127668 ACTTTTAAGAGGGAGGCAGAGGG - Intergenic
1198279991 X:135132371-135132393 CCTTGCAAGAGGGAGGCAGGAGG - Intergenic
1198290966 X:135240143-135240165 CCTTGCAAGAGGGAGGCAGGAGG + Intergenic
1198291472 X:135244868-135244890 ACTTTTAAGAGGGAGGCAGAGGG + Intergenic
1198506982 X:137310664-137310686 CCTTGTAAGAGAGAGGCAGGGGG + Intergenic
1198687658 X:139244618-139244640 CCTCATAAGAGGGAGTCAGGAGG + Intergenic
1199228940 X:145412223-145412245 CCTTATAAGGTGAAGGCAGGAGG - Intergenic
1199297683 X:146177561-146177583 CTTTGGAAGACTGAGGCAGGTGG + Intergenic
1199362009 X:146931803-146931825 TCTTATAAGAGGGATGTAGGAGG - Intergenic
1199524343 X:148775772-148775794 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1199675739 X:150187803-150187825 CTTTATAAGGGGGAGGCAGAAGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199691893 X:150314777-150314799 CCTTCTAAGAGAGAGGCAGAGGG - Intergenic
1199732817 X:150653367-150653389 CCTGATAAGAGAGAGGCAGAGGG - Intronic
1199757358 X:150877576-150877598 CTTTGAAAGACTGAGGCAGGAGG + Intronic
1199787647 X:151119129-151119151 CCTTATAAGAGAGAGGCGGCTGG + Intergenic
1200074596 X:153544848-153544870 CTCTGGAGGAGGGAGGCAGGGGG - Intronic
1200258661 X:154599863-154599885 CCTTGCAAGTGGGAAGCATGCGG - Intergenic
1200782402 Y:7228574-7228596 CCTTCTAAGAGGGAGGCAGGAGG - Intergenic
1200782867 Y:7232512-7232534 CCTTATAAGAGGGAAGTAGGAGG - Intergenic
1201407735 Y:13665350-13665372 CCTTGGAGAAGAGAGGCAGGAGG + Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic