ID: 1142000424

View in Genome Browser
Species Human (GRCh38)
Location 16:87661203-87661225
Sequence CCTCCTGCCTCCCTCTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1431
Summary {0: 4, 1: 41, 2: 126, 3: 365, 4: 895}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000410_1142000424 27 Left 1142000410 16:87661153-87661175 CCCTCCTCCACCTTCAGAGCCAG 0: 4
1: 35
2: 254
3: 602
4: 1303
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000420_1142000424 -9 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000416_1142000424 20 Left 1142000416 16:87661160-87661182 CCACCTTCAGAGCCAGCGGGGCA 0: 1
1: 0
2: 3
3: 24
4: 224
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000418_1142000424 8 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000413_1142000424 23 Left 1142000413 16:87661157-87661179 CCTCCACCTTCAGAGCCAGCGGG 0: 1
1: 0
2: 8
3: 61
4: 460
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000417_1142000424 17 Left 1142000417 16:87661163-87661185 CCTTCAGAGCCAGCGGGGCAGCC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000419_1142000424 -4 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895
1142000411_1142000424 26 Left 1142000411 16:87661154-87661176 CCTCCTCCACCTTCAGAGCCAGC 0: 1
1: 15
2: 48
3: 203
4: 897
Right 1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 126
3: 365
4: 895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000424 Original CRISPR CCTCCTGCCTCCCTCTTACA AGG Intronic
900239708 1:1610008-1610030 CCTCCTGGCTCCATTTTTCAGGG - Intergenic
900607085 1:3528606-3528628 CCTCCTGCCTCCCTCTTATAAGG - Intronic
901071371 1:6520593-6520615 CCTCCTGCCTCAGCCTTCCAAGG + Intergenic
901104065 1:6741692-6741714 TCTCATGCCTCCCTCTTCTAAGG + Intergenic
901143530 1:7050784-7050806 CCGCCTGCCTCACCCTGACAAGG - Intronic
901170571 1:7254018-7254040 CCTCCTGCATCCCCCACACAGGG - Intronic
901461625 1:9395396-9395418 CCTCCTGCCTCTAGCTTATAAGG + Intergenic
901761932 1:11477501-11477523 CCTCCTCCCACCCTCTCACATGG + Intergenic
901826018 1:11861847-11861869 CCTCTGGCTTCCCTCTTATAAGG - Intergenic
901945663 1:12701629-12701651 TCTCCTGCCTCCTTCTTAGAAGG - Intergenic
901955190 1:12778980-12779002 CCTACTGCCTCCCTGTTATGAGG - Intergenic
902041203 1:13493621-13493643 CTGCCTGCCTCCCTTTTATAAGG - Intronic
902085081 1:13853746-13853768 TCTCCTGCCTCCCTCCTAAAGGG + Intergenic
902257915 1:15202640-15202662 CTTTCTGCTTCCCTCTTATAAGG + Intronic
902489933 1:16774057-16774079 CCTCCTGCCTCCCTCCTGTAAGG - Intronic
902574219 1:17367146-17367168 CCCTCTGCCTCCCCCTTATAAGG + Intergenic
902659765 1:17892904-17892926 CCCTCTGCCTCCCTCCTACGAGG - Intergenic
902666181 1:17940259-17940281 CCTCCTGCCTCCTTCTTATAAGG + Intergenic
902722382 1:18312662-18312684 CCTCCTGTCTCCCTCCAATAAGG + Intronic
902753237 1:18532017-18532039 CCCTCTGCCTCCCTCTTATAAGG - Intergenic
902940483 1:19797380-19797402 CCCCCTGCCTCCCTTTTCCCAGG - Intronic
903041175 1:20531890-20531912 CCTTCTGCCTCCTTCTTATAAGG - Intergenic
903237135 1:21957266-21957288 CCTCCTGCACCCTCCTTACAGGG - Intergenic
903237579 1:21960089-21960111 CCTCCTGCCTCAGTCTCCCAGGG - Intergenic
903412510 1:23157431-23157453 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
903672325 1:25043823-25043845 CCTCCTGCATCCATCTGAAAAGG + Intergenic
904274462 1:29371216-29371238 CCTCCAGCCTCCCCATTGCAGGG + Intergenic
904389775 1:30174746-30174768 CCTCCTGCCTCCCTCTTGTAAGG - Intergenic
904590390 1:31611642-31611664 CCTCTTGCCTCCCTCTTATAAGG + Intergenic
904828167 1:33289093-33289115 CCTCCTACTTCCCTCTCTCAAGG - Intronic
904916235 1:33972529-33972551 CCTCCTGCCCCCCTCTTATAAGG - Intronic
904968560 1:34400551-34400573 CCCTCTGCCTCTCTCTTATAAGG + Intergenic
904982817 1:34521281-34521303 CCTCTTGCCTTCCTCTTATAAGG + Intergenic
905265211 1:36748659-36748681 TCTCCAGCCTCCCTCTCATAAGG + Intergenic
905410187 1:37763367-37763389 CCTCCTGCACCCCTCATACAAGG + Intronic
905475962 1:38228240-38228262 CCCTCTGCCTCCCTCTTATAAGG - Intergenic
905686174 1:39910230-39910252 CCTCCTGCCTCAGTCTCCCAAGG - Intergenic
905714872 1:40140321-40140343 CTCTCTGCCTCTCTCTTACAAGG + Intergenic
905803194 1:40858973-40858995 CCTCCTGCATCCCTCCAAAAGGG - Intergenic
906236203 1:44212708-44212730 CCTCCTGTCTCTCTCTTTCCAGG + Intergenic
906362947 1:45179863-45179885 CCTCTTGCCTCCCTCTTATAAGG - Intronic
906517237 1:46446921-46446943 ACTCAGACCTCCCTCTTACAGGG - Intergenic
906568906 1:46819809-46819831 CCTCCTATCTCCCTCCCACAGGG - Intergenic
906605046 1:47162907-47162929 TCCTCTGCCTCCCTCTTATAAGG + Intergenic
906646217 1:47477377-47477399 CTTCCTGCCTCCCTCTTATAGGG + Intergenic
906857774 1:49327089-49327111 CTTCCAGTCTCCCTCTTACAAGG + Intronic
906935631 1:50211798-50211820 CCTCCCACCTCCCTTTTAAAAGG - Intergenic
907290906 1:53412357-53412379 CCTTCTGCCTCCTTCATGCAGGG - Intergenic
907463727 1:54621644-54621666 CCTCCTGGACCCCTCTTACAAGG - Intronic
907523058 1:55037840-55037862 CCTCCTGCCTTCCTCCTTCAGGG - Intergenic
907580577 1:55568620-55568642 CTTCCTGTATCCCTCTTATAAGG - Intergenic
907932258 1:59011475-59011497 CCCTCTGCCTCTCTCTTAAAAGG - Intergenic
908087609 1:60653133-60653155 CTTCCTGCCTTCATCTTATAAGG + Intergenic
908342589 1:63197067-63197089 TCTCCAGCCTCCCTCTTAAAAGG + Intergenic
908416048 1:63914388-63914410 CCTCCTGCCTTCCTCTCCCTAGG - Intronic
908452610 1:64270883-64270905 CCTTCTGCCTCGGTCTTCCAAGG - Intergenic
908567926 1:65377804-65377826 CCTCCTGCCTCCCTTTCCCATGG + Intronic
908859152 1:68463813-68463835 CCTCCTGCTTTCCTCTTATAAGG + Intergenic
909042809 1:70674223-70674245 CCTTCTGCGCCCCTCTTATAAGG + Intergenic
909454813 1:75838339-75838361 CCTCCTGCCACCCTCTTGTAAGG + Intronic
910240020 1:85076212-85076234 CCTCCTGTCACCATCTTATAAGG + Intronic
910418959 1:87034951-87034973 TCTCTTGCCTCCCTCTTATAAGG - Intronic
910733761 1:90428664-90428686 CCCTCTGCCTCCCTCTCAAAAGG - Intergenic
911026042 1:93436057-93436079 TCTGTTGCCTCCTTCTTACAAGG + Intergenic
911115067 1:94237909-94237931 CCTTTTTCCTCCCTCTTCCAGGG + Intronic
911740531 1:101382357-101382379 CTTCCTGCCGCCCTCTTTCAAGG + Intergenic
911788849 1:101985179-101985201 CCTCCAGCCTTCCTCTTAAAAGG + Intronic
912148894 1:106831775-106831797 ACTCCTACCTCCCTTTTATAAGG + Intergenic
912477131 1:109945971-109945993 CCCCCTGCCTTCCTCTTATAAGG + Intergenic
912507370 1:110165496-110165518 CCTGCTGCCCTCCTCTTCCAAGG - Intronic
912881422 1:113419971-113419993 CCTCCTACTACCCTCTTAGAAGG + Intronic
913582355 1:120238772-120238794 CCTCCAGTGTCCCTCTTACTAGG + Intergenic
913625818 1:120659611-120659633 CCTCCAGTGTCCCTCTTACTAGG - Intergenic
914254877 1:145953754-145953776 CATCCTGCCTCCCTCTTATAAGG - Intronic
914334425 1:146701531-146701553 CCCTCTGCCTCCCTCATATAAGG + Intergenic
914564290 1:148850247-148850269 CCTCCAGTGTCCCTCTTACTAGG + Intronic
914608536 1:149279992-149280014 CCTCCAGTGTCCCTCTTACTAGG - Intergenic
914991974 1:152506710-152506732 CCTTTTGCCTCCCTCTTGTAAGG + Intergenic
915473663 1:156139949-156139971 CCTCTTGCCTTCCTCCTCCACGG - Exonic
915606877 1:156957791-156957813 CCTCCTGTCTTCCTCATACTTGG + Exonic
915936614 1:160093436-160093458 CCTCCTGTCTCCCCCTCACTAGG + Intronic
916181690 1:162089661-162089683 CCCCCTCCCTCCCTCTTGTAAGG - Intronic
916292759 1:163184649-163184671 CCTCCTGCCTTCTTCTTACAAGG - Intronic
916295979 1:163220795-163220817 CCTCCTGCCTTGCTCTTGTAAGG - Intronic
916632889 1:166636002-166636024 CCTCCTGCTTCCTTCTTATAAGG + Intergenic
916757107 1:167782755-167782777 CCTTCTGCCTCCCTCTTCTAAGG - Intronic
916757575 1:167787799-167787821 CCTTCTGCTTCCCTTTTCCAGGG + Exonic
916801886 1:168223572-168223594 CCCTCTGCTTCCCTCTTATAAGG + Intergenic
916930751 1:169575955-169575977 TCTCCTGCATCCCTCTGATAAGG - Intronic
917085906 1:171305860-171305882 CCTCCTGCCTCTCTTCTCCAAGG + Intergenic
917902321 1:179554907-179554929 CCATTTGCCTCCCTCTTATAAGG - Intronic
918057261 1:181032825-181032847 CCTTTTGCCTCCCTCTAATAAGG + Intergenic
918226567 1:182488878-182488900 CTCCATGCCTCCCTGTTACATGG - Intronic
918317416 1:183333449-183333471 AATCCAGCCTCCCTCTTATAAGG - Intronic
918743908 1:188173770-188173792 CCATCTGCCTCCCTCTTATAAGG - Intergenic
918992467 1:191715385-191715407 CCTCCTGCATCCCTCTCGAAAGG + Intergenic
919086977 1:192932112-192932134 CCTCCTGTGTCCCTCTTATAAGG + Intergenic
919151162 1:193700749-193700771 ATTCCTGCCTTGCTCTTACAGGG + Intergenic
919178560 1:194052192-194052214 CTTCCTGCGTCCCTCTGATAAGG - Intergenic
919410095 1:197232037-197232059 CCTCCTACCTTTCTCTTATAAGG - Intergenic
920061087 1:203227368-203227390 CTTCCTGGCTCCTTCCTACATGG - Intronic
920617029 1:207503603-207503625 CCTCTTGCCTCCCTTTTATAAGG + Intronic
920645292 1:207798847-207798869 CCCCCTGCCTCCCTCTTAGAAGG - Intergenic
920701926 1:208224408-208224430 CCTCCTGCAGCCCTGTCACATGG - Intronic
921315433 1:213886038-213886060 ACTCCTGCATCTCTCTTATAAGG + Intergenic
921594210 1:217037526-217037548 CCTACTGAGTCCCTCTCACATGG + Intronic
921971232 1:221151382-221151404 CCTCCTGCCTCCCTCCTGTTAGG + Intergenic
922335884 1:224617718-224617740 GCTTCTCCCTACCTCTTACAAGG - Intronic
922597149 1:226822914-226822936 CCTCCTGCCTCCCTCTTATAAGG + Intergenic
922613727 1:226948335-226948357 CTGCCTGCCTCCCTCTTATATGG + Intronic
922654138 1:227366071-227366093 CTGCCTCCCTCCCTCTTATATGG + Intergenic
922932583 1:229402058-229402080 CCTCCTGCCTCCCTCTCATAAGG + Intergenic
923530506 1:234808471-234808493 CCTCCTGCCTCCCTCCCGTAAGG + Intergenic
923773907 1:236961358-236961380 CCCTCAGCCTCCCTCTTATAAGG + Intergenic
924016099 1:239724893-239724915 CCTCCTGCCTCAGCCTCACAAGG + Intronic
924289997 1:242526157-242526179 CCTCCTGCCTCCTCCTCCCAAGG - Intergenic
924398783 1:243654560-243654582 CCTCCTGCCTCAGCCTTCCAAGG + Intronic
924467466 1:244311489-244311511 CCTCCTGCCTCAGCCTCACAAGG + Intergenic
924520214 1:244799801-244799823 GCTCCTGAATCCTTCTTACATGG - Intergenic
924846128 1:247774081-247774103 CATCCTACTTCCCTCTTAGAAGG - Intergenic
924948299 1:248860614-248860636 CCCTCTGCTTCTCTCTTACAAGG + Intergenic
1063375218 10:5550584-5550606 AGTCCTGCCTGCCTCTTATAAGG - Intergenic
1063375224 10:5550643-5550665 AGTCCTGCCTGCCTCTTATAAGG - Intergenic
1063810368 10:9698030-9698052 CCACATACCTCCCTCTTATAAGG - Intergenic
1064487270 10:15806894-15806916 CCTACTTCTTCCCTCTTCCAGGG + Intronic
1065241665 10:23711357-23711379 CCTCTTGCCTCCCTCTTGTAAGG - Intronic
1065378827 10:25068558-25068580 CCTCCTTCCTCCCTCCTCCTAGG - Intergenic
1065619749 10:27568986-27569008 CCTCCTGCCCCTCTCTTGCAAGG + Intergenic
1065620497 10:27576207-27576229 CCCTCTGCCTACCTCTTATAAGG + Intergenic
1065902753 10:30223230-30223252 CCTTCTGCCTCCCTCCTACCTGG + Intergenic
1066456107 10:35573636-35573658 CCTCCTGCCTCACCCTCCCAGGG + Intergenic
1067089283 10:43258426-43258448 CCACCTGCCCTCCTCTTTCATGG + Intronic
1067286127 10:44908739-44908761 CCTCTTCCCTCCCTCTTATGGGG + Intergenic
1067309838 10:45102449-45102471 CCTCCTTCCTCCCTCTTATGAGG + Intergenic
1067371038 10:45682815-45682837 CCTCTCTCCTCCCTCTTTCACGG - Intergenic
1067388744 10:45843335-45843357 CCTCTCTCCTCCCTCTTTCACGG + Intronic
1067417321 10:46113621-46113643 CCTCTCTCCTCCCTCTTTCACGG - Intergenic
1067930176 10:50552834-50552856 CTGTCTACCTCCCTCTTACAAGG - Intronic
1068437674 10:57013702-57013724 CCTCCTGCCTCAGCCTTCCAAGG - Intergenic
1068611876 10:59069278-59069300 CCTCCTGCCGTGCTCTTACCTGG + Intergenic
1068820302 10:61368666-61368688 CCTCCTGCCTCCTTCTAATAAGG + Intergenic
1068988693 10:63129988-63130010 CCTTCTGCCTCCCTCTAGTAAGG - Intergenic
1069062318 10:63906892-63906914 CCTTCTGCCTTCCTCTTATAAGG - Intergenic
1069125023 10:64619411-64619433 CCTTTTGCCTCTCTTTTACAAGG + Intergenic
1069352512 10:67546238-67546260 CCTCCTGCCTCAGCCTTCCAAGG + Intronic
1069489330 10:68848057-68848079 TCTCCTGCCTCCATCTTGCTTGG + Intronic
1069590046 10:69635888-69635910 GCTCCTGCCTCCCTGTGACGGGG + Intergenic
1069654096 10:70075140-70075162 CCCCCTGCCTCCGTCTTCTAAGG + Intronic
1069658590 10:70108524-70108546 CTTCTTGCCTCCCTCTTATCAGG + Intronic
1069869523 10:71524688-71524710 CCTCCTACCTGCTTCTTATAAGG - Intronic
1069880910 10:71592604-71592626 CCCCCTGCCTCCCTCTAATGAGG + Intronic
1069887266 10:71631731-71631753 CCTCTGGCATCCCTCTTAGAAGG - Intronic
1069945431 10:71982204-71982226 TCTTCTGCCTCCCTCTTATAAGG - Intronic
1070384991 10:75916382-75916404 CCTGCTGCCTCTCTCTTGCCAGG - Intronic
1070629442 10:78074475-78074497 CCTCCTGCCTCCTTCTTATAAGG - Intergenic
1071044444 10:81356517-81356539 CCTCCTGCCTCCCTGTGAAGAGG + Intergenic
1071270551 10:84002865-84002887 CCTCCTGAGTCCTTATTACAAGG + Intergenic
1071791220 10:88956415-88956437 CCTCCTGTCTCCCTCTTAGAAGG + Intronic
1071912045 10:90247454-90247476 CCTCTGCCCTCCCTCTTATAAGG - Intergenic
1071943937 10:90619486-90619508 CCTCCTGCCCTGCTCTTATAAGG + Intergenic
1072036139 10:91564500-91564522 CCTCCTGCCTCGGCCTTCCAAGG - Intergenic
1072083420 10:92055794-92055816 CCTCCTGCCTCACCCTTCCAAGG - Intronic
1073373242 10:103009580-103009602 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
1073615483 10:104990707-104990729 TCTCCTGCCTCCCTCTTAAAAGG - Intronic
1073687009 10:105765826-105765848 CCTCCTGCATCTCTCTCATAAGG + Intergenic
1073961461 10:108934949-108934971 GCTACTGCCTTCCTCTTACAAGG + Intergenic
1074153183 10:110776619-110776641 CCTCCTGCTTCCGTCTTAGAAGG + Intronic
1074249985 10:111735413-111735435 CCTCCTGCCTCTATCTTATAAGG + Intergenic
1074377994 10:112953947-112953969 CGTCCTTCCTCCCTGTTACCTGG + Intronic
1074404671 10:113170542-113170564 CCTTCTGCCTCTCTCTTACAAGG + Intergenic
1074912828 10:117927247-117927269 CCCTCTGCCTCCGTCTTATAAGG + Intergenic
1075261504 10:120967273-120967295 CCTCCTGTCTCTGTCTTCCAAGG + Intergenic
1075428606 10:122362466-122362488 CCTCCAGACTCCCTCTTCCTGGG + Intergenic
1075667823 10:124243566-124243588 GCTTCTGCCTCCCTCTTGTAAGG - Intergenic
1075672821 10:124275168-124275190 CCCCCTGCCTCCCGCTTATCTGG + Intergenic
1075903414 10:126061591-126061613 TCTCCTGCCTTCCTCTTATAAGG - Intronic
1075923439 10:126232216-126232238 CCTCCTGCTTGTCTCTTATAAGG - Intronic
1075955113 10:126516938-126516960 CCTTCTTCCTCCCTCTTGTAAGG + Intronic
1076008515 10:126967726-126967748 CCTCCCGTCTTCCTCTTATAAGG + Intronic
1076074645 10:127523455-127523477 CCTCCTGCCTCCCTCTTATAAGG - Intergenic
1076268757 10:129132288-129132310 CCTCCTGCCTCCCTCTTCTAAGG + Intergenic
1076381405 10:130026839-130026861 CCTCCTGCCTCCCACACAGAGGG - Intergenic
1076531542 10:131148231-131148253 CTTCCCACCTCCCTCTTAGAAGG - Intronic
1076565268 10:131394249-131394271 CCTTCTGCCTCCCTCTTATGAGG + Intergenic
1076612539 10:131735719-131735741 CCTCTGGCCTCCCTCTCCCAGGG - Intergenic
1076776460 10:132700572-132700594 CCTCCTTCCTCCCTCCAGCAAGG - Intronic
1077309413 11:1881810-1881832 CCTCCTGTCTCCCCCTTTCCTGG - Intronic
1077447230 11:2602031-2602053 TCTTCTGCCTCCCTGTTATAAGG - Intronic
1077482419 11:2822014-2822036 CCTCCTGCCTCCCTCTTAGAAGG - Intronic
1077484756 11:2833567-2833589 CCTCTTGCCTCCCAGTGACACGG - Intronic
1077552922 11:3209798-3209820 TCTTCTGCCTCCCTCTTACAAGG + Intergenic
1077666502 11:4115337-4115359 CCCTCAGCCTCTCTCTTACAAGG - Intronic
1077933546 11:6758721-6758743 CCTGCTACCTCCCTCTTATAAGG + Intergenic
1077944523 11:6880676-6880698 CATCTTGCCTCCCTCTTAGAAGG - Intergenic
1078148334 11:8737764-8737786 TCTCCTTCCTCTCTCTCACAGGG + Intronic
1079443048 11:20534495-20534517 CCTCCTCCCTCACTATTACTGGG + Intergenic
1080131525 11:28801215-28801237 CATGCTGCCACCCTCTTATAAGG + Intergenic
1080181913 11:29435680-29435702 CCTCCTGCCTCCTTTTTATAAGG + Intergenic
1080317720 11:30969284-30969306 CCTTCTGCCTCTCTCTTCTAAGG - Intronic
1080335401 11:31189750-31189772 ACTCCTGCCTCCCTCTTATAAGG + Intronic
1080687833 11:34530132-34530154 CCCTCTGCCTCACTCTTATAAGG - Intergenic
1080788717 11:35499918-35499940 CATCCTGCCTCCCTCTTACGGGG - Intronic
1080814946 11:35746384-35746406 CCTCTTGCCTGCCTCTCACTGGG - Intronic
1080824971 11:35840364-35840386 CCTTCTGTTTCCCTCTCACAGGG + Intergenic
1081152115 11:39645692-39645714 CCTCTTACCTCTCTCTTACAAGG + Intergenic
1081208977 11:40308559-40308581 CCTCCTGCCTTTCTCTTATAAGG - Intronic
1081248197 11:40795887-40795909 GTTCCTGCCTTCCTCCTACATGG - Intronic
1081640323 11:44748863-44748885 CCTCCTCCCACCCACTTCCAGGG + Intronic
1081678224 11:44983478-44983500 CCTCCTGCCTCCCTCTTATGAGG - Intergenic
1081748440 11:45489375-45489397 CTTCCTGCCTCCCTCCCACCTGG + Intergenic
1081906037 11:46670698-46670720 CCTCCTGCCTCCACCTCCCAAGG - Intronic
1082056334 11:47820486-47820508 CCTCCTGCCTCAGTCTAATAGGG + Intronic
1082727383 11:56752418-56752440 CCCTCTGCCTCCCTCTTGTAAGG - Intergenic
1082952631 11:58833497-58833519 CCCTCTGCCTCCCTCTTAGAAGG - Intergenic
1083173628 11:60936605-60936627 CCTCCTCCCCCACTCTCACAGGG - Exonic
1083337543 11:61933289-61933311 CTTTCTGCCCCCCTCTTATAAGG - Intergenic
1083572241 11:63766973-63766995 CCTCCTGCCATCCCTTTACAGGG - Intronic
1083664840 11:64268765-64268787 CCGCCTGCATCCCTCCTCCAGGG + Exonic
1084052649 11:66610460-66610482 CCTTCTGCCTCCCTCTTACAAGG + Intergenic
1084413532 11:69017388-69017410 TCTCCTGTCTCCTTCTTACAAGG - Intergenic
1084417701 11:69042981-69043003 CCTCCTGCCTGCCCCATCCATGG - Intergenic
1084453959 11:69256724-69256746 CCCCCTTCCTCCCTCTCATAAGG - Intergenic
1084551915 11:69849135-69849157 CTCTCTGCCTCCCTCTTATAAGG - Intergenic
1084724168 11:70929636-70929658 CCCTCTGCCTTCCTCTTATAAGG + Intronic
1084780566 11:71405505-71405527 CCTCCTGCCTCTGTCTTAGAAGG - Intergenic
1084981713 11:72832439-72832461 CCTCCTGCCTACCTCATTCCCGG - Intronic
1085027338 11:73243948-73243970 CCTCCTGCCTCCCGGGTTCAAGG - Intergenic
1085096415 11:73764041-73764063 TCTCTGGGCTCCCTCTTACAAGG + Intergenic
1085278085 11:75312692-75312714 CCTCCTGCCTCCCTCTTGTCAGG - Intronic
1086185535 11:84010543-84010565 CCTCCTGCCTCCGTCTCCCAAGG + Intronic
1086445292 11:86864914-86864936 CTTCCTGTCTACCTCTTAGAAGG + Intronic
1086667047 11:89495433-89495455 CCCTCTGCCTCTCTCTTACCAGG + Intronic
1086698707 11:89874375-89874397 CTTTCTGCCTCACTCTTGCAAGG + Intronic
1086707463 11:89970126-89970148 CTTTCTGCCTCACTCTTGCAAGG - Intronic
1087021872 11:93611203-93611225 CCCTCTGCTTCCCTCTTAAAAGG + Intergenic
1088070285 11:105775169-105775191 CCTCTTGCATCCCTCTTACCAGG + Intronic
1088266967 11:107997140-107997162 CTTCGTGCCTTCCTCTTATAAGG - Intergenic
1088879365 11:113961518-113961540 CCTTCTGCCTTCCTCTAATAAGG + Intergenic
1088903824 11:114138989-114139011 CCTACTCCCTTCCTCTTACAAGG + Intronic
1088998663 11:115029288-115029310 CTTCCTGACTTCCTCTTACAAGG - Intergenic
1089051391 11:115548985-115549007 CTTACTTCCTCCCTCTTACCTGG - Intergenic
1089226306 11:116925330-116925352 CCTCCTGCTTCCCTCTTGCAAGG - Intronic
1089254505 11:117187181-117187203 CCCCCTGCCTGCCTCTCCCATGG - Intronic
1089279184 11:117360913-117360935 CCTCCCGCATCCTTCTTATATGG + Intronic
1089838346 11:121391792-121391814 TCTCTCGCCTCCCTCTTAGAAGG + Intergenic
1090228769 11:125087033-125087055 CCCCCTGCTCCCCTCTTCCAGGG - Intronic
1090260432 11:125315106-125315128 CCTCCTGCCTCCCTCTGAGCAGG - Intronic
1090375655 11:126286985-126287007 CTTCCTGCCTCCCTCTTGAAAGG + Intronic
1091340347 11:134807382-134807404 CCTCCTGTCTTCCTCTTGAAAGG - Intergenic
1091769849 12:3144413-3144435 CTTCCTGTGTCCCTCTTATAGGG - Intronic
1092096479 12:5846756-5846778 CCTTCTGCCTTTCTCTTATAGGG + Intronic
1092340076 12:7668094-7668116 TCTTCTACCTCCCTCTTATAAGG - Intergenic
1092494772 12:8982208-8982230 TCTACTGCTTCCCTCTTATAAGG - Intronic
1092692686 12:11131187-11131209 CCTCCTCTCTCTCTCTTCCATGG + Intronic
1092881404 12:12890598-12890620 CCTCCTGCCTCCCCGTGGCATGG + Intergenic
1092907188 12:13112053-13112075 CCCTCTGCCTCCCTCTCATAAGG - Intronic
1093378597 12:18461996-18462018 CCATCTGCCTCCCTCTTATAAGG + Intronic
1093386873 12:18568032-18568054 CCTCCTGCCTCCCTCTCAGAAGG + Intronic
1093404889 12:18792273-18792295 CCTCCTGCCTTCCTCTTAGAAGG + Intergenic
1093684238 12:22038331-22038353 CCTACTGTCTCCCTCTTTAAGGG + Intergenic
1094526117 12:31232389-31232411 CCTCTTGCCTCCCTCCTCCGAGG + Intergenic
1095641518 12:44491202-44491224 TCTCCTGCCTCCCTTTTATAAGG + Intergenic
1095729689 12:45493136-45493158 CCCTCTGCCTCTCTCTTACAGGG + Intergenic
1095746208 12:45661689-45661711 TCTCCTGTCTCTCTCTTATAAGG - Intergenic
1095755968 12:45767583-45767605 CCTCCTGCCTCCACCTCCCAAGG - Intronic
1095906883 12:47387809-47387831 CCTTCTGGGTCCCTCTTAAAAGG - Intergenic
1096635987 12:52959947-52959969 CCTTCTGCCTCCTTCTTATAAGG + Intergenic
1096792137 12:54051935-54051957 CCTTCAGTCTCCCTCTCACAAGG + Intronic
1096935633 12:55270823-55270845 TCTCCTGCCCCCAACTTACAAGG - Intergenic
1097369368 12:58757890-58757912 CATCCTGCCACCCTCATACCTGG - Intronic
1097560503 12:61199210-61199232 CCTCTTGCTTCCCTCTTGAAAGG + Intergenic
1098034420 12:66287683-66287705 TCTTTTGCCTCCCTCTTATAAGG - Intergenic
1098035765 12:66300794-66300816 CCTCCTGCCTCAGTCTACCAAGG - Intergenic
1098112025 12:67133113-67133135 TCTCCAGCCTGCCTCTTGCAGGG + Intergenic
1098429311 12:70402397-70402419 CCTCCCGCCTCAGTCTTCCACGG - Intronic
1098549906 12:71751719-71751741 CTTTCTGCCTCTCTCTTATAAGG + Intergenic
1098569678 12:71974509-71974531 CCTTCTGCCTCCCTCTGATAAGG + Intronic
1098828229 12:75326860-75326882 CTTCTTGCTTCCCTCTTACAAGG - Intronic
1098909891 12:76198251-76198273 CCCTCTGCCTCCCTCTTGTAAGG + Intergenic
1099360171 12:81690937-81690959 CCTTTTGCCTCCTTCTTATAAGG + Intronic
1100660076 12:96687174-96687196 CCTCCTGCCTTTCTCTTATAAGG + Intronic
1100685386 12:96981998-96982020 ATTCCTGCCTCCTTCTTGCAAGG - Intergenic
1100939357 12:99708683-99708705 CCCTCTACCTCCCTCTTATAAGG + Intronic
1101054295 12:100896285-100896307 CCCTCTGCCTCTCTCTTATAAGG - Intronic
1101517509 12:105450573-105450595 CCTCCTGCCTCAGTCTCCCAGGG + Intergenic
1102055287 12:109892261-109892283 CCTCCTGATTCCCTCTGACCAGG - Intergenic
1102257801 12:111426207-111426229 CAACCTGCCTCCCTCAGACAAGG + Intronic
1102281856 12:111624767-111624789 TCTCCCGCCTCCCTCTTAGGAGG + Intergenic
1102314119 12:111872799-111872821 CCTCTTGCCTGCCTCTTATAAGG + Intronic
1102418714 12:112787107-112787129 CCTCCAGCCTCCCTCCTATAAGG + Intronic
1102448181 12:113019816-113019838 CCCACTTCCTCCCTCTTATAAGG + Intergenic
1102525285 12:113508194-113508216 TCTCCCACCTCCCTCTTAGAAGG - Intergenic
1102557816 12:113740158-113740180 CCTCCTGCATCCCTTTTATAAGG + Intergenic
1102591951 12:113962955-113962977 CTTCCCGCCTCCCTCTCATAAGG - Intronic
1102773875 12:115502174-115502196 CCTCATGCCTCTCACTTCCATGG + Intergenic
1102898699 12:116619421-116619443 CCTCCCTCCTCCCTCTTACAAGG - Intergenic
1102919559 12:116781645-116781667 CCTCCTGCCTTCCTCTTATAAGG + Intronic
1102924359 12:116815581-116815603 CCTCTTGCCTTCCTCTAATAAGG + Intronic
1102937070 12:116906551-116906573 CAGCCTGCCTCCCTCTTAGAAGG - Intergenic
1103027711 12:117587308-117587330 CCTCCTCCCTCCATCTTATAAGG - Intronic
1103042690 12:117709029-117709051 TCTCCTACCTCCCCCTTATAAGG + Intronic
1103521135 12:121537553-121537575 CCTCCTGCCGCCCTCCTCCCCGG - Intronic
1103549148 12:121723753-121723775 CCTCATGGATCCCTCCTACATGG - Intronic
1103796000 12:123503633-123503655 CTCCCTGCCTCCATCTTACAAGG + Intronic
1103840926 12:123863643-123863665 CCTCCTGCTTTTCTCTTATAAGG + Intronic
1103862597 12:124026518-124026540 CCACCTGCCTCCCTCTTAGGAGG + Intronic
1103956360 12:124579076-124579098 CCTCCTGACTCCCTCTCACAAGG + Intergenic
1104099322 12:125591450-125591472 CCTGCTGCCTCCCTCTTACAAGG + Intronic
1104234559 12:126921020-126921042 CCTCTTGCCTCCCTTTTATAAGG + Intergenic
1104288063 12:127443450-127443472 CTTCCTTCCTCCCTCTGCCAGGG - Intergenic
1104293846 12:127494027-127494049 CCTCCTGCTTCCCTTTTACAAGG + Intergenic
1104337785 12:127916556-127916578 CCTCCTTCCTCCTTCTAATAAGG - Intergenic
1104424988 12:128668860-128668882 CTTCATGGCTCCCTCTTATAAGG + Intronic
1104478154 12:129087495-129087517 CTCCCTGCCTCCCTCTTATAAGG - Intronic
1104485489 12:129148416-129148438 CCTCCTGCCTCCTTCTTTTAAGG - Intronic
1104597989 12:130132960-130132982 CCTCCTGCCTCCCTCTTCTAAGG - Intergenic
1104640974 12:130466905-130466927 TCCTCTGCCTCCCTCTCACATGG + Intronic
1104725398 12:131072500-131072522 CCTACTGCTTCCCTCTTCAAAGG - Intronic
1105204560 13:18209822-18209844 CTTCCTGCCTCCCTCCTCCATGG + Intergenic
1105240908 13:18609282-18609304 CCTCCAGCCTCCCGGCTACACGG - Intergenic
1106334147 13:28767283-28767305 CCTCTTGCCTCTCTTTTATAAGG - Intergenic
1106357931 13:29001808-29001830 ACTCCTGCCTCCCTCTTACAAGG - Intronic
1106389359 13:29320149-29320171 CCTCCTGCCTCTCTCTTACAAGG - Intronic
1106670280 13:31897908-31897930 CCTCCTGCCTCCCTCTTACAAGG + Intergenic
1107384962 13:39898177-39898199 CTTCTTGCCCCACTCTTACAAGG - Intergenic
1107631828 13:42350621-42350643 CCCTCTGCTTCCCTCTTATAAGG - Intergenic
1107709848 13:43141043-43141065 CCTCCTCCCTCACTCTTGCCAGG + Intergenic
1107990806 13:45817561-45817583 CCCTCTGCCTCCCTCGTATAAGG - Intronic
1108036597 13:46296659-46296681 TCTCCTGCCTCTCTCTTATAAGG + Intergenic
1108391346 13:49950950-49950972 CATCCTACCTCCCTCTTATAAGG - Intergenic
1108758468 13:53532711-53532733 AACCCTGCCTCCTTCTTACAAGG - Intergenic
1108848397 13:54701302-54701324 CCTCCTGCCTCTCTTCTCCAAGG + Intergenic
1109242410 13:59905716-59905738 CCTCCTGCTTCCCTCTTATAAGG - Intronic
1109266065 13:60201704-60201726 TCTCCTGCTTCTCTCTTATAAGG + Intergenic
1110441984 13:75536539-75536561 CCTTTTTCCTCCCTCTTATAAGG - Intronic
1111692648 13:91583691-91583713 CCTCCTGCCTCTTTCTTCAAGGG - Intronic
1111820617 13:93209346-93209368 CCTCCTACTTCCTTCTTATAAGG + Intergenic
1112175847 13:97023216-97023238 CCTGCTGCCTCCCTCTTATAAGG - Intergenic
1112354496 13:98662502-98662524 CCTCCTGTCTCCCACTTTCCTGG - Intergenic
1112535531 13:100250971-100250993 TCTCCTGCCTACATCTTTCATGG - Intronic
1112895314 13:104292467-104292489 TCTCCTGCCTCCCTCTCACAAGG + Intergenic
1113187161 13:107701496-107701518 CCTCCTCCCTCCCTCATACCTGG - Intronic
1113550393 13:111188483-111188505 CTGCCTGCCTTCCTCCTACACGG + Intronic
1113737382 13:112688761-112688783 GCCCCTGCCTCCCTCCTACCCGG + Intergenic
1114169253 14:20255082-20255104 CCTCCTGCCTCTCTCTAATAAGG + Intergenic
1114498212 14:23148596-23148618 CTTCTTGCCTCCCTCTTGAAAGG - Intronic
1114658369 14:24329533-24329555 CCTACTGCCTCCCTCCTTCCAGG - Exonic
1115255587 14:31397765-31397787 CCTCCTGCCTCAGTCTTCCGAGG + Intronic
1115936155 14:38555059-38555081 CCTCCTGCCTCCCTCTTATAAGG - Intergenic
1116062469 14:39941340-39941362 TCTCCTGACTCCCTCCTATAAGG + Intergenic
1116539528 14:46082169-46082191 CCTCCTACCTCCCTCTTATAAGG - Intergenic
1116903843 14:50386679-50386701 CCTCCTGCCTCGGTCTCCCAAGG - Intronic
1117074246 14:52085695-52085717 CCTCCGGCCTCCCTATTCCCTGG - Intergenic
1117873546 14:60225612-60225634 CCTCCTGCCTTCCTCTTATAAGG + Intergenic
1117961909 14:61171632-61171654 CCTCCTGCCTCCTTCTTTCCTGG + Intergenic
1118377918 14:65192874-65192896 CCTCCTGCCTCTCTCTGATAAGG - Intergenic
1118630723 14:67700029-67700051 TCTCCTGCCTCCATCTCCCAAGG - Intergenic
1118885776 14:69864793-69864815 CCTCTTGCCTCTCTCTTATAAGG - Intronic
1119206136 14:72794960-72794982 CGTCCTGTCTCCCTCTTGCAAGG + Intronic
1119677672 14:76568001-76568023 CCTCCTGCCTTTCTCTTATAAGG - Intergenic
1119689605 14:76661263-76661285 CCCTCTGCTTCCCTCTTATAAGG + Intergenic
1119852549 14:77876370-77876392 CTTCCTACCTCCCTCTTGTAAGG + Intronic
1120039658 14:79738279-79738301 CCCTCTGCCTCACTCTTATAAGG - Intronic
1120185147 14:81386430-81386452 ACCCCTGCCTCCCTCTTAAATGG + Intronic
1120219823 14:81719547-81719569 CCACCCGCCTTCCTCTTATAAGG + Intergenic
1120503597 14:85326591-85326613 CCTCTTGCCTCCCTCTTAAAAGG - Intergenic
1120846115 14:89126392-89126414 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
1120897335 14:89545420-89545442 CCTACTGGCTCCTTCTAACACGG + Intronic
1121216822 14:92254910-92254932 CCTCCAGCCTCCCTCCCACTTGG - Intergenic
1121313341 14:92946863-92946885 TCTCCTTCCTCCCTGTTAAAAGG - Intronic
1121519992 14:94579505-94579527 TCTCCTGCCTCTTTCTTGCAAGG + Intronic
1121533903 14:94677954-94677976 CCTGCAGGCTCCCTCCTACAAGG + Intergenic
1121615359 14:95310385-95310407 CCTCCTGCTTCCTTCTTATAAGG + Intronic
1121654643 14:95586423-95586445 CCTCCTATCTCCCTCTTATGTGG - Intergenic
1121717004 14:96083527-96083549 CTTCCAGCCTCGCTCTTATAAGG - Intronic
1121742652 14:96264945-96264967 CCTCCTGCCTCCCTCCTATAAGG - Intronic
1121773089 14:96569412-96569434 CCTCCACACTCCCTCTTACTGGG + Intergenic
1121794871 14:96726413-96726435 CCCTCTGCCTCCTTCTTAGAAGG - Intergenic
1121800538 14:96770457-96770479 CCTCTTGCCTCTCTCTTATAAGG - Intergenic
1121846806 14:97179406-97179428 ACCCCTGCCTCCCTCTTATAAGG + Intergenic
1121856638 14:97276340-97276362 TCTCCTGCCTCCCTCTGATAAGG - Intergenic
1121902224 14:97704081-97704103 CCTCCTGCTTTCCTCTTATAAGG + Intergenic
1121908538 14:97768749-97768771 CCCCTTTCCTCCCTCTTACAAGG - Intergenic
1122349953 14:101083338-101083360 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1122483063 14:102060242-102060264 CCTTCTGCCTTTCTCTTATAAGG - Intergenic
1122623011 14:103070490-103070512 CCTCCTGCCTCCCTCATCACTGG - Intergenic
1122856878 14:104564161-104564183 CCTCCTGCATCCCTCTTCACTGG + Intronic
1123121253 14:105918084-105918106 CCTCCCTCCTCCCTCCTTCAGGG - Intronic
1123208394 14:106735941-106735963 CCACCTGCCTCCCTCATCCATGG - Intergenic
1124123147 15:26909685-26909707 ACTCTTGTCTCCCTCTTAGAAGG + Intronic
1124349728 15:28946324-28946346 CCTCCAGCTTCCTTCTTATAAGG - Intronic
1124457177 15:29854423-29854445 TCCTCTGCCTCCCTCTTATAAGG - Intronic
1124642774 15:31406896-31406918 CCTCTCGCCTCCCTCTTATGAGG + Intronic
1124838212 15:33216076-33216098 TCTCCTTCCTCCCTCTTACCTGG + Intergenic
1125214825 15:37259550-37259572 CCTTCTGCCTCCCTCTTGTAAGG + Intergenic
1125391720 15:39199782-39199804 CCTCTTGTCTTCCTCTTATAAGG + Intergenic
1126074970 15:44900384-44900406 CCCTCTATCTCCCTCTTACAAGG - Intergenic
1126369183 15:47927655-47927677 CCTCCTGTATCATTCTTACAAGG + Intergenic
1126564899 15:50084836-50084858 CCTCCTGCCTCCCTCTGATAAGG + Intronic
1127495648 15:59509526-59509548 CCTATTGCCTCCCTCTTATAAGG - Intronic
1127588283 15:60398060-60398082 CGCCCCGCCTCCCCCTTACACGG + Intronic
1127668289 15:61170435-61170457 TCTCCTGCCCGCCTCTTATAAGG + Intronic
1127691497 15:61401920-61401942 TCTCCTGCCTGCTTCTTCCATGG + Intergenic
1127718732 15:61678634-61678656 CCTCCTGTCTTTCTCTTATAAGG - Intergenic
1128113371 15:65090290-65090312 CTTTCTGCCTCCTTCTTAGAAGG - Intergenic
1128612525 15:69085315-69085337 CCTCCTAGCTCCCTCTTATAAGG - Intergenic
1128633533 15:69288284-69288306 CCTCCTGCCTCCTTCTTAAAAGG + Intergenic
1128674474 15:69598514-69598536 CTTCCTGCATCCCTCTTATAAGG + Intergenic
1128707804 15:69850525-69850547 CCTCCTGCCTCCCCCATGGAGGG + Intergenic
1128789435 15:70422392-70422414 ACTCCTGAATCCCTCTTACAGGG - Intergenic
1128878860 15:71224806-71224828 CCTCCTACCTCCCACTTATAAGG + Intronic
1129118933 15:73383183-73383205 CCCTCTGTCTCCCTCTTATAAGG - Intergenic
1129433637 15:75520019-75520041 CCTCCTGCCTCTGTCTCCCAAGG - Intronic
1129530926 15:76263919-76263941 CCTCCTCTCTCCCCCTTACTGGG + Intronic
1129532810 15:76282209-76282231 CCTTCTGTGTCCCTCTTATAAGG - Intronic
1129702935 15:77778239-77778261 CCCTCTGCCTCCCTCTTATATGG + Intronic
1129908060 15:79203629-79203651 CCACCTGCCTCCATCTTATGGGG + Intergenic
1130019254 15:80213494-80213516 CCCACTGCCTCTCTCTTATAAGG - Intergenic
1130067561 15:80617284-80617306 CCTCCTGCCTTCCCCTTATGAGG + Intergenic
1130159496 15:81384631-81384653 CCTCCTTCATCCCTCTTATAAGG - Intergenic
1130252311 15:82307540-82307562 CCTTCTGCTTCCCTCTACCACGG - Intergenic
1130982663 15:88823462-88823484 CCTCCTGCTTCACTCATCCAGGG - Intronic
1131007742 15:88992173-88992195 CCTCCTAACTCCCTCTTCCTAGG - Intergenic
1131107535 15:89745079-89745101 CCTCCTGCCTTCCTCCCTCATGG - Intergenic
1131222273 15:90594857-90594879 ACTCCTGGCTCCCTTGTACAAGG - Intronic
1131424913 15:92337954-92337976 CCTCCTGCCACCCTTTTGTAAGG + Intergenic
1131457740 15:92596622-92596644 ACACCTGCTTCCCTCTCACATGG + Intergenic
1131733775 15:95310831-95310853 CTTCCTGGCTCCCTTTTAAAAGG + Intergenic
1132155021 15:99489585-99489607 CCTCCTGCCTCCCTCTCATAAGG + Intergenic
1132384501 15:101390491-101390513 CTTGCTGCCTTCCTCTTCCAAGG - Intronic
1132631769 16:921206-921228 CCTCCTGCCTTCTACTTACCTGG - Intronic
1132743692 16:1428165-1428187 CCTCCTGCCTCCCTCCAACAAGG + Intergenic
1132774106 16:1582283-1582305 CTGCCTCCCTCCCTCTTACAGGG - Intronic
1133508053 16:6431380-6431402 CCTTTTCCCTCCCTCTTCCAGGG - Intronic
1133734239 16:8601973-8601995 CCTCTTACCTGCCTCTTAGAAGG + Intergenic
1133852199 16:9516041-9516063 CCCTCTGCCTCACTCTTACAAGG - Intergenic
1134636603 16:15796729-15796751 CCCCCTACCTCTCTCTTATAAGG - Intronic
1134682145 16:16133771-16133793 GCTCCTTCTTCCCTCCTACAGGG - Intronic
1134864097 16:17589634-17589656 CATCTTGGCTTCCTCTTACAAGG - Intergenic
1134905833 16:17978722-17978744 CTTCCTGCTTCCCTCGTAAAAGG - Intergenic
1135029827 16:19029616-19029638 CCTCCTGCCTCGGCCTTCCAAGG + Intronic
1135314655 16:21434329-21434351 CCTCCTGCCTCACCCTCCCAAGG - Intronic
1135321347 16:21499354-21499376 GCCCCTGCCTCCCGGTTACAGGG - Intergenic
1135353093 16:21746485-21746507 CCTCCTTGCTCCTTCTTAAAAGG - Intronic
1135367578 16:21866609-21866631 CCTCCTGCCTCACCCTCCCAAGG - Intronic
1135374180 16:21930856-21930878 GCCCCTGCCTCCCGGTTACAGGG - Intergenic
1135437606 16:22439865-22439887 GCCCCTGCCTCCCGGTTACAGGG + Intergenic
1135444236 16:22504553-22504575 CCTCCTGCCTCACCCTCCCAAGG + Intronic
1135451580 16:22562608-22562630 CCTCCTTGCTCCTTCTTAAAAGG - Intergenic
1135884652 16:26295045-26295067 CCTCCCGCCTCCCTCTTAAAAGG + Intergenic
1136275191 16:29175634-29175656 CCTCCCGCCTCCCTCCTACAAGG - Intergenic
1136276284 16:29181070-29181092 CCTTCTGCCTTCCTCTTCCAAGG - Intergenic
1136311320 16:29413011-29413033 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1136324768 16:29514804-29514826 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1136332827 16:29592480-29592502 GCCTCTGCCTCCCGCTTACAGGG - Intergenic
1136401568 16:30021933-30021955 ACTCTTGCCTCCCTTATACACGG - Intronic
1136439453 16:30254789-30254811 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1136489222 16:30594781-30594803 CCTCTTGCCTCCCTTTTATAAGG - Intergenic
1136533463 16:30885201-30885223 TCTCCTGCCTCCTTCCTCCAAGG - Intronic
1137862306 16:51858521-51858543 CATCATGCCTTCCTCTTACCTGG + Intergenic
1138197128 16:55059917-55059939 CCTTCTGCCTCCCTCGTATGAGG - Intergenic
1138255090 16:55549695-55549717 AGTCCTGCCACCTTCTTACAAGG + Intronic
1138624754 16:58241909-58241931 CCTTCTGCCTCCCTCTTGTAAGG + Intronic
1138626970 16:58260158-58260180 CCTCCTGCTTCCCACTGATAAGG - Intronic
1138646393 16:58428459-58428481 TCTCTTGCCTCTCTCTTACAAGG - Intergenic
1138831052 16:60374837-60374859 CCTCATGCCTCCTTCTTGCAAGG - Intergenic
1139084775 16:63571528-63571550 CCTTCTGCCTCCCTCTGACAAGG - Intergenic
1139509655 16:67419876-67419898 CCTCCTGCCTCCCTCTTATAAGG - Intergenic
1139655005 16:68382246-68382268 CCTCCTGCCCCTCCCCTACAGGG - Intronic
1139736869 16:68997800-68997822 TTTCCTCCCTCCCTTTTACAAGG + Intronic
1139858840 16:70003937-70003959 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1139885959 16:70207089-70207111 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1139999193 16:71009701-71009723 CCCTCTGCCTCCCTCATATAAGG - Intronic
1140023549 16:71262428-71262450 CTTCCTGCCTCCCTCTCAGGAGG - Intergenic
1140342663 16:74180424-74180446 CTTCCTACCTCCCTCTTATAAGG - Intergenic
1140377289 16:74454773-74454795 CCTCCTGCCTCGGTCTCCCAAGG + Intronic
1140422993 16:74836052-74836074 CCTCCTGCCTCCTTCTTAGAAGG + Intergenic
1140598278 16:76442129-76442151 CCTCCTACTTCCCTTTTATAAGG - Intronic
1140904419 16:79398213-79398235 CCTCCTGCCACTTTCTTATAAGG + Intergenic
1140934952 16:79661870-79661892 CCTCCTGCCTCCCTCTTATGTGG + Intergenic
1140987909 16:80176665-80176687 TCTCCTGTCTCCCTCTTGTAAGG - Intergenic
1141029103 16:80572273-80572295 CCTCCTGCCTCCCTTTCCTAAGG - Intergenic
1141041166 16:80673856-80673878 CCCCCTGCCTCCCTCTTACAAGG - Intronic
1141095687 16:81161290-81161312 CTTTCTGCCTCCCTTTTATAAGG + Intergenic
1141097261 16:81171717-81171739 GTTCCTACCTCCCTCTTAGAAGG - Intergenic
1141107585 16:81246220-81246242 TTTCCTGCCTCCCTCTTATAAGG + Intronic
1141187858 16:81800877-81800899 CCTCCTGCCTCCCTCCTGCAAGG - Intronic
1141222073 16:82080373-82080395 CCTCATGCCTCTTTCTTATAAGG - Intronic
1141224211 16:82100076-82100098 TCTCCTGCCTCCCGCTCATAAGG + Intergenic
1141268653 16:82519655-82519677 TCTCCTGCTTCCTCCTTACAAGG - Intergenic
1141416228 16:83877529-83877551 ACTCCTGCCTTCCCCGTACAAGG + Intergenic
1141444133 16:84047303-84047325 CCTCCTGCATCCGTGTTAGAAGG - Intergenic
1141478244 16:84288324-84288346 CTCTCTACCTCCCTCTTACAAGG + Intergenic
1141551095 16:84807214-84807236 CCTCTGGCCTCCCTCTTACAAGG + Intergenic
1141683057 16:85555279-85555301 CCTCCTGCCTCCTTCTGCCCAGG + Intergenic
1141862762 16:86729250-86729272 CTTCCTGCATCCCTCTCATAGGG + Intergenic
1142000424 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG + Intronic
1142006603 16:87692315-87692337 CCTCCTGCTTCCCACCAACAGGG - Intronic
1142079550 16:88141702-88141724 CCTCCCGCCTCCCTCCTACAAGG - Intergenic
1142080665 16:88147129-88147151 CCTTCTGCCTTCCTCTTCCAAGG - Intergenic
1142104957 16:88297698-88297720 CCCTCTGCCTCCCTCTTATGAGG + Intergenic
1142160387 16:88554557-88554579 CCTGCTGCCCGCCTCTTACGAGG + Intergenic
1142953939 17:3507363-3507385 CCTCCTACCACCATCTTAAATGG + Intronic
1142996993 17:3766293-3766315 TCTCCTGCCTCCCTCCTAGAAGG - Intronic
1143269250 17:5663692-5663714 ACCTTTGCCTCCCTCTTACAGGG - Intergenic
1143366361 17:6411172-6411194 CCTTCTGCCTCCGTCTTATAAGG - Intronic
1143368039 17:6421154-6421176 CCTCCTGTCTCCCTCTTATAAGG - Intronic
1143893087 17:10117258-10117280 CCTCCTGCCTCCCTCTCATAAGG + Intronic
1144001051 17:11055555-11055577 CCTACTGCCTCACTATTTCATGG + Intergenic
1144103632 17:11966278-11966300 CGTACTGCCTTCCTCTTTCATGG - Intronic
1144213714 17:13036327-13036349 TCTCCTGCCTCCCTCTTCTAAGG + Intergenic
1144395206 17:14836620-14836642 CTTCCTGCCTCCCTCTTATAAGG - Intergenic
1144588786 17:16506076-16506098 CCTCCTGCCCCCATCTTCTAAGG + Intergenic
1145053519 17:19682570-19682592 TCTCCTGCCTCCCTCTTCTAAGG + Intronic
1145218427 17:21069416-21069438 CCTCCTGCCCCCCTCTTATGAGG - Intergenic
1145370752 17:22304467-22304489 CCTACTGCCTCCCTCCTTCCTGG - Intergenic
1146267977 17:31465570-31465592 CCTCCTGCCTCCCCATTAGCTGG - Intronic
1146299552 17:31677584-31677606 CCTCCTGGCTCCTTCTTATAAGG + Intergenic
1146482001 17:33212294-33212316 CCTTCTGCCTCCCTCTTACAAGG - Intronic
1146510987 17:33448477-33448499 CCCTCTGCCTCTCTCTTATAAGG - Intronic
1146515243 17:33483933-33483955 CCTCCTGTCTCCCTCTTCCAAGG - Intronic
1146959915 17:36965386-36965408 CCTATTGCCTTCCTCTTATAAGG + Intronic
1147020499 17:37528321-37528343 CCTCCTACCTTCCCCTTATAAGG + Intronic
1147035693 17:37678650-37678672 CCCTCTTCCTCCCTCTTATAAGG - Intergenic
1147141786 17:38464570-38464592 CCTCCTTCCTCCCTCTCCCCAGG - Intronic
1147197450 17:38777003-38777025 CCTCCTGCCTCACCCTTCCAAGG + Intronic
1147209646 17:38864921-38864943 CCTCCTGCCTCCCTCTTGTAAGG - Intergenic
1147279775 17:39349477-39349499 CCTCCTGCCTCAACCTTCCAAGG - Intronic
1147567490 17:41546700-41546722 CATCTCGCCTCTCTCTTACAAGG - Intergenic
1148216667 17:45837156-45837178 CCTCCAGCCTACCTCTGTCACGG - Intergenic
1148222012 17:45869731-45869753 CCTCCTGCGTGCCTCTTACAAGG - Intergenic
1148371916 17:47106343-47106365 CCCACTGCCTCCCTCTGATAAGG + Intergenic
1148666142 17:49376442-49376464 GCTCCTGCCTCCCTCTTCTAAGG - Intronic
1149239328 17:54630785-54630807 TCCACTGCCTCCCTCTTACAAGG + Intergenic
1149391490 17:56196021-56196043 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
1149445724 17:56711892-56711914 CCTCCTTCCTCAGTCTTCCAAGG + Intergenic
1149469649 17:56905712-56905734 CCTCCTGCCTCGGTCTCCCAAGG - Intronic
1150050100 17:61953463-61953485 CCTACTGCCTCCCTCTTATTAGG - Intronic
1150304633 17:64073885-64073907 CCTCCTGCCTCACCCTCCCAAGG + Intronic
1150339614 17:64356023-64356045 CCCCCCAACTCCCTCTTACAAGG + Intronic
1150659565 17:67063674-67063696 TCTCCTGCCTACCTCTTAGAAGG + Intergenic
1151189788 17:72389771-72389793 TCTCCTGCCTCTCTCTTAAAGGG + Intergenic
1151266553 17:72960700-72960722 CCTCCTGCCTCCCTAGTAGCTGG - Intronic
1151271845 17:73002918-73002940 CCCTCTGCCTCCCTCTTATAAGG + Intronic
1151800686 17:76377670-76377692 CTTCCTGCCTCCCTCATATAAGG - Intronic
1152246689 17:79188226-79188248 CCCTCTGCCTCCCTCTGCCAGGG + Intronic
1152347754 17:79763902-79763924 GCTCCTGCCTCCCTCGCATAAGG - Intergenic
1152725675 17:81944470-81944492 CCTCCTGCCTCTGTCTGAAAGGG - Intronic
1153003808 18:480068-480090 CCCTCTGCCTCTCTCTTACAAGG + Intronic
1153304576 18:3620169-3620191 CCTCCTGCCTCCCTCTTATAAGG - Intronic
1153325770 18:3818708-3818730 TCTCCTGCCTCCCTAGTAGATGG + Intronic
1153435206 18:5061635-5061657 CCTCCTGTCTCCCTCTTATATGG + Intergenic
1153505281 18:5790486-5790508 CCTCCTGGCTCCCTCTTACAAGG - Intergenic
1153777807 18:8469045-8469067 CATCCTGCCTGCCTCTGTCAGGG - Intergenic
1153780517 18:8491430-8491452 CCTCCTGCCTTCCTCTCATAAGG - Intergenic
1153842412 18:9018670-9018692 CCTTCTGCCTCCCCCTTAGAAGG - Intergenic
1154088094 18:11327064-11327086 CCTTTTGCCTCCTTCTTATAAGG - Intergenic
1154156921 18:11951113-11951135 CCTCCCGCCTCCCTCTCTGAAGG - Intergenic
1154196512 18:12271319-12271341 TCACCTGCCTCCCTCTCATAAGG - Intronic
1154272363 18:12931262-12931284 CCTCCTGCAACCCCCTTACAAGG + Intergenic
1154301867 18:13201250-13201272 CCTCTTGCTTCCCTCCTATAAGG + Intergenic
1154448062 18:14450626-14450648 CCTCCAGCCTCCCGGCTACACGG + Intergenic
1154473091 18:14723722-14723744 CCTCCTGCCTCACCCTCCCATGG + Intergenic
1155014232 18:21816850-21816872 AATCCTGCCTCCCACTTACAAGG - Intronic
1155259950 18:24031952-24031974 CTTTCTGCCTTCCTCTTATAAGG - Intronic
1155261683 18:24049690-24049712 CCTCCTGCCTCTCTCCTCAATGG - Intronic
1155318169 18:24592727-24592749 CTCCCTGCCTTCCTCTTCCAAGG - Intergenic
1155498373 18:26464351-26464373 CCTCCTGCCTCCCTCAAATAAGG + Intronic
1155817075 18:30325968-30325990 CCTCCTCCCTGCTACTTACAGGG - Intergenic
1155865323 18:30957648-30957670 CCTCTTGCCTCTTTCTTAGAAGG - Intergenic
1156649368 18:39206324-39206346 CCTGCTGCCTGAATCTTACATGG - Intergenic
1157024667 18:43828629-43828651 CCTCCTGCCCCACCATTACATGG + Intergenic
1157080680 18:44521699-44521721 CTTCAGGCCTCCCTCCTACAAGG + Intergenic
1157391485 18:47307132-47307154 CCTGCTCCCTCCCTCTTAGTGGG - Intergenic
1157717974 18:49902266-49902288 CCTCCAGCCTCCCTCTTAGGAGG + Intronic
1157870424 18:51225396-51225418 CCTCCTGACTTCCTCTTATGAGG - Intergenic
1157958413 18:52125209-52125231 TTTCCTGCCTTCCTCTTACAAGG + Intergenic
1158094872 18:53758979-53759001 CCTCCTTCCAGCCTCTTCCACGG + Intergenic
1158310244 18:56150545-56150567 CCTCCTGTATCCCTTTTATAAGG + Intergenic
1158504532 18:58034812-58034834 CTTTCTGCCTCCCTCTAATAAGG - Intergenic
1158534633 18:58296608-58296630 CCTTCTGCATCTCTCTTACAAGG + Intronic
1158774317 18:60557804-60557826 CCTCCTGTCTCTCTCTTATAGGG + Intergenic
1159103218 18:63978017-63978039 CCTCCTGCCTCTCTCTTTTAAGG + Intronic
1159180082 18:64891973-64891995 CCCCCTGCCTTCCTCTTGTAAGG - Intergenic
1159333679 18:67035263-67035285 TCTCCTTCCTTCCTCTAACAAGG - Intergenic
1159428479 18:68320400-68320422 TGTCCTGCCTCCATCTTATAGGG + Intergenic
1159647400 18:70935514-70935536 TCTCCTTCCTCCCTCTTACAAGG - Intergenic
1160015986 18:75141134-75141156 TCTCCTGCCTCCTTCGTATAAGG - Intergenic
1160067846 18:75594110-75594132 CAGCCTCTCTCCCTCTTACAAGG - Intergenic
1160087082 18:75786526-75786548 CATCCTGCCTTCCTCTTATAAGG + Intergenic
1160265275 18:77336446-77336468 CCTGCTGCCTCCCTCTTAGAAGG - Intergenic
1160387091 18:78503364-78503386 CCTTCTCCCTCCCACATACAGGG + Intergenic
1160963963 19:1737515-1737537 CCTCCTGTGTCTGTCTTACAGGG - Intergenic
1160984510 19:1832098-1832120 CCTCCTGCCTCCCTCTTTAAAGG - Intronic
1161116939 19:2502647-2502669 CTTCCTGCCACCCTCTTACAAGG + Intergenic
1161347903 19:3777283-3777305 CCTCCTGCCTCCCCCATTCATGG - Intergenic
1161638989 19:5407860-5407882 GCTCCTGCTTTCCTCTTATAAGG + Intergenic
1161761948 19:6180105-6180127 TCTCCTGCTTCCCTCTTATAAGG + Intronic
1161953712 19:7481571-7481593 CCTCCTTCCTCCCTCCTATAAGG - Intronic
1162048721 19:8018960-8018982 CATCCTGCCTCCCTCTTATAAGG - Intronic
1162175323 19:8825954-8825976 CCTCCTGTTTCCCTTTTATAAGG - Intronic
1162179466 19:8857908-8857930 CCTCCTTCCCCCGTCTTCCATGG + Intronic
1163019637 19:14475344-14475366 CTTCCTCCCTCCCTCTTCCTGGG + Exonic
1163486476 19:17590195-17590217 CCTCTTGTCTCCCTCTTCTAAGG + Intergenic
1163650364 19:18514121-18514143 CCTCCCGCCTCCATCTGACCTGG - Intronic
1164505227 19:28854689-28854711 CCTCCTGCCTCCCTCCTATGAGG - Intergenic
1165419247 19:35714937-35714959 CCTCCAGCATGCCTCTTCCAGGG - Exonic
1165590991 19:36969709-36969731 CCTCCTGCCTTCCTCTTTTAAGG + Intronic
1165747221 19:38237029-38237051 CCCTCTGCCTCCCTCTTAAAGGG + Intergenic
1165930678 19:39356585-39356607 CCTCATGCCTTTCTCTTTCAGGG - Intronic
1166145052 19:40828371-40828393 CCTCCTGCCTCCCTCTAAAAAGG - Intronic
1166267132 19:41691214-41691236 GCACCTGTCTCCCTGTTACAGGG - Intronic
1166350099 19:42193400-42193422 TCCTCTGCCTCCCTCTTAGAAGG - Intronic
1166499659 19:43331308-43331330 CCTCCTCCCACCCTCTCCCAGGG + Intergenic
1166828375 19:45623417-45623439 CCTCCTGCCTCCCAAGTACCTGG - Intronic
1167009623 19:46798556-46798578 CCTTCTGCCCCTCTCTTATAAGG + Intergenic
1167090926 19:47343116-47343138 CCTCCTGCCTCCCTCTTAAAAGG - Exonic
1167199019 19:48051091-48051113 CCTCCCGCCTTGCTCTTATAAGG - Intronic
1167281672 19:48572819-48572841 CCTCCTGCCTCCCTCCTCCATGG - Intronic
1167440925 19:49508385-49508407 CCGCCTGCCTCCCTCTCCAAAGG - Intronic
1167582757 19:50356126-50356148 CCCTCTGCCTCCCTCTTATAAGG + Intronic
1167683675 19:50942106-50942128 CTTTCCGCCTCCCTCTTATAAGG + Intergenic
1167800326 19:51736460-51736482 CCCTCTGCCTCACTCTTATAAGG - Intergenic
1168250378 19:55138108-55138130 CCTCCTCCCTCAGTCCTACAGGG - Intronic
1168250607 19:55139566-55139588 CCTCTGGCCTTCCTCTTATAAGG + Intronic
1168311701 19:55464020-55464042 CCTCCTGCCTCGGCCTTTCAAGG + Intergenic
1168580712 19:57553659-57553681 CCTCCTGCCTCAGTCTCCCAAGG + Intronic
1168666445 19:58208524-58208546 CCTCCAGCCTCCCTCTCCTAAGG - Intronic
1168677516 19:58289730-58289752 CCTTCTGCTTCCCTCCTATATGG + Intronic
925193809 2:1907533-1907555 CCTCCTACCTCCCTCTGATCTGG - Intronic
925322680 2:2987734-2987756 CCACCTTCCACCCTCTGACAGGG + Intergenic
925910613 2:8571397-8571419 GCTCCTGCATGCCTCTTACCTGG + Intergenic
926111555 2:10187321-10187343 CCTCCTTCCTACCTCTGCCACGG + Intronic
926339600 2:11894253-11894275 CATCCTGCCTCCCTCTTATCAGG + Intergenic
926544786 2:14226155-14226177 CCCCCTGTCTCACTCTTATAAGG + Intergenic
926620566 2:15043311-15043333 CCTGCTGCCTCCACCTTCCAAGG + Intergenic
926769292 2:16353686-16353708 CCTCCTTGTTCCCTCTCACAAGG + Intergenic
926820997 2:16851735-16851757 CCTTCTGCCTGCCTCTTATAAGG + Intergenic
926839443 2:17062816-17062838 CCTCCTGCCTCCTTCTTACAAGG + Intergenic
926942628 2:18154335-18154357 CTCTCTGCCTCCCTTTTACAAGG - Intronic
927642819 2:24856104-24856126 CTAACTGTCTCCCTCTTACAAGG - Intronic
927987196 2:27420333-27420355 CCCTCTGCCTTCCTCTTACATGG + Intergenic
928241750 2:29592515-29592537 CCTCCAGCATCCCTCTTCCCAGG - Intronic
928309336 2:30196654-30196676 CTTCCTGCCTCCCTCTTCTAAGG - Intergenic
928364912 2:30692911-30692933 CCTCTTGCCTCCCTCTTGTAAGG - Intergenic
928600240 2:32897354-32897376 CCCTCTGCCTCTCTCTTATAAGG - Intergenic
928690365 2:33792589-33792611 CCTCCTGCCATTCTCCTACAGGG + Intergenic
928835324 2:35537384-35537406 CCTCCTGCCACTCTCTTATAAGG - Intergenic
929454486 2:42056176-42056198 CCTCCTGCCTCCTTCTACCAGGG - Intronic
929571538 2:43026204-43026226 CTTCCTGCCTCCCTCTTATGTGG + Intergenic
929571915 2:43028085-43028107 CCTTCTGCATCCCTCTTCCAAGG + Intergenic
929598661 2:43191578-43191600 CCTCGTGCCTCCTTCCTGCAGGG + Intergenic
929959387 2:46485003-46485025 CCTCCTGCCTCCCTTTTACAAGG - Intergenic
930035437 2:47082479-47082501 CCTCCTGCCTGCCTTATATAAGG - Intronic
930322461 2:49873853-49873875 CCTTCTGCCTCTTTCTTATAAGG - Intergenic
930597260 2:53403653-53403675 CCCTCTGCATCCCTCTTAGAAGG + Intergenic
930688634 2:54335929-54335951 TCTCCTGACTCTCTCTTATAAGG + Intronic
930978631 2:57494885-57494907 TCTCCTGCCTTCCTCTCATAAGG - Intergenic
931133852 2:59374146-59374168 CCTCCTTCCTGCCTCCCACATGG - Intergenic
931630918 2:64297811-64297833 CCTCCTCCCTCTCTCTTCCAAGG - Intergenic
931673818 2:64673290-64673312 GCTCCTGCCCCACTCTTATAAGG + Intronic
932102261 2:68911937-68911959 CCCCATGCTTCCCTCTTACTGGG + Intergenic
932484073 2:72070632-72070654 CCCTCTGCCTGCCTCTTATAAGG - Intergenic
932861440 2:75297007-75297029 CCTCCTTCCTCCCTCTTATGAGG + Intergenic
932938243 2:76131890-76131912 CTTCCTGTTTTCCTCTTACAAGG + Intergenic
932968746 2:76512394-76512416 CCTCCTGCTTCCCTCTCCCCTGG + Intergenic
933150535 2:78909669-78909691 CCTTGTACCTCCCTCTTATAAGG - Intergenic
933377756 2:81501839-81501861 CCTCTTTCCTTCCTCTTACTAGG + Intergenic
933647620 2:84825331-84825353 CCTCCTCCCTTCCTCACACACGG - Intronic
934032871 2:88064259-88064281 CCTCCTGCCTTCCTCCTATAAGG + Intergenic
934151296 2:89150112-89150134 CCTCCTCCCTCCCAATTATAAGG - Intergenic
934215962 2:90031798-90031820 CCTCCTCCCTCCCAATTATAAGG + Intergenic
934579176 2:95424834-95424856 CCACCTCACTCCCTCTCACACGG + Intergenic
934585121 2:95485442-95485464 CTTTCTGCCTCACTCTTGCAAGG - Intergenic
934594340 2:95591291-95591313 CTTTCTGCCTCACTCTTGCAAGG + Intergenic
934600270 2:95651890-95651912 CCACCTCACTCCCTCTCACACGG - Intergenic
934704955 2:96470830-96470852 TCTCCTGCCTCCCGCCTGCAGGG - Intergenic
934788435 2:97034343-97034365 CTTTCTGCCTCACTCTTGCAAGG - Intergenic
935296781 2:101656635-101656657 CCTCCTGCCTCGCTCTGATAAGG - Intergenic
935340070 2:102051842-102051864 CGTGCTGCCTCCCTCTTCCTGGG - Intergenic
935445443 2:103151458-103151480 ACTCCTACTTCCCTCTTACAAGG - Intergenic
935462138 2:103349771-103349793 CCTACTGCATGACTCTTACAAGG - Intergenic
935471052 2:103461419-103461441 CCTTCTGCCTCTCTCTTACAGGG + Intergenic
935471834 2:103470044-103470066 TTTCCTGCCTCCCTTTTACAAGG + Intergenic
935621820 2:105136630-105136652 CCTCCTGCTACCCTTTTAGAAGG + Intergenic
935727708 2:106038087-106038109 CCCTCTGCCTCCCTGTTATAAGG - Intergenic
936004057 2:108866236-108866258 CCTTCTGCCTCCCTTTTATAAGG + Intronic
936135357 2:109888318-109888340 CCTCCTGCATCCCTCTTATAAGG - Intergenic
936209340 2:110483167-110483189 CCTCCTGCATCCCTCTTATAAGG + Intergenic
936255096 2:110904441-110904463 CCTCCTGCCTCTGTCTTTCCTGG + Intronic
936428527 2:112438406-112438428 CCTCCTACATCCCTCTTATAAGG + Intergenic
936533621 2:113293895-113293917 CCACCTCACTCCCTCTCACATGG - Intergenic
936936269 2:117841044-117841066 CCTCTTGCCTCCCTCTCATGAGG - Intergenic
937019156 2:118634305-118634327 ACTCAAGCCTCCCTCTTAAACGG - Intergenic
937065979 2:119018032-119018054 CCTCCTGCATTCCTCTTCCTCGG - Intergenic
937080902 2:119139008-119139030 CCCGCTGCCTCCTTCTTATAAGG + Intergenic
937160296 2:119754780-119754802 CCTCTTGCCTCCCTTTTATAAGG - Intergenic
937242606 2:120472018-120472040 CCTCCTGCTTTCCTCTAACAGGG - Intergenic
937257646 2:120566300-120566322 CCCCATGCCTTCCTCTTCCAGGG + Intergenic
937342017 2:121097132-121097154 CCTCCTGCCTCCCTCTTATAAGG - Intergenic
937562135 2:123239227-123239249 TCTCCAGCCTCCCTCTTACAAGG - Intergenic
937614580 2:123906693-123906715 CCTCCTGCATCCCTCTAGCTGGG + Intergenic
937754975 2:125526196-125526218 CCCCCGGCCTCCCTCTTATAAGG - Intergenic
937760336 2:125593160-125593182 CCACCTCCCTCCTTCTCACAGGG - Intergenic
937825712 2:126366611-126366633 TCTCTTGCCTCCCTCTTAGAAGG + Intergenic
937921590 2:127135356-127135378 CCTCCGGCCTCCGGCTTGCAGGG + Intergenic
938710683 2:133973921-133973943 TCTCCTGCCTCGCTCCTATAAGG + Intergenic
938725797 2:134107957-134107979 TCTCCTGTCTCCCTCTTAGAAGG - Intergenic
939135234 2:138285733-138285755 CCCTCTGCCTCTCTCTTACAGGG + Intergenic
939230010 2:139412383-139412405 TTTCCTGCCTCCTTCTTATAAGG - Intergenic
939239439 2:139538905-139538927 CCTTCTGCCTCCCTCACACTGGG + Intergenic
939979163 2:148758027-148758049 GCTCCTGCGTCCTTCTGACATGG - Intronic
940208412 2:151230415-151230437 CCTCTTTCTTCCCTCTTACAAGG - Intergenic
940275805 2:151939418-151939440 CCTCCTGCAAACCTCTTCCAAGG - Intronic
940338659 2:152556394-152556416 CCTGCTGCCTACCTCCTAAAAGG - Intronic
940541816 2:155029946-155029968 CCCTCTGCCTCCCACTTATAAGG - Intergenic
941168122 2:162105126-162105148 CCTCTTGCTTCCCTCTTAAAAGG + Intergenic
941403260 2:165057862-165057884 CCTCCTGCCTCAGTCTCTCAAGG + Intergenic
941454932 2:165703802-165703824 CCTCTTGCTTCCCTCTCATAAGG - Intergenic
942330744 2:174821386-174821408 CCTCTCGCCTCCCTTTTATAAGG + Intronic
943803561 2:192092712-192092734 TCTGCTGCCCCCTTCTTACAAGG - Intronic
944248399 2:197556721-197556743 CCTTCTGACTTCCTCTTACAAGG + Intergenic
944312060 2:198244440-198244462 CCTCCTACCACCCTCTTATAAGG - Intronic
944463074 2:199972434-199972456 CCGCCTGCCTCCCTTTTATAAGG - Intronic
944509019 2:200446093-200446115 CCTCCTGCCTCGGCCTTCCAAGG - Intronic
944542530 2:200767320-200767342 GCTGCTGCCTCCATCTTCCATGG + Intergenic
944840612 2:203620458-203620480 CCCTCTGCCTTTCTCTTACAAGG - Intergenic
944922348 2:204428710-204428732 CCTCTTGCCTTCCTCTTATAAGG - Intergenic
944923626 2:204440381-204440403 CCTCCTGCTTCCCTATTATAAGG - Intergenic
944931907 2:204528512-204528534 CCCCCTGCCTCCCTCTTATAAGG - Intergenic
945352350 2:208796121-208796143 CCTCCTACCTCCCTCTTACTAGG - Intronic
945579337 2:211573111-211573133 CCTTCTGCCTCTCTTTTATAAGG - Intronic
945683147 2:212937516-212937538 CCTCCCACCTCCCTCTTACAAGG - Intergenic
945932123 2:215865774-215865796 CCTTCTCCTTCCCTTTTACAGGG - Intergenic
945932306 2:215867127-215867149 ACCCCTGCCTCCCACTTGCAAGG + Intergenic
946013156 2:216582840-216582862 CATTCTACCTCCCTCTTACAAGG + Intergenic
946045066 2:216814120-216814142 CCTCCAGCCTCCTTATTCCATGG - Intergenic
946054401 2:216888311-216888333 CCTCCTGGCTCTCTCTGAAATGG - Intergenic
946150975 2:217770403-217770425 TCTCCTACCTGCCTCTTACAAGG + Intergenic
946447658 2:219753600-219753622 CCTCTTGCCTCACTCTTATAAGG + Intergenic
946698808 2:222388958-222388980 CCTCCTGCCTCACTCTTATAAGG - Intergenic
946893991 2:224304242-224304264 CCCTCTGCCTCCCTCTTAAAAGG - Intergenic
947627870 2:231632276-231632298 CTTCCTGCCTCCCTCTTACAAGG - Intergenic
947705445 2:232271723-232271745 CCTCCTCCCACTCTCTTCCACGG - Intronic
947793146 2:232879112-232879134 CCTTCTGCCTGCCTCCCACAGGG + Exonic
947811308 2:233005567-233005589 TCTTCTGCCTTCCTCTTATAAGG - Intronic
947979053 2:234393306-234393328 CCCTCTTCCTCCCTCTTACAAGG + Intergenic
948115184 2:235490207-235490229 CCTCCTGCCTTCCTCGTATAAGG + Intergenic
948154556 2:235770976-235770998 CCTTCTCCCTCCCTATTATAAGG - Intronic
948435189 2:237948511-237948533 CCGCCTGCCTCACTCTTATAAGG + Intergenic
949010321 2:241674654-241674676 CCGCCTGCCTCCCTGTTATGCGG + Intergenic
949022144 2:241747675-241747697 CCTCCTGCCTCCCTAGTAGCTGG + Intronic
1168950168 20:1792539-1792561 CCCTCTGTCTCCCTCTTATATGG + Intergenic
1168993616 20:2115825-2115847 TCTACTGCCTGCCTTTTACAGGG + Intronic
1169286980 20:4317188-4317210 CTCTCTGCCTCCCTCTTATAAGG - Intergenic
1169453014 20:5728382-5728404 CCTCCTATCTCCCTCTTATAAGG - Intergenic
1169654720 20:7910616-7910638 ACTCTTGCTTCCCTCTTATAAGG + Intronic
1169997119 20:11570980-11571002 CCTCTTGCCTCCCTCTTAGAAGG + Intergenic
1170354532 20:15477833-15477855 CCTCCTGCCTTCCTCATATAAGG - Intronic
1170773699 20:19357109-19357131 CCCACTGCCTCTCTCTTACAAGG - Intronic
1170916484 20:20631466-20631488 CCTCCTGCCACCCTCTTATAAGG - Intronic
1171017845 20:21557860-21557882 CTTCCTGCCACCCCCTCACAGGG + Intergenic
1171230976 20:23484792-23484814 CCTCCTGCTTCTCTCTTATAAGG - Intergenic
1172290160 20:33770300-33770322 CCTCCTGCTTCCCTCTCCCTGGG + Intronic
1172297012 20:33819555-33819577 CCTCCTCCCTCTTCCTTACAGGG + Intronic
1172309467 20:33906494-33906516 CCTCCTGCCTCAGCCTTCCAAGG - Intergenic
1172475900 20:35237413-35237435 CCCCCTGCCTTCCTCTTATAAGG + Intronic
1172490843 20:35336445-35336467 CCTTCCGCCTCTCTCTTAAAAGG - Intronic
1172690575 20:36786637-36786659 CTCCCTGCCTCCCTCTTCCTAGG - Exonic
1172769859 20:37375479-37375501 CCTCCTGCCTCTGCCTCACAAGG + Intronic
1172862029 20:38062013-38062035 TCTCCCACCTTCCTCTTACAAGG - Intronic
1172934370 20:38609236-38609258 CATCCTGCCTCCCTCCAACCTGG + Intronic
1173010609 20:39178310-39178332 CCCTCTGCCTCTCTCTTAAAAGG - Intergenic
1173044214 20:39493916-39493938 CCCTCTGCCTGTCTCTTACAAGG - Intergenic
1173204961 20:40985676-40985698 CATCCTGCCTTCCTCTTATAAGG + Intergenic
1173376417 20:42487569-42487591 CCTCTTGCCTCCCTCTTATAAGG - Intronic
1173540132 20:43844772-43844794 CCCTCTGCCTCTCTCTTATAAGG - Intergenic
1173983470 20:47242462-47242484 CCCCCTGCCCTCCTCTTAGAAGG - Intronic
1174073002 20:47912018-47912040 CTTCCTGCCCTCCTCTTATAAGG + Intergenic
1174073661 20:47916677-47916699 CCTCCTGCCTCCTTCTTACAAGG - Intergenic
1174075653 20:47934146-47934168 CCTCCTTCCGTCCTCTTATAAGG + Intergenic
1174132884 20:48358520-48358542 CCTCCTTCCTCCCTAGTTCAAGG - Intergenic
1174151060 20:48486623-48486645 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1174157508 20:48525418-48525440 TCTCCTGCCTCACTATGACATGG - Intergenic
1174419787 20:50391909-50391931 CCTCCCGCCTCCCTCTCATAAGG - Intergenic
1174433551 20:50489074-50489096 CCTCTTGCTTCCCTTTTATAAGG + Intergenic
1174481205 20:50832801-50832823 CCTCCTGCCTCCCTCTTGTAAGG + Intronic
1174776751 20:53350053-53350075 CCTCCTCCCTCCCTTGTATAAGG + Intronic
1175039604 20:56035754-56035776 CCTCCTGCCTCCCTTCTCTAAGG + Intergenic
1175124459 20:56741033-56741055 CGTCCTGTCTCCCTCTTATGAGG + Intergenic
1175131446 20:56792702-56792724 CCTCCTGCCTCCCCTTCGCAAGG - Intergenic
1175158382 20:56989892-56989914 CCTCCAACCTCCCTGTTCCAGGG + Intergenic
1175172489 20:57090345-57090367 CCTCCTACCTCCGTCTTATAAGG - Intergenic
1175495979 20:59414562-59414584 CCTCCTGTGTCCATCTTATAAGG + Intergenic
1175658482 20:60792323-60792345 CCTCCTGCCTCCCTCTGTTAAGG + Intergenic
1175723700 20:61302860-61302882 CCTCCGGCCTCCCTTTTGGAAGG - Intronic
1175739095 20:61408139-61408161 TCCCCTGCCTCTCTCTTATAAGG + Intronic
1175765938 20:61592993-61593015 CCTCCTGCCCCCCTCCTATAAGG - Intronic
1175958258 20:62622317-62622339 CCTCCTGCCTCCTTCCTAGATGG - Intergenic
1176049008 20:63106801-63106823 CTTCCTGCCTCGCTCCTATAAGG - Intergenic
1176069808 20:63220189-63220211 CCTCCTGCCTCCCTGTGCCTTGG + Intergenic
1176295166 21:5068067-5068089 CCCCTTGCCTTCCTCTTACAAGG + Intergenic
1176513563 21:7766809-7766831 CCCTCTGCCTCCCTCTTACAAGG - Intronic
1176713417 21:10328266-10328288 CTTCCTGCCTCCCTCCTCCATGG - Intergenic
1176801392 21:13434127-13434149 CCTCCTGCCTCACCCTCCCATGG - Intergenic
1176946636 21:14990208-14990230 CCTCCACCCCTCCTCTTACATGG + Intronic
1177278120 21:18942387-18942409 ACTCCTGCTTCCCTTTTAAAAGG + Intergenic
1177315950 21:19461227-19461249 CCTCTGGCCTCCCCCTTACAAGG - Intergenic
1177420703 21:20853139-20853161 CCTTCCGTCTCCCTCTTATAAGG + Intergenic
1177606266 21:23381468-23381490 CCCTCTGCCTCTCTCTTATAAGG + Intergenic
1177744267 21:25192243-25192265 TCTACTGCCTCCCTTTTAAATGG - Intergenic
1177767701 21:25476762-25476784 CCTCCTGCCTCCACCTCCCAAGG - Intergenic
1177881916 21:26704362-26704384 CCTTCAGCCTCCCTTTTATAAGG + Intergenic
1178029023 21:28503838-28503860 CCACCTGCTTCCCTCTTATAAGG - Intergenic
1178642356 21:34355349-34355371 CCCCCTGCCTGCTTCTTATAAGG - Intergenic
1178647676 21:34397333-34397355 CCCTCTGCCTCCCTCTTACAAGG - Intronic
1179043448 21:37825048-37825070 CTCTCTGCTTCCCTCTTACAAGG + Intronic
1179130313 21:38630444-38630466 CCTCCCACCTCCCTGTTGCATGG - Intronic
1179211430 21:39327793-39327815 CCTCCTGCCTCAGTCTCCCAAGG - Intergenic
1179384109 21:40925704-40925726 TCACCTGTCTCCCTCTTACAGGG - Intergenic
1179596776 21:42448313-42448335 TCTCCTGCCTCCCTCCTACAAGG + Intergenic
1179861883 21:44194061-44194083 CCCCTTGCCTTCCTCTTACAAGG - Intergenic
1179942992 21:44651613-44651635 CCTCCTCCCTCCTTCTGATAAGG + Intronic
1180084850 21:45503990-45504012 CCGCCTGTCTCTCTCTTGCAGGG + Exonic
1180160296 21:45996154-45996176 CCTTCTGCCTCCCACTTACCTGG + Intronic
1180829798 22:18898845-18898867 CTTCCTGCCTCCCTCCTCCATGG - Intergenic
1180971937 22:19820415-19820437 CTGCCTGCCTCCCTGTGACAAGG + Intronic
1181033902 22:20160886-20160908 GCTCCTGCCTCCCCCTTCCCTGG - Intergenic
1181101684 22:20544926-20544948 CCTTCTGCCTCCCTCTTAGGAGG + Intronic
1181389298 22:22568049-22568071 CCCCCTGCCTCCCTCTCGAAAGG - Intergenic
1181935842 22:26437805-26437827 CCTCCTTCCTGCCTCTTTCAGGG + Intronic
1182069107 22:27450910-27450932 CCTCTTGTCTCCCCCTTATAAGG - Intergenic
1182096443 22:27629214-27629236 CCTCCTGCCTTCCTCTTATAAGG + Intergenic
1182106315 22:27692304-27692326 CCTCCTGCCTTCCTCTTACAAGG - Intergenic
1182191889 22:28469543-28469565 CCCTCTGCCTCCCTCTTATAAGG - Intronic
1182205716 22:28623193-28623215 CCTCCTGCCTCAGCCTTCCAAGG + Intronic
1182850316 22:33468356-33468378 CCTCCTGCCTCAGTCTTCCAAGG - Intronic
1182877330 22:33703566-33703588 CTTCCTGCATCTCTCTTATAAGG - Intronic
1182924605 22:34110515-34110537 CCTCCTGTCTTCCTCTTACAAGG + Intergenic
1183068115 22:35377687-35377709 CATCCAGCCTCCCTCTTATAAGG + Intergenic
1183514899 22:38259453-38259475 CCTCCTGCCTTCCTCCTACGAGG - Intronic
1184304531 22:43587603-43587625 CCCTCTGCCTCCCTCTTATAAGG + Intronic
1184364358 22:44040485-44040507 CCTCCTGCCTCCTTCTCATAAGG - Intronic
1184413122 22:44337268-44337290 CCCTCTGCCTCCCTCTTATAAGG + Intergenic
1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG + Intergenic
1184529253 22:45044040-45044062 CCCTCTGCCTCCCTCTCATAAGG - Intergenic
1184638195 22:45852764-45852786 CCTCCAGCCACCATCTTATAAGG + Intergenic
1184659367 22:45958835-45958857 CCTCCTGCCCCTGACTTACATGG - Intronic
1184681316 22:46073739-46073761 CCTCATGCCTCCCTCCCACTGGG + Intronic
1184744777 22:46449900-46449922 CCTCCAGCCTCCAACATACATGG + Intronic
1185106389 22:48872178-48872200 CCTCCTGCCTCCCCATGACAGGG + Intergenic
1203279889 22_KI270734v1_random:124118-124140 CTTCCTGCCTCCCTCCTCCATGG - Intergenic
949098385 3:113780-113802 CCCCTTGCCTCCCTCTTATAAGG + Intergenic
950008670 3:9706898-9706920 CCTCCTGCCTCCCAGTCACCTGG - Intronic
950063677 3:10093612-10093634 CCTCCTTCCTCCCTTTTGCCTGG - Intronic
950921595 3:16700369-16700391 CCTCCTGCTTCCCTCTTACAGGG + Intergenic
951369562 3:21828952-21828974 CCTCTTGTCTCCCTCTTACAAGG + Intronic
951605769 3:24433337-24433359 CCTCCTGCATCCTTTTTATAAGG - Intronic
951951258 3:28201669-28201691 TCTCCTGCCTCCCTCTCATAAGG - Intergenic
952196827 3:31084628-31084650 CCTCTTGACTTCCTCTTATAAGG - Intergenic
952234084 3:31461121-31461143 CCTCCTGCCTCCCTTTTGAAAGG - Intergenic
952290171 3:32007612-32007634 CCCTCTGCCTCTCTCTTATACGG + Intronic
953105136 3:39870244-39870266 TCTCCTTCTTCCCTCTTTCAGGG - Intronic
953163274 3:40441915-40441937 CCTCCTGCCTCAGCCTTCCAAGG - Intergenic
953202459 3:40789652-40789674 GCTCTTGCCTCCTTCTTATAAGG - Intergenic
953274740 3:41483811-41483833 TCTCCTGCCTCCCTCTGATGAGG - Intronic
953370760 3:42386407-42386429 CCCCCCGCCTCCCTCTTTTAAGG + Intergenic
953386422 3:42508766-42508788 CCTCTTGCCTCCCAACTACAAGG + Intronic
953450896 3:43005098-43005120 CTTCTTGCTTCCCTCTTAAAAGG + Intronic
953724428 3:45385435-45385457 CTCTCTGCCTCCCTCTTATAAGG + Intergenic
954689825 3:52389721-52389743 CCTCCTACCACCCTCTTGCTGGG - Intronic
954748550 3:52800800-52800822 GGTCCTGCCTCCCTCTGCCAGGG + Intronic
954850608 3:53596576-53596598 ACTCTTGCCTCCCTCTTGTAAGG - Intronic
955236393 3:57143523-57143545 CCTCCTGCCTACTTCTGATAGGG - Intronic
955745610 3:62137381-62137403 CCTCTTGCCTCTCACTTAGAAGG - Intronic
955808408 3:62760592-62760614 CCTCCTGCCTCCTCCTTGCTGGG + Intronic
956196471 3:66657801-66657823 CCTCCTACATCCCTCTAATAAGG + Intergenic
956374052 3:68595163-68595185 CTTCTTGCCTCCCTCTTATAAGG + Intergenic
956736170 3:72239943-72239965 CCTCATGGCTCCCTCCTCCAAGG + Intergenic
956750835 3:72342619-72342641 TCTCCTGCCTCCTTCTTAGAAGG + Intergenic
956775511 3:72562159-72562181 CCTCCTGCCTCCCTGTTATAAGG - Intergenic
956878991 3:73491313-73491335 CCTCCTGGCTGCATCTTCCATGG - Intronic
956899808 3:73703704-73703726 CCTCCAGCCTCTCTTTTATAAGG + Intergenic
956958973 3:74375567-74375589 CCTCCTGCCTCTCTCTTATAAGG - Intronic
956974595 3:74565403-74565425 CCTCCTGCCTCTCTCTTAGAAGG + Intergenic
957555349 3:81759636-81759658 CCTCATGCCTCACTCTGACCCGG - Intronic
957631738 3:82724720-82724742 CCTCCTGCCTCCCTCTTAGAAGG - Intergenic
957771357 3:84696340-84696362 CTCCCTTCCTCCCTCTGACAGGG - Intergenic
957884081 3:86260644-86260666 CCCTCTGCTTCCCTCTTATAAGG + Intergenic
958612886 3:96450031-96450053 CCTGCTGCCTCCTCCTTAGAGGG + Intergenic
958727592 3:97924709-97924731 CCTCCTACCTTCCTCTTACAGGG + Intronic
959478769 3:106845676-106845698 TCTCCTGCTTCTCTCTTATAAGG - Intergenic
959787856 3:110322052-110322074 CTTTCTGTCTCCCTCTTATAAGG + Intergenic
959794960 3:110415398-110415420 AATCCTGCCACCCTCTTATAAGG - Intergenic
959862428 3:111230826-111230848 CCTCCTGCCTCAGTCTCTCAGGG - Intronic
960255888 3:115511269-115511291 CCTCCAGCCTCCTTCTTTAAAGG - Intergenic
960432592 3:117587741-117587763 CCTGTTGCCTCTCTCTTATAAGG + Intergenic
960673749 3:120175591-120175613 TCTCCTCCCTCCCTCCTATAAGG - Intronic
960947547 3:122977184-122977206 CTTCCTGTCCCACTCTTACAAGG + Intronic
961200393 3:125040947-125040969 CCTCCTGCCTGCCACTCAGAGGG - Intronic
961261421 3:125605265-125605287 CCTCCTGCCTCTCTTCTCCAAGG + Intergenic
961367778 3:126412258-126412280 TCTCCTGCCTCCCAATTACAAGG + Intronic
961473574 3:127133681-127133703 CCTCTGGCCTCCCTCTTATAAGG + Intergenic
961517569 3:127447539-127447561 CTTCCTGCCTCCCTCTTATAAGG - Intergenic
961611446 3:128143081-128143103 CCTCCTGCCACTCTCTTATAAGG + Intronic
962304351 3:134272522-134272544 CCTCCAGCCTCCCACTGAGATGG + Intergenic
962363235 3:134758970-134758992 CTTCCTGCCTCCCTTTTATAAGG - Intronic
962422810 3:135242832-135242854 CCACCTGCCTCCACCTTCCAAGG - Intronic
962904079 3:139786251-139786273 ATTTCTGCCTCCCTCTTATAAGG - Intergenic
962906605 3:139809136-139809158 CCTCCTCCCTCGGTCTTCCAAGG - Intergenic
963103064 3:141623812-141623834 CCTCCTTCCTCCCTCCAGCAGGG + Intergenic
963128024 3:141833216-141833238 CCTCCTGCCTCCCTTTTATGAGG - Intergenic
963240160 3:142995076-142995098 TCTGCTCCCTCCCTCTTATAAGG - Intronic
963268781 3:143265685-143265707 CCTCAGGTCTCCCCCTTACAAGG - Exonic
963463575 3:145648600-145648622 CCTCCAGCCTCCCTCTTATAGGG - Intergenic
963686769 3:148444961-148444983 CCTCCTGCATCCCTCTGACAAGG - Intergenic
963688906 3:148473623-148473645 CATACTACCTCACTCTTACAAGG + Intergenic
964670388 3:159219006-159219028 CCCTCTGCCTTCCTCTTAGAAGG + Intronic
964862691 3:161220026-161220048 CCCCCCGCACCCCTCTTACAAGG - Intronic
964928905 3:161991574-161991596 CCTCCTGCCTTCTTCCCACAGGG - Intergenic
965905588 3:173701342-173701364 CCTCTTGCCTCCCTCTTACAAGG - Intronic
966147322 3:176826622-176826644 TCCTCTGCCTCTCTCTTACAAGG + Intergenic
966990443 3:185224836-185224858 CCTTCTGCTTCCCTCTTATAAGG + Intronic
967149778 3:186637866-186637888 CCTGCTACCTTCCTTTTACATGG + Intronic
967164135 3:186765575-186765597 TGTCCTGCCTCCCTCTTATAAGG - Intergenic
967548461 3:190760861-190760883 CCTCCTACGTCCCTCTCATAAGG + Intergenic
967840752 3:194003135-194003157 CCTCCTCCCTCCCGCTCCCAGGG + Intergenic
967965966 3:194960491-194960513 CCTCATGGCTCCTTCTCACAAGG - Intergenic
968359480 3:198137344-198137366 CTTGCTGCCTCCCTCTCATAAGG + Intergenic
968509302 4:988329-988351 CCTCGTGCCTCCCCCTCACAGGG - Exonic
968685641 4:1956666-1956688 CATCCTGCCTCCCTCAAACGTGG - Intronic
968728990 4:2261067-2261089 CCTCCTCCCGCCCCCTTAAAAGG + Intronic
968807697 4:2786464-2786486 CCTCCTCCCGGCCTCTGACAGGG - Intergenic
968881132 4:3300771-3300793 CCTTTTGCCTCCCTCTTTTACGG + Intronic
968929412 4:3570635-3570657 CCTCCTGCCTCCCTCTTAAAAGG - Intergenic
969050579 4:4370057-4370079 CCCCCTGACTCCCTCTTATAAGG - Intronic
969105281 4:4802853-4802875 CCTCTTGCTTCCCTCTTACGAGG - Intergenic
969245860 4:5932327-5932349 CTGCCTGCCTCCCTCTTTGATGG - Intronic
969257940 4:6015294-6015316 CCTCCTCTCCTCCTCTTACAAGG - Intergenic
969302618 4:6306113-6306135 CCTCCAGCCTCCCTCTTACAAGG - Intergenic
969342742 4:6552592-6552614 CCTCCTACCTCCCTCTTATAAGG + Intronic
969440981 4:7216668-7216690 CCTCCTGCCTCCCTCTTTTAAGG + Intronic
969483539 4:7459331-7459353 CCTCATGTCTCCCTAGTACAAGG - Intronic
969622091 4:8283789-8283811 CCTCCAGCCTCCCTGTGACGAGG + Intronic
969710706 4:8841362-8841384 CCTCTAGCCTCCCTCTCTCAGGG + Intergenic
969917571 4:10505696-10505718 ACTCCTGGTTCCCTCTTACAAGG + Intronic
969994961 4:11302490-11302512 CCTCAGTCCTCCCTCTAACAGGG + Intergenic
969998388 4:11338778-11338800 CCTCCTGACTCTCTCTTATAAGG + Intergenic
970371601 4:15412525-15412547 ACTTCTGCCTCCCTCTTAAAAGG + Intronic
970418498 4:15882629-15882651 CTCCCTGCCTCCTTCTTATAAGG - Intergenic
970580032 4:17466689-17466711 CCTTCTGCCTCCCTTTTATAAGG - Intronic
970586291 4:17517605-17517627 CCTCCTTCTTCCTTCTTAGAAGG + Intronic
970602826 4:17653855-17653877 CCTCCTACGGCCCTCTTATAAGG - Intronic
970906541 4:21223153-21223175 CCACTTGCCTCCCACTTATAAGG - Intronic
971232596 4:24812062-24812084 TCTCTTGCCTCCCTCTTGAAAGG + Intronic
971260999 4:25057107-25057129 CCTCCTACCTCCCTCTTGTAAGG + Intergenic
971420213 4:26467658-26467680 TCTCCTGCCTCCCTTCTATAAGG - Intergenic
971454921 4:26835166-26835188 ACTCCTGCCTCCCTCTTATAAGG - Intergenic
971596169 4:28531736-28531758 CCTCCTGCCTGTCTCTTATAAGG - Intergenic
971700421 4:29966509-29966531 CCTCCTGCTTCCCTGACACAAGG + Intergenic
972180621 4:36460457-36460479 CCTCCTGCTTTCTTCTTAGAAGG + Intergenic
972247931 4:37265726-37265748 CCTTATGCCTCCCTCTTATAAGG + Intronic
972418411 4:38864899-38864921 CCTCCTGCCTCAGCCTCACAAGG - Intergenic
972667370 4:41180190-41180212 CCTCCTCGCTATCTCTTACAAGG + Intronic
972842562 4:42948767-42948789 CTTCCTGCCTCCTTTTTATAAGG - Intronic
972881952 4:43435660-43435682 CCTCCTGTCTCCCTTTAACAGGG + Intergenic
972894123 4:43597996-43598018 CTTCCTGCCTCCCTCTTTCAAGG + Intergenic
973033839 4:45379905-45379927 CTTACGGCTTCCCTCTTACAAGG - Intergenic
973116574 4:46467572-46467594 CCTTCTACCTCCCTCTTATAGGG - Intronic
974093284 4:57334916-57334938 CCTTCTGCCTCCCTCTCATAAGG - Intergenic
974467935 4:62281604-62281626 CTTCCTGCCTCCCTCTTATAAGG - Intergenic
974576069 4:63724582-63724604 TCTCCAGGCTCCCTCTTATAAGG + Intergenic
975400840 4:73938001-73938023 CCTCCTGCCTCAGTCTCCCAAGG + Intergenic
975960658 4:79900093-79900115 TCTGCTGCCTCCCTCTTATAAGG - Intergenic
976132751 4:81902491-81902513 TCTCCTGCCTCTCTCTTACAAGG + Intronic
976179435 4:82385108-82385130 CCTCCTGTCCCCCTCTTACAAGG - Intergenic
976809177 4:89082040-89082062 CTTCCTGCCTCCTTCTTATAAGG - Intronic
976830710 4:89310524-89310546 CCTCCTGCATCCCTCCTGGAAGG + Intergenic
977156656 4:93582289-93582311 CCTCCTGACTGTCTCTTAAAAGG + Intronic
978994913 4:115139060-115139082 TTTTCTGTCTCCCTCTTACAGGG - Intergenic
979194240 4:117900870-117900892 CCACCTACTTCCCTCTTAGAAGG + Intergenic
979845854 4:125510721-125510743 CCTCCTCCATCTCTCTTATAAGG + Intergenic
979961824 4:127029711-127029733 TCTTCTGCCTCCCTCTTATTGGG - Intergenic
980785814 4:137553333-137553355 CCGCCTGCCTCCTCCTTCCAAGG - Intergenic
980935928 4:139225843-139225865 CCTCCTGCCTCAGCCTTCCAAGG - Intergenic
981098142 4:140802729-140802751 CCTTTTGCCTCCCTCTTAGAAGG + Intergenic
981116143 4:140993336-140993358 CCTCATGCTTCCCTTTTATACGG + Intronic
981291115 4:143076751-143076773 TCTCCTGACTTTCTCTTACAAGG - Intergenic
981339779 4:143608044-143608066 CCTCTTGCATCTCTCTTATAGGG + Intronic
981567585 4:146116862-146116884 TCGCCTGCATCCCTCTTATAAGG + Intergenic
981925931 4:150139106-150139128 CCTCCTGCCTCAGCCTCACAAGG + Intronic
981971456 4:150667317-150667339 CTTCCTTCCTCCCTCTTATAAGG - Intronic
983090630 4:163497668-163497690 CCTCCTGCCTTCCTCTTACATGG + Intronic
983100085 4:163614821-163614843 TCTACTGCCTCCCTCTCATAAGG - Intronic
983125604 4:163947485-163947507 ACTTCTGCCTCCCTCTTATGTGG - Intronic
983434443 4:167694437-167694459 CTTCCTGCCTGCCTCTCACATGG - Intergenic
983610989 4:169644823-169644845 CCTCCTGCCTCCCTCTTTTAAGG - Intronic
983633109 4:169870113-169870135 CCGCCTTCCTCCCTCTTCCAAGG - Intergenic
983739396 4:171109569-171109591 TGTCCTGCTTCCCTCTTATAGGG - Intergenic
984248167 4:177300534-177300556 CCTCCTGCCTGCCTTTTATGAGG + Intergenic
984345875 4:178524404-178524426 TCTCTTGCCTCCCTCTCAGAAGG - Intergenic
984379132 4:178967938-178967960 CCTCCTGCTTTCCTCTTACAAGG - Intergenic
984461851 4:180047281-180047303 CCTCCTGCATCCTTCATATAAGG - Intergenic
984467794 4:180123552-180123574 CCTCCAGCCTTGTTCTTACATGG - Intergenic
984709369 4:182872309-182872331 CCTCCTGCCTCTCTCTTGTAAGG + Intergenic
984867619 4:184295430-184295452 TCTCCTGCCTCCCCCTTCTAAGG - Intergenic
985008125 4:185554986-185555008 CCTCCTATCTCCCAATTACATGG - Intergenic
985234227 4:187855408-187855430 CCTCATGCCACCCTCTTCTAAGG - Intergenic
985629116 5:1005604-1005626 CCCCCTGCCTGCCTCTTCCAGGG - Intergenic
985747639 5:1656104-1656126 TCTCCTGCCTCCTCCTTGCAAGG - Intergenic
986304363 5:6504534-6504556 CCCTCTGCCTTCCTCTTATAAGG + Intergenic
986367146 5:7043731-7043753 CCCTCTGCCTCCCTCTTATAAGG + Intergenic
986704484 5:10443856-10443878 CCCTCTGCCTCCTTCTTCCAAGG + Intronic
986791366 5:11164140-11164162 CCTCCTACCTCCCTCTCATAAGG + Intronic
986876553 5:12117886-12117908 ACTCCTGCCTCCCTCTTATGAGG + Intergenic
986986847 5:13510191-13510213 CCTCCTGCCTTCCTCTCATATGG - Intergenic
987150883 5:15038537-15038559 CCTCCTACCTTCCTCTTATGAGG + Intergenic
987180974 5:15368148-15368170 CCTCCTACCTCCCTCTTATAAGG - Intergenic
987188062 5:15445235-15445257 CCTCCTGCCTTCCTCTAATAAGG - Intergenic
987214059 5:15714554-15714576 AGCCCTGCCTCTCTCTTACAAGG - Intronic
987588897 5:19896429-19896451 CCCCTTGCCTCTCTCTTAGAAGG - Intronic
987959342 5:24785083-24785105 TCTACTACCTCTCTCTTACAAGG + Intergenic
988440573 5:31228180-31228202 CCACCTGCCTCCCTCTTTTAAGG + Intronic
988709964 5:33763290-33763312 CCTCTTGCCTTCCTCTTATAAGG - Intronic
988815146 5:34827219-34827241 TTTCTTGCCTCCCTCTTATAAGG + Intronic
989116445 5:37958495-37958517 CCTTTTGCCACCCTCTTACAAGG + Intergenic
989445568 5:41524670-41524692 TTTCCTGCCTTCCTCTTATAAGG - Intergenic
989603957 5:43226298-43226320 CCTCCTGCCCACCTTTAACAGGG - Intronic
990220190 5:53579814-53579836 CCACCTGCATCCTTCTTATAAGG - Intronic
990232233 5:53725851-53725873 CCGTCTGCTTCCCTCTTATAAGG + Intergenic
990374093 5:55152010-55152032 CCCTCTGCCTTCCTCTTACAGGG - Intronic
990412486 5:55554655-55554677 CCCTCTGCCTCCCACTTATAAGG - Intergenic
990445649 5:55891600-55891622 CTCTCTGCCTCCCTCTTATAAGG + Intronic
990837112 5:60034496-60034518 CTTCCTGCCTCTCTCTTAAAAGG + Intronic
991433217 5:66569466-66569488 CCTTCTGCCTCCCTCTTATAAGG - Intergenic
991556837 5:67904566-67904588 CCTGCTACTTCCCTCTTATAGGG - Intergenic
991625933 5:68601140-68601162 CTTTCTGCCTCCCTCCTATAGGG + Intergenic
991638769 5:68732983-68733005 CTTCCTGCAACCCTCCTACAGGG + Intergenic
992318751 5:75588820-75588842 CCTCCTGCCTCCTTCTTATAAGG + Intronic
992356186 5:75986294-75986316 CCTCCTGCATCCATCTTTCAGGG - Intergenic
992591828 5:78303533-78303555 CCTTCTGCCTTCCTCTTTTAAGG + Intergenic
993081842 5:83310780-83310802 CCTTCTTCCTCCCTCTAATAAGG - Intronic
993558226 5:89368272-89368294 CCTTCTGCCTCCATCTTATAAGG + Intergenic
993749138 5:91645259-91645281 ACTCCTGCCTCCCTCTTACAAGG + Intergenic
993858178 5:93101086-93101108 CCTCCTGTCTTCCTCTTATAAGG - Intergenic
994275926 5:97837221-97837243 CCTCCTACCTCCCTCTTGTAAGG + Intergenic
994667837 5:102728182-102728204 CTTCCTGCCTCCCTGTTATAAGG - Intergenic
995118328 5:108507216-108507238 TCCTCTGCCTCCCTCTTCCAAGG + Intergenic
995118430 5:108508252-108508274 TCCTCTGCCTCCCTCTTACAGGG - Intergenic
995261949 5:110114344-110114366 CCTCCTCTGTCCCTCTTATAAGG + Intergenic
995307300 5:110668357-110668379 CCTCCAGGCTCCCTCTTAGAGGG - Intronic
995531062 5:113092241-113092263 ACTCCTGCTTCCCTCTTAGAGGG - Intronic
995587121 5:113659734-113659756 CCATCTGCCTCCCTCTAAAAAGG - Intergenic
995794949 5:115931262-115931284 TCTTCTGCCTCCCTCTTCTAGGG + Intergenic
995820044 5:116219466-116219488 CCCTCTGCCTCTCTCTTATAAGG - Intronic
995864356 5:116675632-116675654 CCTCCTGCCTCCCCGCTCCAAGG + Intergenic
996141429 5:119913814-119913836 CCTCCTGCCTTCCACTCCCAAGG + Intergenic
996349694 5:122524610-122524632 ACTCCTGCTGCCCTCTTATAAGG + Intergenic
996389581 5:122945220-122945242 TCTGCTGCCTCCCTTTTATAAGG + Intronic
996401660 5:123069417-123069439 TCTCCAGCCTCCCTCCTATAAGG - Intergenic
996482616 5:123991815-123991837 CCTCGTGCCTTCCTCCTATAAGG - Intergenic
996624046 5:125548280-125548302 CCTCCTACCTCCCTCTTATGAGG + Intergenic
996783747 5:127216031-127216053 GCTCAGGCCTCACTCTTACAAGG - Intergenic
997053670 5:130413777-130413799 CCCTCTGCCTCCCTTTTATAAGG + Intergenic
997205450 5:132046056-132046078 CCTCCTAATTCCCTCTTACAAGG + Intergenic
997254454 5:132417711-132417733 CCCCCTGCCTCCCTCTTATAAGG + Intronic
997392979 5:133532095-133532117 CCTCCTGCCTCTCTTTTAGAAGG - Intronic
997460006 5:134045593-134045615 TCTTCTGCCTCCCTCTTTGAAGG + Intergenic
997830579 5:137146238-137146260 CCTCCTTCCTCCCTCTCCCCAGG + Intronic
998035470 5:138911485-138911507 GCCCCTGCCTCCCTCATATAAGG - Intronic
998177631 5:139911616-139911638 CCTGCTGCCAGCCTCTTCCAGGG + Intronic
998188701 5:140003415-140003437 CCTCCTACCTCCCTCTTACAAGG - Intronic
998554854 5:143113525-143113547 CCTCCTCTCTCAATCTTACAGGG + Intronic
998558687 5:143150526-143150548 CCTCCTTCATCCTTCTTACCTGG - Intronic
999210669 5:149885929-149885951 CCTCTTGCTTCCCTCTTATAAGG + Intronic
999327012 5:150649893-150649915 CCGCCTGCCTCCCTCTACCATGG + Exonic
1000123942 5:158225284-158225306 CCTCTTGCGTCTTTCTTACAAGG - Intergenic
1000150150 5:158492254-158492276 CCTGCTGCCTCCCTCTACCAAGG - Intergenic
1000608089 5:163345514-163345536 CTTCTTGCCTGCCTCTTATAAGG + Intergenic
1000624900 5:163527769-163527791 ATTCCTGCCTCCCTCTTAAAAGG - Intergenic
1001038440 5:168314822-168314844 CCTCCTGCCACCCTCATGCCAGG - Intronic
1001051869 5:168420312-168420334 CCTCCTCCCTCCGTTTCACATGG + Intronic
1001329370 5:170751656-170751678 CTGCCTGCCTCCCTCTCACCTGG - Intergenic
1001545937 5:172570660-172570682 CTTCCTTCCTCCCTTTAACAGGG - Intergenic
1001658549 5:173373179-173373201 CCTCTTGCCTCCCTTTTATAAGG - Intergenic
1001789813 5:174446366-174446388 CCCTCTGCCTCTCTCTTACAAGG - Intergenic
1001798634 5:174524041-174524063 CCTCCTGTCTGCCTCTTCTAGGG + Intergenic
1001805265 5:174579297-174579319 CTTCCTGCTGCCCTCTTAAAAGG - Intergenic
1001813141 5:174645963-174645985 CCCTCTACCTCTCTCTTACAAGG + Intergenic
1002014588 5:176309824-176309846 CCTCCTGCCTCCCTAGTAGCTGG - Intronic
1002080009 5:176732259-176732281 CCCCCTGCCTCCCGATTATAAGG + Intergenic
1002478025 5:179480476-179480498 CCTCCTGCCTTCCTCCTAGAAGG + Intergenic
1002682299 5:180976185-180976207 CCTCCTGACTCTCTCTTGCATGG + Intergenic
1002846957 6:955487-955509 CTTCCTGCCTTCCTCTCACAAGG - Intergenic
1002939019 6:1699651-1699673 CCTCCTGCCTTCCTCCTATAAGG + Intronic
1003073249 6:2960892-2960914 CCCCCTCCCTCCCTCTTAGAAGG - Exonic
1003492916 6:6639647-6639669 TCTCCTACCTCCCTCTTATAAGG + Intronic
1003837441 6:10086994-10087016 CCTCCTGCCTCAGTCTTGCAAGG - Intronic
1004094106 6:12535659-12535681 CCTGCAGCTTCCCTCTAACAGGG - Intergenic
1004199184 6:13532195-13532217 CCTCCTGCCTCCTTTTTTTAAGG + Intergenic
1004218370 6:13723303-13723325 CCCTCTGCCTCTCTCTTATAAGG - Intergenic
1004222400 6:13758105-13758127 CCTCCTCCCTCTCTCTTATAAGG - Intergenic
1004510083 6:16278047-16278069 CCTCCTGCCTGCCTGTCCCACGG - Intronic
1005051502 6:21687966-21687988 TCTCCTGCCTGTCTCTTATAAGG - Intergenic
1005175678 6:23041805-23041827 TCTCTTGCTTCCCTCTTACAAGG - Intergenic
1005348096 6:24910052-24910074 CCTTCTAGCTCCCTCTTACAGGG - Intronic
1005774964 6:29121057-29121079 CTTCTGGCCTCCCTCTTATATGG + Intergenic
1005781012 6:29192284-29192306 CCTCCAGCCTCCCTCTTATATGG + Intergenic
1006034791 6:31202719-31202741 CCTCCTTCCTCCCTCCTCAATGG + Exonic
1007087938 6:39163521-39163543 TCTCCTGCCTCCGTCTTATAAGG - Intergenic
1007337975 6:41168466-41168488 CCTCCTGCCTCCCTCCATCCCGG + Intergenic
1008179095 6:48305458-48305480 TCTACTGCCTCCCTCTTTAAAGG - Intergenic
1008402488 6:51079706-51079728 CTCTCTGCCTCCCTCTTATAAGG - Intergenic
1008856358 6:56093032-56093054 TCCTCTGCCTCTCTCTTACAAGG + Intronic
1009386190 6:63085833-63085855 CCTCCTGCCTCTCTTTTCCGAGG - Intergenic
1010009827 6:71037070-71037092 CCCTCTGCCTCCCTCTTATAAGG - Intergenic
1010158448 6:72822963-72822985 CCTCCTGCTTCCTTTTTACGAGG + Intronic
1010501452 6:76606103-76606125 AATTCTGCCTCCCTCTTAGAAGG - Intergenic
1011135135 6:84092138-84092160 CATCCTGCTTCTCTCTTATAAGG + Intergenic
1011476674 6:87755444-87755466 CCCTCTGCCTCCCTCTTATAAGG + Intergenic
1011597124 6:89026602-89026624 CCTCCTGCCTTCCTTTTACAAGG - Intergenic
1011703112 6:89973523-89973545 CCTCCTGCCTCCCTCTTTTAAGG + Intronic
1011800307 6:91005207-91005229 CCTCCTGTGTCCCTCTGACATGG + Intergenic
1012027346 6:94013120-94013142 TCTCTTGCCTTCCTCTTAAAAGG - Intergenic
1012205744 6:96458354-96458376 CCCTCTGCCTCTCTCTTATAAGG - Intergenic
1012209707 6:96504753-96504775 TCTCCTGCATCCCTTTTATAAGG + Intergenic
1012676772 6:102124260-102124282 CCTCCTGCTTCCCTTTTATAAGG - Intergenic
1013055383 6:106577745-106577767 CCTCCTGCCTTCCCCTTATAAGG - Intronic
1013380094 6:109560002-109560024 CTTCCTGTCTTCCTCTTACAAGG + Intronic
1013753671 6:113436425-113436447 TCCTCTGCCTCCCTCTTATAAGG + Intergenic
1013770899 6:113626939-113626961 TCTCCTGCCTCCCTTTCATAAGG + Intergenic
1014159479 6:118151622-118151644 CCTCCTGCCTCAGTCTCCCAAGG + Intronic
1014713226 6:124833904-124833926 CCTTCTGCTTCCCTCTTAAAAGG - Intergenic
1014742147 6:125158071-125158093 CCCTCTGCCTCTCTCTTATAAGG + Intronic
1014787233 6:125632993-125633015 CCTCATCCTTCCCTCTTACCAGG + Intergenic
1014936515 6:127391778-127391800 CTTGCTGCCTCCCTCACACAAGG + Intergenic
1015173055 6:130276065-130276087 CCTCCTGTTTCCCTGTTATAAGG - Intronic
1015889357 6:137954413-137954435 CCTACTGCCTCCCTCTGATAAGG + Intergenic
1016369299 6:143355562-143355584 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1016884667 6:148948121-148948143 CATCCTGCCTCCTGCTTACAAGG + Intronic
1016918973 6:149272567-149272589 ACTGCTGCCTCCTTCTTACAAGG + Intronic
1017112170 6:150942148-150942170 CCTCCTGCCTCCGCCTCCCAAGG - Intronic
1017430902 6:154369813-154369835 GTTCCCACCTCCCTCTTACAGGG + Intronic
1017565418 6:155679740-155679762 CCTCCTGCCTTCATCCTGCAAGG - Intergenic
1018712562 6:166507143-166507165 CCTCTTCCCTCCCTCTTCCCAGG + Intronic
1018754691 6:166838884-166838906 CCTGCTGCCTTCCTCTTATGAGG - Intronic
1018830479 6:167438725-167438747 CCCTCTGCCTCCCTCTTCTAAGG + Intergenic
1019127664 6:169851757-169851779 TCTGACGCCTCCCTCTTACAGGG + Intergenic
1019168867 6:170117422-170117444 CCTCCTGCCTCCCTCGGTCTGGG + Intergenic
1019737900 7:2659570-2659592 CCTCCTGCCTGTGTCTTACGCGG - Intronic
1020260390 7:6527517-6527539 CCCCCTGCCTCTCACTTCCAAGG - Intronic
1020801836 7:12741651-12741673 CCTCCCACCTCCCTTTTATAAGG - Intergenic
1020807534 7:12808797-12808819 CCTCCTGCCTCCAGCTCCCAAGG + Intergenic
1021001504 7:15337356-15337378 CCTACTGTCTCCCTCTTTCTCGG - Intronic
1021118563 7:16771504-16771526 CCTCTTTCCTCCCTCTTCCAAGG - Intronic
1021367940 7:19804840-19804862 CCTCCTGCCTCAGCCTTCCAAGG + Intergenic
1021470933 7:21001882-21001904 TATCCTGCCTCTCTCTTAAAAGG - Intergenic
1021682602 7:23149432-23149454 CCTCCTACCTTTCTCTTACTGGG + Intronic
1021738593 7:23662984-23663006 CTCTCTGCCTCCCTCTTATAAGG + Intergenic
1021863533 7:24931441-24931463 TCTCCTGACGCCCTCTTATAAGG - Intronic
1023030647 7:36087902-36087924 TCCTCTGCCTCCCTCTTACAAGG - Intergenic
1023047664 7:36224936-36224958 CCTTCTTCCTGTCTCTTACAAGG - Intronic
1023123966 7:36936564-36936586 CCTCCTGCCTCAGTCTTCCAAGG + Intronic
1023331093 7:39117782-39117804 TCTCCTGCTTCTCTCTTAGAAGG + Intronic
1023381499 7:39612791-39612813 TGTCCTGCCTCCCTCATAGAAGG - Intergenic
1023391482 7:39715331-39715353 TCTCCTGCCTCCATCTTAGAAGG - Intergenic
1023617055 7:42030222-42030244 TCTCCTGCTTCCCTCTCACAGGG + Intronic
1023725344 7:43137406-43137428 CTTCCTGCCTCTCTCTAAAATGG + Intronic
1023754215 7:43400988-43401010 CTTCCTGCCTCCATCTGACAAGG + Intronic
1024052049 7:45630698-45630720 CCTCCTGCCTCATTTTTATAAGG + Intronic
1024271959 7:47649398-47649420 CCTCCTGCCTCCCTGTAGCTAGG - Intergenic
1024496670 7:50056400-50056422 CCTCTTGCCTTCCTCTTAGAAGG + Intronic
1024595033 7:50925421-50925443 CCTCCTGCCTGCTTCTTTCCTGG + Intergenic
1025003911 7:55340870-55340892 CCTTCCGGCTCCCTCTTATAAGG + Intergenic
1025192634 7:56907716-56907738 CCTCCTGCCCTTCTCTTACAAGG + Intergenic
1025679311 7:63669204-63669226 CCTCCTGCCCTTCTCTTACAAGG - Intergenic
1026361896 7:69609446-69609468 CCTCCCACCTCCCTTTTATAAGG + Intronic
1026418337 7:70206573-70206595 CTTCCTGCCACCCACCTACAAGG + Intronic
1026442092 7:70453752-70453774 CCGCCTGCCTCTCTCCTATAAGG + Intronic
1026539253 7:71266137-71266159 CCTCCTGTATACCTCTTATAAGG + Intronic
1026644492 7:72155943-72155965 TCTCCTGCCTCACTCTTATAAGG + Intronic
1026654945 7:72248572-72248594 CCTCCAGCCTCCCTCTTATAAGG + Intronic
1026766665 7:73164442-73164464 CCTCCTGCCTCCTGCTTCTAGGG + Intergenic
1026793854 7:73353186-73353208 CCTCCTGCCTCCCTTTTACGAGG + Intronic
1027043143 7:74974141-74974163 CCTCCTGCCTCCTGCTTCTAGGG + Intronic
1027080504 7:75228218-75228240 CCTCCTGCCTCCTGCTTCTAGGG - Intergenic
1027499402 7:78929660-78929682 CCTTCTGGGTCCCTCTTATAAGG + Intronic
1027550010 7:79579241-79579263 CCTCTTACCTCCCTCTAATAAGG - Intergenic
1028086556 7:86644290-86644312 CCCCCACCCTCCCTCTTATAAGG - Exonic
1029572735 7:101381329-101381351 CTTCCTGCCTCTCTCTTGTATGG + Intronic
1029574464 7:101394137-101394159 CCTCTTGCTACCCTCTTACAAGG - Intronic
1029670234 7:102025116-102025138 CCTCCTGCCTGTCTCTTACTAGG + Intronic
1030164179 7:106536346-106536368 CTTCTTGCATCCCTCTTACGTGG - Intergenic
1030174129 7:106632798-106632820 TCTCCGGCCTCCCTCTTATCAGG + Intergenic
1030318162 7:108137498-108137520 TCTCCTGCCTTCCTTTTACAGGG + Intergenic
1030386399 7:108872528-108872550 CTTCTTGCCTCCCTCTTTTAGGG + Intergenic
1030934510 7:115568548-115568570 TCTGCTGCCTCTGTCTTACAAGG + Intergenic
1031144854 7:117986400-117986422 CTCCCTGCCTTCCTCTTACAAGG + Intergenic
1031181769 7:118427968-118427990 GCTCCTGCCTCCCTTTTACGTGG + Intergenic
1031399099 7:121310019-121310041 CCTTGTGCCTCCCTCTTGTAAGG - Intergenic
1031402797 7:121345601-121345623 TGTCCTGCCTCCTTCTTACCTGG - Intergenic
1031587240 7:123546977-123546999 CCCTCTGCCTCTCTCTTATAAGG - Intronic
1031627412 7:124006256-124006278 CCTCCTTCCCCCCTACTACATGG - Intergenic
1031887254 7:127254713-127254735 CCTCCTCCCTCCCTCTTTTGTGG - Intergenic
1031910405 7:127511110-127511132 CCTCCTGCCTTCCTCTTAGAAGG - Intergenic
1032121195 7:129158144-129158166 CCTCTTGCCTCCTTCTTAGAAGG + Intronic
1032792782 7:135254639-135254661 CCTCCTGCCTGCCTGGGACAAGG - Intronic
1033209062 7:139446819-139446841 CTGCCTGCCTCCCTCTTATAAGG + Intergenic
1033247257 7:139728184-139728206 CCTCCTGCCTCACACTCTCAAGG + Intronic
1033414249 7:141148218-141148240 CTTCTTGCCTCTCTTTTACAAGG + Intronic
1033460314 7:141541605-141541627 CCTCCTGCCTCCTTCTCCCTGGG + Intergenic
1034401252 7:150863044-150863066 TCTCCTGTCTCCCGCTCACAAGG - Intergenic
1034441915 7:151090016-151090038 TCTCCTGCATCCCTCTTTCTAGG - Intronic
1034448133 7:151123695-151123717 CCTCCTGCCTCCCTCCTCCTGGG - Intronic
1034686512 7:152976068-152976090 CTCTCTGCCTCCCTCTTAAAAGG - Intergenic
1035148510 7:156844792-156844814 CATGCTGCCTCCTTCTTCCAGGG - Intronic
1035468305 7:159093900-159093922 CCTCGTGACTCCCTCTTTCAGGG + Intronic
1035903387 8:3481662-3481684 CCCTCTGCCTCTCTCTTATATGG - Intronic
1036123110 8:6039221-6039243 CCTCCTGCCTCTGTCTGATAAGG + Intergenic
1036428329 8:8666910-8666932 CTTCCTGCCTCCCGGTTTCAAGG + Intergenic
1037034944 8:14154736-14154758 CCTCCTCTCTCCCTCTTTGAAGG + Intronic
1037505366 8:19524179-19524201 CCTCCTGCCTCATCCTTCCAAGG - Intronic
1037545749 8:19920137-19920159 CCTCCTGCCTCAGCCTTCCAAGG + Intronic
1037829188 8:22178025-22178047 CCTCCTGCCTCCCACTTCTGGGG + Intronic
1037928695 8:22865013-22865035 CCGCCTGCCTCCCTCTCTCACGG - Intronic
1037931275 8:22881740-22881762 GCTACTGCCTCCCTCTGTCATGG - Intronic
1038173340 8:25159021-25159043 GTTCCTGCCTCCCTCTTGTAAGG - Intergenic
1038410540 8:27355247-27355269 CTTCCTGCCTCTCTCTTAAAAGG - Intronic
1038701827 8:29856109-29856131 CCCTCTGCCTCACTCTTATAAGG - Intergenic
1039372626 8:37002105-37002127 CCTCTTGCCTCCCTCTTACAGGG + Intergenic
1039840577 8:41290307-41290329 TCTCCTGCCTCCCTCTTTCAGGG + Intronic
1040110273 8:43564128-43564150 CGTCCTGTCTCCTTCATACAGGG + Intergenic
1040636112 8:49274857-49274879 CCGCCTGCCTCCATCTTAGCCGG + Intergenic
1040982938 8:53264075-53264097 ACTCTTGCCTGCCTTTTACAAGG - Intergenic
1041692806 8:60705206-60705228 CCTCCTGCCTCCTTGTTTCCAGG - Intronic
1041734042 8:61091142-61091164 CCTCCTGCATCCCTCCTGTAAGG - Intronic
1042216724 8:66435518-66435540 CCCTCTGCCTCCCTTTTATAAGG + Intronic
1042350231 8:67769509-67769531 CCTCCTGCATCCCTCTTACAAGG - Intergenic
1042824630 8:72967642-72967664 CCTCCTGCCTCCTTGCTAGATGG + Intergenic
1043186510 8:77158426-77158448 CCCTCTGTCTCTCTCTTACAAGG - Intergenic
1043564270 8:81530769-81530791 CCCTCTTCCTCCCTCTTAAAAGG - Intronic
1043776838 8:84279781-84279803 CTTCTTGCCTCCCTCTTACAGGG + Intronic
1044966133 8:97575672-97575694 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1044997861 8:97854339-97854361 CCTCCTGTCTCCTTCTTCCAAGG - Intergenic
1045323821 8:101101956-101101978 CCTCATACCTCCCTCTTATAGGG + Intergenic
1045346407 8:101297721-101297743 TCTCCTGCCTCCCTATTACACGG - Intergenic
1045461922 8:102432752-102432774 CCTCCTGCCTCAGCCTTCCAGGG + Intergenic
1045478507 8:102574293-102574315 CCTTCTGCCTCCCTCTTCTAAGG - Intergenic
1045677699 8:104626560-104626582 CCCCCTGCTTCTCTCTTAGAAGG + Intronic
1046201776 8:110936660-110936682 TGTCCTGCCTCCTTCTTATAAGG - Intergenic
1046222824 8:111237730-111237752 CCCTCTCCCTCCCTCTTATAGGG + Intergenic
1046245234 8:111551190-111551212 CCTCCTGCCTCCCGATTAGCTGG + Intergenic
1046248579 8:111600195-111600217 TCTACTGCCTCCCTCTTACAAGG + Intergenic
1046414772 8:113898585-113898607 CCTCCTCCCTCCCTCATATAAGG + Intergenic
1046610937 8:116424891-116424913 TCTCCCACCTCCCTCTTATAAGG + Intergenic
1046680085 8:117158988-117159010 TCTCCTGTCTCCCTCTTATAAGG - Intronic
1046692227 8:117298815-117298837 TCTTCTGCCTCCTTCTTAGAAGG - Intergenic
1046807347 8:118494088-118494110 GCTCCTGTCTCCTTCTTATAAGG - Intronic
1046821998 8:118643986-118644008 CCTCCTGCATCCCTTTCATAAGG + Intergenic
1046886674 8:119375181-119375203 CCTCCTGCCTCCTTCTTATTAGG - Intergenic
1047002441 8:120586540-120586562 CCTCCTGCCTCCCTCTTATAAGG + Intronic
1047063476 8:121253581-121253603 CCTTCTTCCTCCCTCTTCTAAGG + Intergenic
1047222873 8:122932640-122932662 CCTCCTGTCTCCCTCTCATAAGG + Intronic
1047237874 8:123058283-123058305 CCTTCTTCCTCCCCCTCACAAGG + Intronic
1047319422 8:123765710-123765732 CCCCCTGCCTCCCTCTAATAAGG + Intergenic
1047366711 8:124217802-124217824 CCTCTTGCCTCCCTCCCACGGGG - Intergenic
1047509201 8:125503442-125503464 TCTCCTGCCTCGCTCTTATAAGG - Intergenic
1047655251 8:126970352-126970374 CCTCCTGCCTCCATCTTTTAAGG + Intergenic
1047700919 8:127448535-127448557 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1047771785 8:128035744-128035766 CCCTCTGCCTCCCTCTAATAAGG - Intergenic
1048292858 8:133193807-133193829 CCTCCTGCCTCCCTGGTCCAAGG + Intronic
1048303945 8:133270584-133270606 CCTCCTGCCTGCATCCTACTTGG + Intronic
1048322433 8:133410586-133410608 CCTCCTGCCTCCCTCTCCTAAGG - Intergenic
1048356229 8:133656230-133656252 CCTCCTGCTTCCTTCTTATAAGG + Intergenic
1048404375 8:134104912-134104934 CCTCCTTCCTCCCTCTTTTAAGG - Intergenic
1048455584 8:134575326-134575348 CCTCCTGCCTTCCTTTTATAAGG - Intronic
1048562697 8:135559019-135559041 TCTTCTGCCTCCCTTTTACAAGG + Intronic
1048601743 8:135925699-135925721 AATCCTGTCTCCTTCTTACATGG + Intergenic
1048663861 8:136638556-136638578 CTACCTGCCTCGCTCTTATAAGG - Intergenic
1048773240 8:137918482-137918504 CCTCCTGCCTCTGTCTTCGAAGG - Intergenic
1048917818 8:139201420-139201442 CCTTCTGCCTCTCTCTTATAAGG + Intergenic
1049170814 8:141159568-141159590 CCTACTTCCTCCCACTCACATGG + Intronic
1049246100 8:141563391-141563413 GCTCCTGCGTCTCTCATACACGG - Intergenic
1049254707 8:141607652-141607674 CCTCCTTCCTCCTTCTCACTGGG + Intergenic
1049297827 8:141852525-141852547 CCTCCTGTCTCCTGCTTCCACGG - Intergenic
1049358524 8:142200647-142200669 CCACCTGCCTTCCTCTTAAAAGG - Intergenic
1049543545 8:143219187-143219209 CCCTCGGCCTCCTTCTTACAGGG + Intergenic
1049629122 8:143642681-143642703 CCTCCAGCCTCCCCCTTCCCTGG - Intronic
1049732014 8:144183270-144183292 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
1049982451 9:916819-916841 CTACCCGCCTCCCTCTTACCTGG + Exonic
1050186839 9:2983591-2983613 CCTCCTGCCTCCCTCTTACAAGG - Intergenic
1050588512 9:7138708-7138730 CCTCCTGCCTCAGTCTCCCAAGG - Intergenic
1050646358 9:7723789-7723811 CCTCCTGCCCCACTCTTATAAGG - Intergenic
1050690874 9:8224812-8224834 CCTCCTGCCTCCCAATTAAGGGG + Intergenic
1051112592 9:13656267-13656289 CCACCTGCCTCCCTTCGACATGG - Intergenic
1051301724 9:15658622-15658644 CCTCCTGCCTCCCTGTTATAAGG - Intronic
1051589167 9:18758635-18758657 CCTCCTGCCTCCCTCTTCTAAGG + Intronic
1051734965 9:20188631-20188653 CCTTCTGCCTCCCTCTTGTAAGG - Intergenic
1052013761 9:23441933-23441955 CCTTCTGCCTCTCTCTCATATGG - Intergenic
1052171929 9:25410116-25410138 TCTCCTTCCACCCTCTTACAAGG + Intergenic
1052183109 9:25555430-25555452 CCCCCTACCTCCCTCTTATAAGG + Intergenic
1052293179 9:26867345-26867367 CCTCCTGTTTCCCTCATATAAGG + Intronic
1052312201 9:27079699-27079721 CCCCTTGTCTCCCTCTTATAAGG - Intergenic
1052684967 9:31744080-31744102 CCTCCTTCCTCTCTCTTATAAGG + Intergenic
1053446599 9:38157959-38157981 CCCTCTGCCTCCCTCTTATAAGG + Intergenic
1053463893 9:38290951-38290973 ACTCCTGCCTCCCTTTTATAAGG - Intergenic
1053804106 9:41784072-41784094 CCTCCTGCCTCCCTCTTAAAAGG - Intergenic
1054141176 9:61531387-61531409 CCTCCTGCCTCCCTCTTAAAAGG + Intergenic
1054192412 9:61995568-61995590 CCTCCTGCCTCCCTCTTAAAAGG - Intergenic
1054406562 9:64768035-64768057 CTTCCTCCCTCCCTATTATAAGG - Intergenic
1054440192 9:65253508-65253530 CTTCCTCCCTCCCTATTATAAGG - Intergenic
1054460866 9:65461823-65461845 CCTCCTGCCTCCCTCTTAAAAGG + Intergenic
1054490213 9:65768431-65768453 CTTCCTCCCTCCCTATTATAAGG + Intergenic
1054645994 9:67593123-67593145 CCTCCTGCCTCCCTCTTAAAAGG + Intergenic
1055199445 9:73641572-73641594 CCTCCTGTCTTCCTTTTATAAGG + Intergenic
1055245696 9:74239898-74239920 CCTCCTGGCTCCCTCTTATAAGG - Intergenic
1055445690 9:76380051-76380073 CCTCCTGCCTCAGTCTCCCAAGG - Intergenic
1055827925 9:80349041-80349063 CCTTCTGCCTCCCTTTTATAAGG - Intergenic
1056220705 9:84448285-84448307 CCTCCTGCCTCCCTCTGGTAAGG - Intergenic
1056227147 9:84506663-84506685 CCTCCTGCCTCCTTCTTGAATGG - Intergenic
1056390936 9:86140938-86140960 CCTCTTGCCTCCCTTTAATAGGG + Intergenic
1056508576 9:87281121-87281143 CTCCCTGCCTCCCTCTTATAAGG - Intergenic
1056746220 9:89306170-89306192 CCTCCTGTCTCCCTCCTCTAAGG + Intergenic
1056948886 9:91026073-91026095 CCTCCTGCTTCCCTGACACAGGG + Intergenic
1057139591 9:92718452-92718474 CCTCCTTCCTCCCCCTGCCACGG - Intronic
1057200282 9:93136061-93136083 CCTCCCGGCTTCCTCTTAGAAGG - Intergenic
1057415581 9:94859400-94859422 CCCTTTGCCTGCCTCTTACAAGG + Intronic
1057472446 9:95369568-95369590 TCTCCTGCCTCCCTCCTCTAAGG + Intergenic
1057954306 9:99395683-99395705 CCTCCTGCCTTGCTCTTGAAAGG - Intergenic
1058047666 9:100373922-100373944 TCTCCTGCCTCCCACTGGCAGGG + Intergenic
1058136006 9:101308235-101308257 CCTCCTGCCTGTCTCTTATAAGG - Intronic
1058154532 9:101500420-101500442 TCTCCTGCCTCCTTCTTACAAGG + Intronic
1058348327 9:103991213-103991235 TCTCTTGCCTCTCTCTTACAAGG + Intergenic
1058671057 9:107360684-107360706 ACTCCTGTCTCTCTCTTACAAGG + Intergenic
1058766360 9:108186256-108186278 GCTTCTGCCTCCCTCTTCTAAGG + Intergenic
1058886179 9:109322754-109322776 CCTCCCGCTTCCCTCTTATAAGG - Intergenic
1059014113 9:110495394-110495416 CCTCCTGCCTTCCCCTTATAAGG - Intronic
1059075982 9:111194515-111194537 CCTTCTGCCTCACTTTTATAAGG + Intergenic
1059409199 9:114121607-114121629 CATCCTGCCTCCCTCAGTCAGGG - Intergenic
1059986061 9:119821798-119821820 CTTTCTGCCTCCCCCTTATAAGG - Intergenic
1060009410 9:120030387-120030409 CTTCTTGGCTCCCTTTTACAAGG + Intergenic
1060280428 9:122212452-122212474 CCTTCTTTTTCCCTCTTACATGG + Intronic
1060524535 9:124313060-124313082 CCTTCTGCGTCCCTCCTAAATGG + Intronic
1060541398 9:124432963-124432985 CCCTCTGCCTCCCTCTTATAAGG - Intergenic
1060571285 9:124642808-124642830 CCTGCTACCTCCCTCTCTCATGG - Intronic
1061162158 9:128901796-128901818 CCACCTGCCTGCCCCCTACAGGG - Intronic
1061278025 9:129580774-129580796 CTTCCTGCCTCTCTGTTACAAGG + Intergenic
1061384392 9:130279912-130279934 CTTCCTGCCTCCCTCTTATGAGG - Intergenic
1061755750 9:132811325-132811347 CCTCTTACCTCCTTCTTATAAGG - Intronic
1061927914 9:133815186-133815208 CCGCCCGCCTCCCTCTTCCCTGG + Intronic
1062036097 9:134383255-134383277 CATCCTGCCTCACCCTGACATGG - Intronic
1062038164 9:134391884-134391906 CCTCCTGCCCCCGTCCTGCAGGG - Intronic
1062067263 9:134535465-134535487 CCCCCTGCCTCCCTGTTGTAAGG + Intergenic
1062073457 9:134571809-134571831 CCTCCTGTCTCTCTCCTACGGGG + Intergenic
1062082551 9:134631965-134631987 TCCTCTGCCTCCATCTTACAAGG - Intergenic
1062144903 9:134983538-134983560 CCTCCTGCCTCCCTCTCATAAGG - Intergenic
1062171428 9:135137039-135137061 CCTCCTAACTCCCTTTTATAAGG - Intergenic
1062278432 9:135741399-135741421 GCTCCTGCCAGCCTCTGACACGG + Intronic
1062481390 9:136754107-136754129 CCTCCTGCCTGCATCCTCCATGG - Intergenic
1062744168 9:138201058-138201080 CTTGCTGCCTCCCTCTCATAAGG + Intergenic
1185596771 X:1311930-1311952 TCTCCTGCCTCCCTCTCATAAGG + Intergenic
1185650916 X:1647614-1647636 CCTCTTGCCTCCCTCTCATAAGG + Intergenic
1185787447 X:2902722-2902744 ACTCCTACCTCCCTCTTATAAGG - Intergenic
1185837634 X:3360211-3360233 CCTCCTCCTTCCCTCTTCTACGG + Intergenic
1185882106 X:3750694-3750716 CCTCCTACTTCCCTCTTATAAGG - Intergenic
1185882590 X:3754740-3754762 CCTCCTGCCTCCCTCTTAGAAGG - Intergenic
1185894592 X:3846268-3846290 CCTCCTGCCTCGGTCTCCCAAGG + Intergenic
1185899710 X:3884692-3884714 CCTCCTGCCTCGGTCTCCCAAGG + Intergenic
1185904826 X:3923121-3923143 CCTCCTGCCTCGGTCTCCCAAGG + Intergenic
1186055067 X:5641591-5641613 CCTCCTGCCTTCAGCTTAGAAGG + Intergenic
1186067392 X:5780550-5780572 CTTCCTGCCTCCCTCTTATAAGG - Intergenic
1186103642 X:6182675-6182697 CCTCCTGCCTCCCTCTTGTAAGG - Intronic
1186145249 X:6618161-6618183 CCTCTTGCCTCTTTCTTATAAGG - Intergenic
1186197090 X:7120308-7120330 CCTCCTGGCCGCCTCTTATAAGG - Intronic
1186216393 X:7305791-7305813 ACCCCTGCCTCCCTCTTATGAGG + Intronic
1186365794 X:8891989-8892011 TTTCCTGCCTCTCTCTTATAGGG - Intergenic
1186428542 X:9484836-9484858 CCTCCTGCCTCAGCCTTCCAAGG - Intronic
1186497420 X:10022710-10022732 CCTCCTCCCTCCCTCTAGTAAGG - Intronic
1186526076 X:10249518-10249540 CCTCCTGCCTCTTTCTTCTAAGG - Intergenic
1186659645 X:11656707-11656729 CTTCCTGCCTCCCTCTTATAAGG + Intronic
1186698882 X:12068022-12068044 CCTACTGACTCCCTCTTATAAGG - Intergenic
1186880158 X:13857097-13857119 TCTCCTGCCTCCTTCTTATAAGG + Intronic
1186890947 X:13958684-13958706 CTTCCTGCCTTCCTCTCATAAGG + Intergenic
1186894881 X:13995736-13995758 CCACCTCCCTCCCTCTTATAAGG + Intergenic
1186997426 X:15138887-15138909 CTTCCTGCCTTCCTATTATAAGG + Intergenic
1187529231 X:20081538-20081560 CCTCCAACCTCACTGTTACAGGG + Intronic
1187561640 X:20408902-20408924 TCTCCTGCCTCTTTCTTATAAGG + Intergenic
1189383263 X:40516933-40516955 TCTCCTACCTTCCTCTTAAAAGG - Intergenic
1189532675 X:41902464-41902486 CCTCCTGCCTTCCTCTTATAAGG + Intronic
1189561200 X:42193030-42193052 CGTCCTCCCTCTCTCTTATATGG - Intergenic
1189900538 X:45701640-45701662 TCTCCTGCTTCCCTCTTGTAAGG - Intergenic
1189947542 X:46194557-46194579 CTTCCTATCTCCCTCTTAGAGGG - Intergenic
1190463520 X:50703109-50703131 CATCCTCCCTACCTCTTAGAAGG + Intronic
1190577876 X:51859724-51859746 CCTCCTGCCTCTCTCTTATAAGG - Intronic
1190858847 X:54324184-54324206 CATTCTGCCTCCCTCTTATAAGG + Intronic
1190891138 X:54568920-54568942 CTTCCTGCCTCTCACTTAAAAGG + Intergenic
1191029478 X:55952556-55952578 ACTCTTGCCTTCCTCTTACAAGG + Intergenic
1191631760 X:63329835-63329857 CCACATGCCTCCCTCTTATAAGG - Intergenic
1191755537 X:64588524-64588546 CCTCCTGCCTTCTTTTTATAAGG + Intergenic
1191801935 X:65091165-65091187 CCTTCTGTCTCCCTCTTATAAGG - Intergenic
1193012500 X:76692593-76692615 CCTCCTTCCAACCTCTTAAATGG + Intergenic
1195272463 X:103245400-103245422 CCCTCTGCCTCTCTCTTATAAGG + Intergenic
1195509097 X:105693715-105693737 CCTTCTGCCTCTCTCTTATAAGG - Intronic
1195664558 X:107416982-107417004 CCCTCTGCATCCCTCTTATAAGG - Intergenic
1195668053 X:107448579-107448601 CCTCCTGCTTCTCTCTTCCCTGG + Intergenic
1196352568 X:114749203-114749225 CCTCCTGCCTCCGCATTCCAAGG - Intronic
1196531788 X:116796431-116796453 CCTCCTGCCTCAGTCTCCCAGGG + Intergenic
1196770768 X:119291147-119291169 CCTCCTGCCTCCCTCTTACAGGG - Intergenic
1196987968 X:121295590-121295612 TCTCCTGCCTCCCTCTTATAAGG - Intergenic
1196998656 X:121413462-121413484 TCACCTCCCTCCCTCATACATGG - Intergenic
1197234258 X:124041286-124041308 CATGCTGCCTCCCTCTTATCTGG - Intronic
1197985602 X:132263640-132263662 CCTTCTGCCTCCCTTTTATAAGG - Intergenic
1198279992 X:135132371-135132393 CCTCCTGCCTCCCTCTTGCAAGG + Intergenic
1198290965 X:135240143-135240165 CCTCCTGCCTCCCTCTTGCAAGG - Intergenic
1198506981 X:137310664-137310686 CCCCCTGCCTCTCTCTTACAAGG - Intergenic
1198687657 X:139244618-139244640 CCTCCTGACTCCCTCTTATGAGG - Intergenic
1199177043 X:144801418-144801440 CTTCTTTCCTCCCTCTTATAAGG + Intergenic
1199228941 X:145412223-145412245 CCTCCTGCCTTCACCTTATAAGG + Intergenic
1199293887 X:146135719-146135741 CTTCCTTCCTCTCTCTCACAAGG - Intergenic
1199524344 X:148775772-148775794 CCCTCTGCCTCTCTCTTATAAGG + Intronic
1199681637 X:150228714-150228736 CCTTCTGCCTTCCTCTTATAAGG + Intergenic
1199691894 X:150314777-150314799 CCCTCTGCCTCTCTCTTAGAAGG + Intergenic
1199765406 X:150937647-150937669 CTTCCTGCCTCCCTCTTATAAGG + Intergenic
1200314891 X:155122016-155122038 CCTCCTGCCTCCCTAGTAGCTGG - Exonic
1200782403 Y:7228574-7228596 CCTCCTGCCTCCCTCTTAGAAGG + Intergenic
1200782868 Y:7232512-7232534 CCTCCTACTTCCCTCTTATAAGG + Intergenic
1201238191 Y:11931524-11931546 CCTCCTCCTTCCCTCTTCTACGG - Intergenic
1201407734 Y:13665350-13665372 CCTCCTGCCTCTCTTCTCCAAGG - Intergenic
1201586596 Y:15567959-15567981 ACACCCGCCTCCCTCTTATAAGG + Intergenic
1201625063 Y:16005829-16005851 CCTACTGCCTTCCTCTTATAAGG - Intergenic
1202080435 Y:21078617-21078639 CTTCCTGAGTCCCACTTACATGG + Intergenic