ID: 1142000428

View in Genome Browser
Species Human (GRCh38)
Location 16:87661213-87661235
Sequence CCCTCTTACAAGGACCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 9, 2: 11, 3: 36, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000418_1142000428 18 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000420_1142000428 1 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000419_1142000428 6 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000422_1142000428 -9 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000417_1142000428 27 Left 1142000417 16:87661163-87661185 CCTTCAGAGCCAGCGGGGCAGCC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000416_1142000428 30 Left 1142000416 16:87661160-87661182 CCACCTTCAGAGCCAGCGGGGCA 0: 1
1: 0
2: 3
3: 24
4: 224
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172
1142000421_1142000428 -4 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG 0: 1
1: 9
2: 11
3: 36
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000428 Original CRISPR CCCTCTTACAAGGACCCTTG TGG Intronic
901125045 1:6923420-6923442 CCCTCTAAACAGGAACCTTGAGG - Intronic
901945659 1:12701619-12701641 CCTTCTTAGAAGGACCTTTATGG - Intergenic
902723370 1:18319294-18319316 CCCTCCTATAAGAACCCTTTAGG + Intronic
904982819 1:34521291-34521313 TCCTCTTATAAGGACGCTTGTGG + Intergenic
905676178 1:39826847-39826869 CCCTGGAACAAGGAGCCTTGGGG + Intergenic
906580066 1:46928910-46928932 CCCTCTTATAAGGACCCTTGTGG - Intergenic
906603657 1:47149976-47149998 CCCTCTTATAAGGACCCTTGTGG + Intergenic
906770812 1:48480659-48480681 TCCACTTTTAAGGACCCTTGTGG + Intergenic
907893087 1:58654572-58654594 CCCACTTACAAGGCTTCTTGTGG + Intergenic
909594516 1:77391049-77391071 CCCTCTGACAAGGTCTGTTGAGG + Intronic
911236228 1:95415315-95415337 CCCTGTTATAATGAGCCTTGTGG + Intergenic
912700426 1:111874267-111874289 CCCTCTTGCATGGACCGCTGAGG + Intronic
914410535 1:147423200-147423222 CCCTTTTAAAAGAAACCTTGGGG + Intergenic
914991977 1:152506720-152506742 CCCTCTTGTAAGGACCTTTGTGG + Intergenic
915674381 1:157516916-157516938 CACTCTTACAAGCCCCTTTGAGG - Intronic
916232827 1:162557127-162557149 CCCTTTTATAAGCAGCCTTGGGG - Intergenic
916757104 1:167782745-167782767 CCCTCTTCTAAGGACCTTTATGG - Intronic
918080973 1:181207402-181207424 CCCTCTGACAAGGACCTCTGAGG + Intergenic
920645286 1:207798837-207798859 CCCTCTTAGAAGGACCCTTGTGG - Intergenic
920968860 1:210725290-210725312 CCATCTTACAAGGAGCTTTAAGG + Intronic
923144632 1:231189445-231189467 CCCTCTTACAAGAACCTTTCTGG - Intronic
924290802 1:242534496-242534518 CCCTCCAACCAGGACCCTTGGGG + Intergenic
924440538 1:244082098-244082120 CCTTCTTTCAAGGACCCCAGAGG + Intergenic
1070090905 10:73284317-73284339 CTCTCATATAAGGACCCTTGTGG + Intronic
1070629438 10:78074465-78074487 CCTTCTTATAAGGACCTTTGTGG - Intergenic
1071526003 10:86358819-86358841 CCCTCTTTCAAGGACCTTTGTGG - Intronic
1072446289 10:95501481-95501503 CCCTCACACAAGGCCCCTTAAGG + Intronic
1075067137 10:119296732-119296754 CCCTCATAGAACAACCCTTGAGG + Intronic
1075923437 10:126232206-126232228 GTCTCTTATAAGGACCTTTGTGG - Intronic
1077552925 11:3209808-3209830 CCCTCTTACAAGGACGCTTGAGG + Intergenic
1078991155 11:16647894-16647916 ATATCTTACAGGGACCCTTGGGG + Intronic
1080639291 11:34149438-34149460 CCCTCTTACTGGAGCCCTTGAGG - Intergenic
1080792829 11:35536813-35536835 CCCTCTTTCAAGGACTTCTGGGG - Intergenic
1083173032 11:60934213-60934235 CTCTCTTACGGGGACCCTGGGGG - Intronic
1084673160 11:70619459-70619481 CCCCCTTATAAGGACGCCTGTGG + Intronic
1084688704 11:70712251-70712273 CCCACATTTAAGGACCCTTGGGG + Intronic
1088175592 11:107049785-107049807 CACTCTTACGAGGACACATGGGG + Intergenic
1088717064 11:112558140-112558162 CTCTTTTACAAGGACACTTGTGG - Intergenic
1088980636 11:114859941-114859963 CACTCTTATGAGAACCCTTGTGG - Intergenic
1090375659 11:126286995-126287017 CCCTCTTGAAAGGATCTTTGTGG + Intronic
1091983927 12:4892163-4892185 CCCTCTTAAGTGGACCCTTCTGG - Intergenic
1092621892 12:10281127-10281149 CCCTTTTATAAGGATACTTGGGG - Intergenic
1098828226 12:75326850-75326872 CCCTCTTACAAGGATTCTGGTGG - Intronic
1099827187 12:87791874-87791896 CACAATTACAAGGACTCTTGGGG - Intergenic
1099927955 12:89040928-89040950 CCTTCTTACGAGTACACTTGTGG - Intergenic
1101325275 12:103710043-103710065 CCCTCTCACCAGTAGCCTTGTGG + Intronic
1101326415 12:103719633-103719655 TCCTCTTGCAAGGACATTTGTGG + Intronic
1102560131 12:113755986-113756008 CCCTCTTATAAAGATCCCTGTGG - Intergenic
1102591946 12:113962945-113962967 CCCTCTCATAAGGACCCTTGAGG - Intronic
1102620930 12:114193865-114193887 GCCCCTTACAAGGGCCCTTGTGG - Intergenic
1103021082 12:117534772-117534794 TCCTCTTCTGAGGACCCTTGTGG - Intronic
1103334923 12:120182214-120182236 CCTTCTTACAAGGAGGCTTTTGG + Intronic
1104006489 12:124896383-124896405 CCCTCTCATAAGGACCCTTGTGG + Intergenic
1105031687 12:132888297-132888319 CCCTCTTAAAACCGCCCTTGGGG - Intronic
1105790132 13:23790549-23790571 TTCTTTTATAAGGACCCTTGTGG - Intronic
1107126908 13:36856143-36856165 GCCTCTTACAACAACCCCTGTGG + Intronic
1108128316 13:47269228-47269250 CTCTCTTCTAAAGACCCTTGAGG + Intergenic
1108557383 13:51607916-51607938 CCCTCTTACAAAGACCTTTGTGG - Intronic
1110817393 13:79877033-79877055 CCCTCTTAGAAAGACCCATTTGG + Intergenic
1112443024 13:99438743-99438765 CCCTCTTCCAAGGGCTCTAGGGG + Intergenic
1112895318 13:104292477-104292499 CCCTCTCACAAGGAACTTTGTGG + Intergenic
1118481447 14:66171213-66171235 CCCTCTTGTGAGAACCCTTGTGG + Intergenic
1121794867 14:96726403-96726425 CCTTCTTAGAAGGACCCTCATGG - Intergenic
1125597298 15:40895072-40895094 CCCTCTCAAAAGGACCCTAGCGG - Intronic
1125788558 15:42344416-42344438 ATCTCTTATAAGGACACTTGTGG + Intronic
1126349376 15:47728864-47728886 CCATCTTCAAAGGACCCTTGTGG + Intronic
1126594871 15:50375228-50375250 CCCTCTTACTAGCCTCCTTGAGG + Intergenic
1128674477 15:69598524-69598546 CCCTCTTATAAGGACTGTTGTGG + Intergenic
1129662005 15:77558141-77558163 CCATCCTTCAAGGACCCTTCTGG - Intergenic
1130421129 15:83748161-83748183 GCCTCTTACAAGGAGCCTGTGGG + Intronic
1130814187 15:87413699-87413721 CCCTCTCACAAAGTCCCTTTAGG + Intergenic
1131250670 15:90828130-90828152 CCCTCTGACCGGGACCCTGGAGG - Intergenic
1134457156 16:14403198-14403220 GCCTCTTATAAGGACCACTGTGG + Intergenic
1135147718 16:19977454-19977476 CATTCTGACAAGGACCCATGTGG - Intergenic
1135912486 16:26574081-26574103 CCTACTTACAAGGACTTTTGTGG - Intergenic
1136518595 16:30782459-30782481 CCCTCTGAAAGGGAGCCTTGGGG + Exonic
1137980063 16:53061898-53061920 CCATCTCACAAGACCCCTTGTGG - Intronic
1141248937 16:82337387-82337409 CCATTTTACAAAGACACTTGTGG - Intergenic
1141268650 16:82519645-82519667 CCTCCTTACAAGGACCCTTGTGG - Intergenic
1141362101 16:83405397-83405419 GCCTCTTATAAGGACCCTTGTGG - Intronic
1141369119 16:83471097-83471119 CTCTCTTACAAGGACCTTGTTGG + Intronic
1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG + Intronic
1142160390 16:88554567-88554589 GCCTCTTACGAGGACCTTTGTGG + Intergenic
1142617285 17:1143678-1143700 CCCTCTTCCAAGGATCTTGGAGG - Intronic
1143366358 17:6411162-6411184 CCGTCTTATAAGGAGCCTTGTGG - Intronic
1143960352 17:10712306-10712328 TCGTCTTGCAAGGACACTTGTGG + Intronic
1147392434 17:40118544-40118566 CCATCTTACCAGGACCACTGTGG + Intergenic
1147605088 17:41769822-41769844 ACCTCTCACCAGGAACCTTGGGG + Intronic
1148666138 17:49376432-49376454 CCCTCTTCTAAGGACTCTTGTGG - Intronic
1151529319 17:74694559-74694581 CTTTCTTATGAGGACCCTTGTGG + Exonic
1152690688 17:81716467-81716489 GCCCCTTCCAAGGACCCCTGGGG + Intronic
1157684324 18:49630505-49630527 CCCTGTGACCAGGAGCCTTGTGG + Intergenic
1158160382 18:54475836-54475858 CTCTCTTATAAGGACCATTGTGG - Intergenic
1158534634 18:58296618-58296640 CTCTCTTACAAGGACACTTGTGG + Intronic
1158605389 18:58891227-58891249 TCCTCTTAAAAGGAACCTGGAGG + Intronic
1160592965 18:79954140-79954162 CCCTCTTACAAAGATGCATGTGG - Intergenic
1163015530 19:14451818-14451840 CCCTCCTGCAGGGACCCTGGAGG + Exonic
1164585993 19:29476367-29476389 CTAGCTTACAAGGACCCCTGTGG - Intergenic
1165110407 19:33498891-33498913 CCCTGTCTCAAGGACCCTGGCGG - Intronic
1165212399 19:34246470-34246492 CCCACTTACAGGGCCCCTCGGGG - Intergenic
1167350921 19:48974224-48974246 CCCTCCTACTATGAGCCTTGGGG - Exonic
1167618292 19:50548194-50548216 CCCTTTCACAGGGACCCCTGTGG - Intronic
1167953560 19:53046671-53046693 CACTCTTAAAAGGTTCCTTGGGG - Intronic
928496664 2:31839771-31839793 CTCTCTTAAAAGAGCCCTTGGGG - Intergenic
929298058 2:40270885-40270907 CTGTCTTTCCAGGACCCTTGAGG + Intronic
931303115 2:61000651-61000673 CCCTCTTACCCTGACCTTTGTGG + Intronic
932861444 2:75297017-75297039 CCCTCTTATGAGGACCCTGCTGG + Intergenic
933328585 2:80869234-80869256 TCCTCTTAAAATGACACTTGCGG - Intergenic
943071085 2:183141248-183141270 CCCTCTTGTAAGGATACTTGTGG + Intronic
943861574 2:192871505-192871527 CCCTTTTAAAAGAATCCTTGAGG + Intergenic
944326495 2:198411560-198411582 CACTCTTAAAGGGACGCTTGTGG + Intronic
945529308 2:210930782-210930804 CTCTTTTAGAAGGACACTTGTGG + Intergenic
946989425 2:225311513-225311535 CCCACTTATAAGAACACTTGTGG - Intergenic
947270251 2:228326724-228326746 GCCTTCTGCAAGGACCCTTGAGG - Intergenic
948063922 2:235062521-235062543 CCATTTTAGAAGGACCCTTCTGG - Intergenic
949064297 2:241980201-241980223 CCCTGGGACCAGGACCCTTGGGG + Intergenic
1169342236 20:4805262-4805284 CCCTCTTATAAGGACACTGGTGG - Intronic
1173578551 20:44129786-44129808 CCCTCTTATAAGGACACCTGTGG - Intronic
1175980265 20:62735230-62735252 CCCTCTGCCAAGGACCCTGCAGG - Intronic
1177883536 21:26721884-26721906 CCCTCTTATGAAGACCCCTGTGG - Intergenic
1178392872 21:32213882-32213904 CCCTCTTATCAAGATCCTTGTGG + Intergenic
1178910524 21:36669717-36669739 CCCACTTCTAAGGACACTTGGGG + Intergenic
1179333937 21:40432434-40432456 CTGTCTTATGAGGACCCTTGGGG + Intronic
1179997146 21:44979303-44979325 CCCTCTTCTAGGGATCCTTGCGG + Intergenic
1181380903 22:22502921-22502943 TTCTCTTACAAGGACATTTGTGG - Intronic
1183100618 22:35581657-35581679 CCCTCATAGAAGGATCCTTGTGG + Intergenic
1183163980 22:36133647-36133669 CCGCCTTATAAGGACCCTTGTGG + Intergenic
1183170251 22:36182602-36182624 CTGCCTTAGAAGGACCCTTGTGG + Intergenic
1183175581 22:36222671-36222693 CTGCCTTATAAGGACCCTTGTGG + Intergenic
1183264395 22:36816609-36816631 AGCTCGTACAAGGACCCTGGAGG + Intronic
1184931808 22:47686858-47686880 CTCTATTTCAAGGACCCTTCTGG + Intergenic
949290607 3:2461090-2461112 CCATATTCCAAGGAACCTTGAGG + Intronic
950255898 3:11505627-11505649 CTGACTTGCAAGGACCCTTGAGG - Intronic
950796419 3:15513949-15513971 GTCTCTTATAATGACCCTTGTGG - Intronic
951369564 3:21828962-21828984 CCCTCTTACAAGGACCCTTAAGG + Intronic
951552446 3:23887619-23887641 CCCTCATACACGGATCCTGGAGG - Exonic
951691098 3:25397154-25397176 TTCTCTCACAGGGACCCTTGGGG - Intronic
951787881 3:26442994-26443016 GCCTCTTATAAGAACCCTTGGGG + Intergenic
951951253 3:28201659-28201681 CCCTCTCATAAGGACTCTGGTGG - Intergenic
952357981 3:32602336-32602358 CCTTCTTACAAGGCAGCTTGGGG + Intergenic
953370767 3:42386417-42386439 CCCTCTTTTAAGGACCCTTGTGG + Intergenic
954424987 3:50438488-50438510 CCCACTTACACGGAGCCATGGGG - Intronic
955234104 3:57124410-57124432 TCCTCTTGTAAAGACCCTTGTGG - Intronic
955632143 3:60986021-60986043 CCCCCTTATAACGACCCTTGTGG + Intronic
957407175 3:79787065-79787087 CCCTCTTTCAATGTCCATTGTGG - Intergenic
958195998 3:90243649-90243671 TCCTGTTATAAGGACCCTTATGG + Intergenic
958419185 3:93912296-93912318 TCCTGTTATAAGGACCCTTATGG + Intronic
958727596 3:97924719-97924741 TCCTCTTACAGGGACCCTGGTGG + Intronic
959322041 3:104888853-104888875 CCTTCTTATAAGGACATTTGTGG + Intergenic
959699810 3:109288176-109288198 CCCTCTTACAAGGCCCTTAAGGG - Intergenic
960395577 3:117132701-117132723 CCCTTTTACTTGGACCCTTATGG + Intronic
961517565 3:127447529-127447551 CCCTCTTATAAGGACCCTTGTGG - Intergenic
963223524 3:142837045-142837067 CCCTCTTATAAGGGCACTTGTGG - Intronic
965577688 3:170234636-170234658 CCCTCATACTAGTAACCTTGAGG + Intronic
966426953 3:179790045-179790067 CCCTCTTATAAAGACCCTTGTGG + Intergenic
972694869 4:41435204-41435226 CCCTCTTATAAGGACTTCTGTGG - Intronic
973208600 4:47589034-47589056 CTTTCTTATAAGGACACTTGTGG - Intronic
975718425 4:77227713-77227735 CCCTCTCACAGGGGTCCTTGGGG - Intronic
980495988 4:133587864-133587886 CTCTCTTAGAATGACCCTGGGGG + Intergenic
981567588 4:146116872-146116894 CCCTCTTATAAGGACCCTTGTGG + Intergenic
981785780 4:148478208-148478230 CACTTTAACAAGCACCCTTGAGG - Intergenic
984032846 4:174626160-174626182 CCCTCTTACAGCTACCCTCGTGG + Intergenic
986085984 5:4447370-4447392 CTCTCTTACAAAGGTCCTTGTGG - Intergenic
986768078 5:10946221-10946243 CCCTCTCAGAAGGACACTTGTGG + Intergenic
986859990 5:11915825-11915847 TCCACTTACAGTGACCCTTGTGG - Intergenic
987525485 5:19044755-19044777 CCCTCCTATAAGGGACCTTGTGG + Intergenic
988277625 5:29102508-29102530 CTCTCTTACATGGGCCCATGAGG - Intergenic
992608995 5:78491196-78491218 CCCTGCTACAAAGTCCCTTGAGG - Intronic
993408594 5:87545483-87545505 CCTTCTTACAAGTACCTATGAGG - Intergenic
994242329 5:97439117-97439139 CCCTCTAACAGGGACCCATCTGG - Intergenic
994974662 5:106787056-106787078 CCCTCTTACCAGGGCTCTAGGGG + Intergenic
995425640 5:112019373-112019395 CTCCCATAAAAGGACCCTTGCGG + Intergenic
997460012 5:134045603-134045625 CCCTCTTTGAAGGGCCCTTGGGG + Intergenic
998799470 5:145854761-145854783 CCCTCCTTGAAGGACACTTGTGG - Intergenic
999196547 5:149785228-149785250 CCCTCTTTTAAGGGCCCTTCTGG + Intronic
1001542089 5:172546695-172546717 CCCTCTAATAAGGACACCTGTGG - Intergenic
1002066979 5:176656806-176656828 CCCTCCTCCAGGTACCCTTGTGG + Exonic
1004289253 6:14351442-14351464 TCCTCTTATAAGGACACTTAAGG + Intergenic
1004596338 6:17103118-17103140 CCCTCTTAGGTGGACCCTTGAGG - Intronic
1006010581 6:31039803-31039825 CCCTATTACAATGCCCCTCGTGG - Intergenic
1006055045 6:31377885-31377907 GCCTCTCACGAGGACCCTGGGGG + Intergenic
1012425926 6:99114339-99114361 CTCTCATAGAAGGACACTTGCGG + Intergenic
1015025513 6:128527664-128527686 CCCTCTTGTAAGGACTCTTGTGG - Intergenic
1017284832 6:152662369-152662391 CCTTCTTAGAGGGACACTTGTGG - Intergenic
1019503495 7:1377606-1377628 CGCTCTGACAAAGACCCTTGCGG + Intergenic
1021863530 7:24931431-24931453 CCCTCTTATAAGGACCCTTGTGG - Intronic
1022911143 7:34900464-34900486 CCCTCTTATGAGGACCCTTGTGG - Intergenic
1023159524 7:37283872-37283894 CCCTCTTTGAAGAACCCTGGGGG + Intronic
1023864357 7:44231853-44231875 ACATCTTACAAGGTCCCTGGGGG + Intronic
1026582539 7:71630266-71630288 TGCTCTTACAAGGACCATTAAGG + Intronic
1026582784 7:71632154-71632176 TGCTCTTACAAGGACCATTAAGG + Intronic
1026644495 7:72155953-72155975 CACTCTTATAAGGACCCTTGTGG + Intronic
1028512685 7:91642652-91642674 CCCCCTTTCAAGGGTCCTTGGGG - Intergenic
1032016500 7:128383479-128383501 CTCCCTTATAAAGACCCTTGTGG - Intergenic
1034079424 7:148262630-148262652 CCCTCCTATAAAGACCCTGGTGG + Intronic
1034545226 7:151784885-151784907 CCCTCTCACCGGGAACCTTGGGG + Intronic
1034939843 7:155223364-155223386 CCCTTTCCCCAGGACCCTTGGGG - Intergenic
1036527515 8:9548769-9548791 CACTCTTAAAAGGACCATTGTGG - Intergenic
1037096144 8:14990292-14990314 CCCTTTTAAAAAGTCCCTTGAGG + Intronic
1038030846 8:23637933-23637955 GCCTCTTATATGGGCCCTTGTGG - Intergenic
1038049132 8:23792642-23792664 GCCTCTTATATGGGCCCTTGTGG + Intergenic
1038256453 8:25955176-25955198 CCCACAGACAAGGACCCTTGGGG + Intronic
1044218900 8:89646695-89646717 TCTTCTTAAAAGGAACCTTGTGG - Intergenic
1045499917 8:102737348-102737370 CCTTCTCATAAGGACCCTTGTGG + Intergenic
1047222876 8:122932650-122932672 CCCTCTCATAAGGATACTTGTGG + Intronic
1047927952 8:129699554-129699576 GCCTCTTATAACGGCCCTTGTGG - Intergenic
1047998231 8:130357227-130357249 TCCTCTTACCTGGACCCTTCAGG - Intronic
1048169899 8:132096305-132096327 CTTTCTTGTAAGGACCCTTGTGG + Intronic
1048364559 8:133727401-133727423 CCCTCCTATAAGGACACCTGTGG + Intergenic
1049197705 8:141324692-141324714 CCCTGTTCCAAGGGCCCATGAGG - Intergenic
1049792074 8:144476732-144476754 CCCACATACAAGGCCCCTTGCGG - Intergenic
1050417306 9:5431236-5431258 TTCTCTTATAAAGACCCTTGTGG + Intronic
1055742568 9:79406133-79406155 CCCTCTTACCAGGAACCACGTGG - Intergenic
1056436560 9:86580297-86580319 CCCTCTTATAAGAAATCTTGTGG - Intergenic
1057506964 9:95642755-95642777 CCCTCTCACAAGGACCCTTGTGG + Intergenic
1057540187 9:95960469-95960491 CTTTCTTATAAGGACACTTGTGG - Intronic
1058541270 9:106014909-106014931 CCCTTATACAAGGAGCCTTAGGG - Intergenic
1058762297 9:108146760-108146782 TCCTCTTATAAAGACCTTTGTGG - Intergenic
1058804499 9:108577898-108577920 CCCTCTTAGAAAGATCCTTCTGG - Intergenic
1060468419 9:123928840-123928862 CCCTCTTACAAGAAAGTTTGTGG - Intronic
1061657232 9:132101778-132101800 TCCTCTTATAAGAATCCTTGCGG + Intergenic
1062082262 9:134630315-134630337 CTCTCTTATAAGGACACTGGGGG + Intergenic
1062144899 9:134983528-134983550 CCCTCTCATAAGGACTCTTGTGG - Intergenic
1062179566 9:135184036-135184058 CCCTCCTCCAAGGACCCCTCGGG - Intergenic
1187093071 X:16117811-16117833 CCCACTTATAAGAGCCCTTGTGG - Intergenic
1188388702 X:29592965-29592987 CCCTCTTTCAAGGTCTCTGGAGG + Intronic
1195271160 X:103232430-103232452 CTCCCTTACAAGGGACCTTGAGG + Intergenic
1196476586 X:116093316-116093338 CCCTCTTATAATGACCATTATGG - Intergenic
1199297419 X:146174849-146174871 TCCACTTTCAAGGACACTTGTGG + Intergenic