ID: 1142000430

View in Genome Browser
Species Human (GRCh38)
Location 16:87661218-87661240
Sequence TTACAAGGACCCTTGTGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000422_1142000430 -4 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000419_1142000430 11 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000423_1142000430 -8 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000421_1142000430 1 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000418_1142000430 23 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data
1142000420_1142000430 6 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000430 16:87661218-87661240 TTACAAGGACCCTTGTGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000430 Original CRISPR TTACAAGGACCCTTGTGGTT CGG Intronic
No off target data available for this crispr