ID: 1142000432

View in Genome Browser
Species Human (GRCh38)
Location 16:87661220-87661242
Sequence ACAAGGACCCTTGTGGTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142000422_1142000432 -2 Left 1142000422 16:87661199-87661221 CCGACCTCCTGCCTCCCTCTTAC 0: 1
1: 1
2: 4
3: 111
4: 1109
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000423_1142000432 -6 Left 1142000423 16:87661203-87661225 CCTCCTGCCTCCCTCTTACAAGG 0: 4
1: 41
2: 157
3: 395
4: 1372
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000425_1142000432 -9 Left 1142000425 16:87661206-87661228 CCTGCCTCCCTCTTACAAGGACC 0: 3
1: 43
2: 146
3: 286
4: 568
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000421_1142000432 3 Left 1142000421 16:87661194-87661216 CCTCTCCGACCTCCTGCCTCCCT 0: 1
1: 0
2: 8
3: 144
4: 1037
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000419_1142000432 13 Left 1142000419 16:87661184-87661206 CCTCTCCTCTCCTCTCCGACCTC 0: 1
1: 1
2: 18
3: 259
4: 2045
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000420_1142000432 8 Left 1142000420 16:87661189-87661211 CCTCTCCTCTCCGACCTCCTGCC 0: 1
1: 0
2: 5
3: 108
4: 1064
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58
1142000418_1142000432 25 Left 1142000418 16:87661172-87661194 CCAGCGGGGCAGCCTCTCCTCTC 0: 1
1: 1
2: 1
3: 32
4: 328
Right 1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000432 Original CRISPR ACAAGGACCCTTGTGGTTCG GGG Intronic
902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG + Intergenic
903440462 1:23384254-23384276 ACAAGGCCCCTTCTGGGTTGTGG + Intronic
905410192 1:37763384-37763406 ACAAGGACCATTGTGATTATTGG + Intronic
907644555 1:56229285-56229307 ACAAGGCCCCTCTTGGGTCGTGG + Intergenic
910587701 1:88897512-88897534 ACAAGGACACTTGTGTTTGTCGG + Intergenic
913372132 1:118111403-118111425 AGAAGGACCCGTGTGGTTTCAGG - Intronic
921592409 1:217020101-217020123 ACCAGGACCTTTGTGATTCAGGG - Intronic
1070225979 10:74506250-74506272 GTAAGGACCATTGTGGTTGGGGG - Intronic
1073836805 10:107453664-107453686 ATAAGGACCCTTGGTGTTCCAGG - Intergenic
1074110261 10:110417742-110417764 ACAAGGACCCTTGTGCACTGAGG - Intergenic
1079356883 11:19737167-19737189 ACAGGGACTCCTGTGGTTCTGGG + Intronic
1080397327 11:31902187-31902209 ACAAGAACTCTTGCGGTTTGGGG - Intronic
1104399138 12:128461297-128461319 ACAAGGAGCATTGTGGGTGGGGG + Intronic
1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG + Intergenic
1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG + Intronic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1128139435 15:65287954-65287976 ACTAGGGGCCTTGTGGTTCTAGG - Intronic
1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG + Intergenic
1129734878 15:77954070-77954092 AAAAGGAAACTTGTGGTTAGTGG - Intergenic
1135508764 16:23062783-23062805 ACAAGGGCCCTTCTGATTCAAGG - Exonic
1135610416 16:23861505-23861527 ACAAGGAGGCTGGTGGTTCCAGG + Intronic
1139429156 16:66901842-66901864 AGAATAACCCTTGTGGTTCTGGG + Intergenic
1140293304 16:73684677-73684699 AAAAGGACCCTTGTGATTGCAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG + Intergenic
1148348229 17:46918691-46918713 CCAATGACCCTTGTGGTTCAGGG - Intergenic
1152291493 17:79442481-79442503 GCAAGGCCCCTTGTGGTGAGAGG + Intronic
1153766329 18:8378494-8378516 CCAAGGAACCTTGTGATTCAAGG - Intronic
1157259206 18:46164219-46164241 ACAATGTGCCTTGTGGTTAGTGG + Intergenic
1157457993 18:47854809-47854831 AAATGGACCATTGTGGTTTGCGG - Intronic
1157527622 18:48396809-48396831 ACAACCACCATTGTGGCTCGTGG - Intronic
1164585991 19:29476360-29476382 ACAAGGACCCCTGTGGGCTGAGG - Intergenic
1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG + Exonic
926221053 2:10935616-10935638 ACAAGGATGCTTGTGTTTCTGGG - Intergenic
931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG + Intronic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
936709619 2:115117791-115117813 ACAAGGAACCTTAAGGGTCGGGG + Intronic
942467482 2:176223973-176223995 TTAAGGACCCTTGTGATTCTTGG + Intergenic
1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG + Intronic
1173169046 20:40707559-40707581 GCAAGGACCCCAGTGGTTCAGGG + Intergenic
1176203710 20:63876820-63876842 CCAGGGACCCGGGTGGTTCGTGG + Intronic
1177289047 21:19086430-19086452 ACAAGGACACTTGTGATTTAGGG - Intergenic
1180083032 21:45495170-45495192 ACAAGGACCCTTTTGGGAGGAGG - Intronic
1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG + Intergenic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG + Intronic
954304392 3:49717801-49717823 AGAAGGCCCATTGTGTTTCGAGG + Exonic
963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG + Intronic
963075577 3:141343436-141343458 ACAAGGACCCTTGGAGGTTGGGG + Intronic
968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG + Intergenic
969409801 4:7020444-7020466 ACAGGGAGCCCTGTGGTTGGGGG + Intronic
978877536 4:113659836-113659858 AAAAGGAACCTTCTGGTTTGAGG - Intronic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
995297882 5:110541063-110541085 ACAAGGATCCTGGTGGTACATGG + Intronic
1022829831 7:34054835-34054857 AGAAGGAAACTGGTGGTTCGTGG + Intronic
1022854009 7:34297821-34297843 CCAAGGACCCCTGAGGTTGGTGG + Intergenic
1038679029 8:29649693-29649715 AAAAGGACACTTGTGCCTCGGGG - Intergenic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1046626693 8:116583442-116583464 ACAAGGCCACTTGTGGCTCCAGG - Intergenic
1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG + Intronic
1054451830 9:65407417-65407439 CCAAGGACACTTGTGGTTGAGGG - Intergenic
1062144897 9:134983521-134983543 ATAAGGACTCTTGTGGCTCATGG - Intergenic
1192080767 X:68045839-68045861 GCAAGGGACCTTGTGGTTTGTGG - Exonic