ID: 1142000889

View in Genome Browser
Species Human (GRCh38)
Location 16:87663741-87663763
Sequence GTAAGTTTACCGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142000889 Original CRISPR GTAAGTTTACCGAGGGAGGT GGG (reversed) Intronic
912633749 1:111271527-111271549 GTGAGTTTCCCGCGGCAGGTGGG - Intergenic
917755698 1:178094916-178094938 GTAAGTTTAATGCGGGAGTTGGG + Intronic
1063676687 10:8146686-8146708 GTCAGTTCCCCGAGGAAGGTAGG + Intergenic
1066661600 10:37742023-37742045 GTTAGTTAAGCGTGGGAGGTCGG - Intergenic
1073944045 10:108730195-108730217 GTAAGTAGAGGGAGGGAGGTAGG + Intergenic
1074264158 10:111884414-111884436 GTAAGATTGGCCAGGGAGGTTGG - Intergenic
1080864354 11:36180132-36180154 GATAGTGTACCGAGGCAGGTAGG - Intronic
1088355921 11:108943788-108943810 GAATGTTTCCCGAGGGAGGGAGG - Intergenic
1096396948 12:51273287-51273309 GTAACCTTAGGGAGGGAGGTGGG + Intergenic
1099570259 12:84308478-84308500 GTAATTTTAATGAGGGAGTTGGG - Intergenic
1110316374 13:74112822-74112844 GTAAGTTTAATGAGGGAGGCAGG + Intronic
1110525640 13:76533406-76533428 GTGAATTTACTCAGGGAGGTAGG + Intergenic
1127252017 15:57248429-57248451 ATAAGTTTACTAAGGGAGCTTGG + Intronic
1131272550 15:90956071-90956093 TTCAGTTTACAAAGGGAGGTGGG - Intronic
1132559882 16:588867-588889 GTAACTTCACCGAGAGAGGCAGG + Intergenic
1132647454 16:1005532-1005554 GCAAGGCTAGCGAGGGAGGTGGG + Intergenic
1138291028 16:55846928-55846950 GTAAGTTTACAGTGGGAGGAGGG - Intronic
1142000889 16:87663741-87663763 GTAAGTTTACCGAGGGAGGTGGG - Intronic
1147040614 17:37715726-37715748 GCAAGTTTGCCTAGGGAAGTGGG - Intronic
1149664648 17:58357445-58357467 GTGAGTTTTCAGAGGGAAGTGGG - Intronic
1154058643 18:11036426-11036448 GCAGCTTTACCGGGGGAGGTGGG - Intronic
1159875781 18:73809365-73809387 GTAAATTTGGGGAGGGAGGTAGG - Intergenic
925578874 2:5389670-5389692 GTCTGTTTACACAGGGAGGTAGG - Intergenic
929284276 2:40117805-40117827 GGAAGTTTACGGAGGAAGGATGG - Intronic
929451221 2:42038969-42038991 GTAAATGTACCCAGGTAGGTGGG - Intergenic
935267718 2:101409017-101409039 GTGAGTTTACCCAGGAAGGAAGG - Intronic
937278428 2:120701395-120701417 GAAGGTTAACCGAGGGAGCTGGG - Intergenic
943713516 2:191124664-191124686 TTAGGTTTAGGGAGGGAGGTGGG - Intronic
944162256 2:196676714-196676736 GAAAGATTTCAGAGGGAGGTAGG + Exonic
1175472735 20:59243474-59243496 ATAAGTAGACAGAGGGAGGTGGG + Intronic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1184754028 22:46506361-46506383 GTAAGTCTGAGGAGGGAGGTGGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
954794826 3:53156187-53156209 ACAAGTTTACCGAGGAAAGTAGG - Intronic
954890980 3:53927798-53927820 GTTGGTTTACCGATGGAGGGAGG - Intergenic
956561398 3:70580171-70580193 GCAACTGTACTGAGGGAGGTTGG - Intergenic
959515943 3:107267222-107267244 GTAGGTTTACGGGGAGAGGTTGG + Intergenic
962318865 3:134374931-134374953 GTGTGTGTACCGGGGGAGGTGGG + Intronic
967491865 3:190101285-190101307 TTAAGTTTACTGAGGAAGGCAGG + Intronic
970520953 4:16883389-16883411 TTAAGTTTACAGAGGGAAGAAGG + Intronic
972713235 4:41619547-41619569 GGAAGATTACAGATGGAGGTGGG + Intronic
981549470 4:145928823-145928845 GTAAGATACCTGAGGGAGGTGGG + Intronic
984084015 4:175285894-175285916 GTAGGATTACCCAGTGAGGTGGG + Intergenic
984650926 4:182269836-182269858 GAAAGTGTACCCAAGGAGGTTGG + Intronic
991660288 5:68944395-68944417 GGAAGTTTACCAAAGGGGGTGGG - Intergenic
1004279789 6:14270980-14271002 GAAAGATTACCTAGAGAGGTGGG - Intergenic
1009685571 6:66951137-66951159 GTAATTTTACCAAGACAGGTGGG - Intergenic
1016763411 6:147765659-147765681 GGAACTTTACCTAGGGACGTCGG + Intergenic
1033107557 7:138542236-138542258 GTAAGCTTACTGAGGAAGGCAGG - Intronic
1038947978 8:32382851-32382873 GTAAGTTTCATGAGGGAAGTGGG - Intronic
1048225213 8:132578692-132578714 GAAAGTTTTCAGTGGGAGGTGGG - Intronic
1058859132 9:109097374-109097396 GTAAGAATGCAGAGGGAGGTTGG + Intronic
1061260656 9:129479127-129479149 GGAAGGCTACCAAGGGAGGTAGG - Intergenic
1189022511 X:37355663-37355685 GTAAGTTTAAAGATGGAAGTGGG + Intronic