ID: 1142003778

View in Genome Browser
Species Human (GRCh38)
Location 16:87679598-87679620
Sequence CCACTGGATGAATGCGTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142003778_1142003788 5 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003788 16:87679626-87679648 GAAGCTGGTGTTCGCTGTCCGGG 0: 1
1: 0
2: 1
3: 7
4: 104
1142003778_1142003785 -10 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003785 16:87679611-87679633 CATCCAGTGGGTTGGGAAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 224
1142003778_1142003790 10 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003790 16:87679631-87679653 TGGTGTTCGCTGTCCGGGCTGGG 0: 1
1: 0
2: 2
3: 2
4: 67
1142003778_1142003789 9 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003789 16:87679630-87679652 CTGGTGTTCGCTGTCCGGGCTGG 0: 1
1: 0
2: 2
3: 2
4: 70
1142003778_1142003787 4 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003787 16:87679625-87679647 GGAAGCTGGTGTTCGCTGTCCGG 0: 1
1: 0
2: 0
3: 6
4: 103
1142003778_1142003791 19 Left 1142003778 16:87679598-87679620 CCCCGGACGCATTCATCCAGTGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1142003791 16:87679640-87679662 CTGTCCGGGCTGGGTCGTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142003778 Original CRISPR CCACTGGATGAATGCGTCCG GGG (reversed) Intronic
905541112 1:38761115-38761137 CCACTGCATGGATGGGTCCCGGG + Intergenic
910600328 1:89024531-89024553 CCACTGTATGAATGGGGCAGGGG - Intergenic
1093316920 12:17663843-17663865 CCACGGAATGAATGTCTCCGGGG - Intergenic
1102407674 12:112687773-112687795 CCAATGGATGAAAGAGTCTGAGG - Intronic
1103479261 12:121240728-121240750 GCAGTGGATGCATGCGTGCGGGG + Exonic
1104813300 12:131631422-131631444 ACAATGGATGAATGCGTAGGTGG + Intergenic
1104896178 12:132166058-132166080 GCACTGGATGAATGCCTCAAGGG + Intergenic
1122966759 14:105133520-105133542 ACACAGGAAGAATGCGTCCAGGG - Intergenic
1123108548 14:105854610-105854632 CCACTGCACGAAGACGTCCGCGG + Intergenic
1123939068 15:25208045-25208067 CCACTGGATGCATGCATGGGAGG + Intergenic
1137881094 16:52049547-52049569 CCACTGCCTGAATGAGTCAGGGG - Intronic
1142003778 16:87679598-87679620 CCACTGGATGAATGCGTCCGGGG - Intronic
1152946309 17:83199346-83199368 CCGCTGAATGAACGCGTCCTGGG + Intergenic
1163875212 19:19862159-19862181 GCACTGGATGAATGCATCAAAGG - Intergenic
1163938446 19:20471778-20471800 GCACTGGATGAATGCCTCTAGGG + Intergenic
936176084 2:110221205-110221227 GCACTGGATGAATGCCTCAAGGG + Intergenic
1171779028 20:29401518-29401540 ACACTGGATGAATGCCTCAAGGG - Intergenic
1175015199 20:55782587-55782609 CCACTGGATGAATTTGTTGGGGG - Intergenic
1180057326 21:45365610-45365632 CCTCTGGGTGAACGCCTCCGTGG - Intergenic
1185197852 22:49483492-49483514 CCTCTGGATGCAGGCCTCCGCGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
957086115 3:75679084-75679106 GCACTGGATGAATGCCTCAAGGG + Intergenic
958143601 3:89595711-89595733 CCACTGGCAGAATGCTTCCAAGG + Intergenic
962248926 3:133822923-133822945 CCAATGGATAAATGCGTACAAGG - Intronic
970005896 4:11410423-11410445 GCCCTGAATGAATGCTTCCGTGG - Intronic
972392344 4:38625702-38625724 CTACTGGCTGAATGAGTGCGTGG - Intergenic
975031427 4:69622803-69622825 CCGCTGGATGAATGTGTTTGAGG - Intronic
982950737 4:161692604-161692626 CCCCTGGGTGAATGTGTCCAGGG + Intronic
996551057 5:124730893-124730915 CCACTCTATGAATGCTTCTGAGG - Intronic
1002159218 5:177305050-177305072 CCACTGTATGAATGAGTCAAAGG - Intronic
1002456358 5:179347184-179347206 CCACAGGAGGAATGCGTCATGGG - Intergenic
1004085382 6:12442688-12442710 CCTCTGAATGCATGCGTGCGGGG - Intergenic
1005317634 6:24619519-24619541 CCACAGGATAAATACGTCCAGGG + Intronic
1006404859 6:33838980-33839002 CCACTGGATGGAAGCCTCCGTGG + Intergenic
1009456235 6:63859810-63859832 CCCCTGGATGAATTCCTCAGTGG + Intronic
1025608102 7:63054025-63054047 CCCCCTGATGAATGCGTCTGTGG - Intergenic
1029458388 7:100682368-100682390 CCACTGGGTGAAGCCGTCCTGGG + Exonic
1048366766 8:133745218-133745240 CCATTGGAAGAATGCTTCCTTGG - Intergenic
1048924186 8:139256007-139256029 CCACTGTATGAATGTGTGGGGGG - Intergenic
1048935275 8:139350014-139350036 CCAATGGATCAGTGCTTCCGAGG + Intergenic
1050422593 9:5482373-5482395 CCACAGGATGGATGCCTCGGTGG - Intergenic
1062102450 9:134735530-134735552 CAGCTGGATGAATGCGCCTGAGG - Intronic
1062702529 9:137914843-137914865 CTCCTGGATGAACGCATCCGTGG - Intronic
1185980264 X:4771546-4771568 GCACTGGATGAATGCCTCAAGGG + Intergenic
1188870383 X:35364639-35364661 CCACTGGATTAATGTTTCAGGGG - Intergenic
1192261400 X:69507722-69507744 CCACTGAGTGTATGTGTCCGTGG - Intronic
1198158204 X:133983630-133983652 CCACAAGATGAATGGGTCCAGGG - Intronic
1200403760 Y:2787394-2787416 CCACACGATGAATGCGTTCATGG + Exonic