ID: 1142004327

View in Genome Browser
Species Human (GRCh38)
Location 16:87682142-87682164
Sequence CAGGAAATGAAGCAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142004327_1142004329 -8 Left 1142004327 16:87682142-87682164 CCAGCAGCTTGCTTCATTTCCTG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1142004329 16:87682157-87682179 ATTTCCTGGACACGTGTTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 120
1142004327_1142004331 -2 Left 1142004327 16:87682142-87682164 CCAGCAGCTTGCTTCATTTCCTG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1142004331 16:87682163-87682185 TGGACACGTGTTCTTGGCTGTGG 0: 1
1: 0
2: 2
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142004327 Original CRISPR CAGGAAATGAAGCAAGCTGC TGG (reversed) Intronic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
901680362 1:10909549-10909571 CAGGAAATGAAGGAAGGAGAGGG - Intergenic
901785456 1:11621732-11621754 AAGGAACTGAGGCAAGATGCTGG + Intergenic
901862277 1:12081940-12081962 CAGGAAGTGAGGCAAGAGGCAGG - Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902520627 1:17013684-17013706 CAGGATCTAAAGCAAGCAGCTGG - Intergenic
903220630 1:21867653-21867675 GAGGATAAGAAGCAATCTGCTGG - Intronic
904967137 1:34383913-34383935 CAGGAACAGAAGCCTGCTGCTGG + Intergenic
904972970 1:34433574-34433596 CAGGGAAGGAAGCCAGTTGCAGG + Intergenic
906747177 1:48230285-48230307 GAGGAAGTGAAGGAAGGTGCTGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908170671 1:61501512-61501534 CAGGAAGTGTAGCCAGCTGGTGG + Intergenic
908634807 1:66151363-66151385 CAGGAGATGAATGAAGCTGGAGG - Intronic
908935097 1:69365781-69365803 TAGGTAAGGAAGAAAGCTGCAGG - Intergenic
909223646 1:72991234-72991256 CAGCACATGTAGCAAGCTCCTGG + Intergenic
910609364 1:89124905-89124927 CAGGTAATGAAGCCAGCATCAGG + Intronic
911021888 1:93397440-93397462 CAGGAAAGGAAGCAAACAGAGGG + Intergenic
911527498 1:99004624-99004646 CTGGAAATAGAGCATGCTGCTGG + Exonic
913527213 1:119705086-119705108 CTGGAAATGAAGCAAGCCAGAGG + Intronic
916972437 1:170038317-170038339 CAGGATTTCGAGCAAGCTGCAGG + Exonic
917611575 1:176693998-176694020 GAGAAAAGGAAGCAAACTGCAGG - Intronic
919850489 1:201668867-201668889 AGGAAAAGGAAGCAAGCTGCAGG - Intronic
920692822 1:208159803-208159825 CAGGAACTGAAGCCAGGGGCTGG + Intronic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923215957 1:231847953-231847975 GAAGAAATGAAGAGAGCTGCTGG + Intronic
924582191 1:245332163-245332185 CAGGAAATGCAGTAAGCAGATGG + Intronic
1063338992 10:5245106-5245128 CTGGACATGAAGCATGGTGCTGG - Intergenic
1063344106 10:5295261-5295283 CTGGACATGAAGCATGGTGCTGG + Intergenic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1067508082 10:46873336-46873358 CAGGAAAATAAACAAGCTGGAGG - Intergenic
1068580228 10:58730921-58730943 GAGGAATTCAAGCAGGCTGCAGG - Intronic
1068645417 10:59461253-59461275 CAGGATATGAAGCAAAATGGTGG + Intergenic
1069334689 10:67334436-67334458 CAAGAGAAGAAGAAAGCTGCTGG + Intronic
1070432804 10:76358148-76358170 CAGGAAATGAATAAAGCTGAGGG - Intronic
1071871678 10:89802158-89802180 TAGTCAATGAAGCAAGCAGCTGG - Intergenic
1071872588 10:89811512-89811534 CAGGAGATAAAGAAAGCTCCAGG - Intergenic
1072911685 10:99507561-99507583 GAGGAAATGAAGTCATCTGCAGG + Intergenic
1073763697 10:106658586-106658608 CAGGAAATGAAGGAAGCCTTGGG + Intronic
1074898570 10:117797509-117797531 GAGTAATTGAAGCAAGATGCAGG - Intergenic
1075129289 10:119725270-119725292 CAGTTAATGAAGCAAGCGGAAGG - Intergenic
1077133129 11:984609-984631 CAGGCAATGAGACACGCTGCCGG - Intronic
1078053744 11:7989867-7989889 CAGGAAATGAAGCTAGCAGAGGG + Intronic
1078428397 11:11269231-11269253 CAGGCAGTGATGCAGGCTGCTGG + Intergenic
1078978550 11:16505554-16505576 GAGGAATTCAAGCCAGCTGCAGG + Intronic
1080327470 11:31094107-31094129 CAGGCAGTGAAGCAAGCAGCAGG - Intronic
1080624678 11:34017568-34017590 CAGTAACTCAAGCATGCTGCAGG + Intergenic
1081494896 11:43598553-43598575 CAGGAAGAGAAGAGAGCTGCAGG - Intronic
1082649325 11:55769038-55769060 CAGGACATGAATGAAGCTGGAGG - Intergenic
1082678073 11:56133512-56133534 CAGGATATGAAGCAAAATGGTGG + Intergenic
1083436883 11:62648850-62648872 CAGGAACTGCAGCAAGCGGTAGG + Exonic
1083989977 11:66240931-66240953 CATGAAAAGGAGAAAGCTGCAGG + Intronic
1085010521 11:73137855-73137877 CAGGAAAGGAAGCTTGCAGCTGG + Intronic
1086062518 11:82714561-82714583 CAGGAAACGCAGCCTGCTGCAGG + Intergenic
1086322132 11:85662403-85662425 CAGGAAATGTGGCCAGCAGCTGG + Exonic
1086377526 11:86216089-86216111 CAGGAAATGAAACCAACTTCTGG + Intergenic
1087273446 11:96136744-96136766 CAGGAAATGAAGCAAAAAGTGGG - Intronic
1087394989 11:97585772-97585794 CTGGACAGGAAGCATGCTGCTGG - Intergenic
1088216875 11:107520246-107520268 CAGGCAATGCAGTAAGCTCCAGG + Intronic
1088274779 11:108073822-108073844 CAGGACATCAAGGAAGCTCCAGG - Intronic
1088586022 11:111360602-111360624 CAGGAAATGATGCAATATACAGG + Intronic
1088811777 11:113397178-113397200 CAGGAAAGGAAGCAACGGGCTGG - Intronic
1089170717 11:116509686-116509708 CAGGAAGTGAATCTAGCAGCAGG + Intergenic
1090440819 11:126724263-126724285 AAGAAAATGAACCAACCTGCAGG - Intronic
1090646152 11:128768142-128768164 TAGCAAATGCAGCAAGCTGGTGG + Exonic
1092069849 12:5623644-5623666 CAGGAGAGGACGCCAGCTGCAGG + Intronic
1092819505 12:12340106-12340128 CAGAAAAAGAAGCCAGCAGCTGG - Intronic
1092999111 12:13979270-13979292 CTGGAATTGAAGGATGCTGCAGG - Intronic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1093656936 12:21705764-21705786 CAAGAGAGGAAGCAAGATGCAGG - Intronic
1094047532 12:26183737-26183759 CAGGGAATGCCGCAAGTTGCTGG + Intronic
1095208574 12:39466979-39467001 CAGGCTAAGAAGAAAGCTGCTGG - Intergenic
1096208848 12:49746614-49746636 TGGGACATGCAGCAAGCTGCTGG - Intronic
1096921411 12:55090511-55090533 AAGCAAATGGAGCAAGCTCCAGG - Intergenic
1097767288 12:63540671-63540693 GAGAAATTGAAGCAGGCTGCTGG - Intergenic
1097783659 12:63735711-63735733 GAGAAATTGAAGCAGGCTGCTGG - Intergenic
1099159434 12:79222775-79222797 GAGGAAATGAAGAAAGCTCATGG - Intronic
1099921800 12:88967312-88967334 AAACACATGAAGCAAGCTGCAGG + Intergenic
1100272009 12:93034837-93034859 CAGGAGATGAAGCAAGCAGGAGG - Intergenic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1107829854 13:44364853-44364875 CAGGAAAAGAGTCAATCTGCAGG - Intergenic
1108988295 13:56622665-56622687 CAGGAAAGGATGCAATCTGATGG - Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1109921572 13:69069596-69069618 TACAAAGTGAAGCAAGCTGCAGG - Intergenic
1110868388 13:80422717-80422739 CAGGGAAGGGTGCAAGCTGCTGG + Intergenic
1112798800 13:103087932-103087954 CAGAAGATGAAGCAAGTGGCTGG + Intergenic
1114196072 14:20477358-20477380 CAGGAAATGAAACAATCAGAAGG - Intergenic
1115630036 14:35235604-35235626 CAGGCCAAGAAGAAAGCTGCTGG - Intronic
1115994581 14:39183287-39183309 CAGGAAATGAAACATTTTGCTGG - Intergenic
1116128520 14:40821554-40821576 AAAGAAATAAAGAAAGCTGCTGG + Intergenic
1119774068 14:77237710-77237732 CAGTATTTGAAGCATGCTGCAGG + Intronic
1119850612 14:77863932-77863954 AAGGAAATGAGGCCAGCTGCTGG + Intronic
1121675677 14:95750811-95750833 CAGGAAGGGAAGCAGGCTTCAGG - Intergenic
1122581299 14:102773347-102773369 CCAGCAAAGAAGCAAGCTGCTGG - Intergenic
1122873475 14:104651939-104651961 CAGCAAAGGGACCAAGCTGCTGG + Intergenic
1124185279 15:27519821-27519843 CAGGAAATGGATCAAAATGCTGG - Intronic
1126781011 15:52139059-52139081 CAGGGATTGAAGAAAGCTGGAGG + Intronic
1127105388 15:55608333-55608355 CAGGAATTGAACAAAGTTGCAGG - Intergenic
1127137822 15:55943259-55943281 GAGGAATTCAAGCCAGCTGCTGG + Intronic
1127753285 15:62067105-62067127 CAGGGAATTAAGCAAGCCGATGG - Intronic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129932778 15:79426158-79426180 CAGGAACTGAAGGAAACTGGGGG + Intronic
1131375948 15:91923410-91923432 CAGGAAAAGAAGAGCGCTGCTGG - Intronic
1132333570 15:101028977-101028999 CGGGAAATGGAGCAGGGTGCCGG - Exonic
1132712472 16:1275592-1275614 CAGGAAAGGAAGAAAGCTTCAGG + Intergenic
1133305297 16:4804529-4804551 CAGGGAGTGCAGCAAGCAGCCGG - Exonic
1133916826 16:10116650-10116672 AAGGAAAAGAAGCCAGCAGCAGG + Intronic
1133938182 16:10285415-10285437 CAGCACTTGAAGCAAGCTCCTGG - Intergenic
1134629025 16:15743619-15743641 AAGTGCATGAAGCAAGCTGCTGG - Intronic
1136038762 16:27561384-27561406 CAGGAAAGGAAGCTAGGAGCGGG - Intronic
1138221102 16:55250941-55250963 CAGGAAATGAAGCAGGCACATGG + Intergenic
1138512166 16:57515135-57515157 CAGGAAGTCAGGCCAGCTGCAGG - Intronic
1139083951 16:63561527-63561549 GAGGAATTCAAGCAGGCTGCAGG - Intergenic
1140519599 16:75569682-75569704 AAGGAAATGAAGCAGGCTTCTGG + Intronic
1141452680 16:84116508-84116530 CAGGCAACGGAACAAGCTGCCGG + Intronic
1141860386 16:86712344-86712366 CAGGTAATGCACCCAGCTGCGGG - Intergenic
1141920506 16:87132599-87132621 CAAGAAATGTAGCCGGCTGCTGG - Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142294188 16:89209588-89209610 CAGCAAATGACGCAAGGTGGCGG + Intergenic
1142854359 17:2721703-2721725 AAGGAAATAAGGCAAGCTGGGGG - Intergenic
1144168890 17:12639338-12639360 CAGGAAATGAAGCAACCCTAGGG + Intergenic
1144672585 17:17141326-17141348 CAGGAAGCTAAGGAAGCTGCTGG - Intronic
1146915304 17:36674476-36674498 CAGGAAATGAAGCCTTTTGCTGG + Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148029714 17:44611072-44611094 CAGGAAAGGAGGGAAGCAGCCGG + Intergenic
1148575048 17:48704575-48704597 CAGGAAATGAGGCAGGATCCAGG - Intergenic
1149584511 17:57776579-57776601 GTGGAAATGAAGCCAGCTGGCGG - Intergenic
1150221959 17:63500825-63500847 CCGGAACTGAGGCAAGCTGTGGG - Intronic
1151196651 17:72436406-72436428 CAAGAAATGATGCAAGATGAGGG - Intergenic
1151542551 17:74771987-74772009 AAGGAAATGAACCAAGCATCCGG - Exonic
1154027358 18:10721179-10721201 CAGAGAATGAAGCAACTTGCCGG - Intronic
1155437337 18:25826985-25827007 GAGGAAATGAAGCAAGGTGCTGG + Intergenic
1155700988 18:28743367-28743389 CAGGAAAGCAAGGAAACTGCAGG + Intergenic
1156698806 18:39799265-39799287 CAGGATATAAAGCAAGATGGAGG + Intergenic
1158512073 18:58099516-58099538 CACTAAAGGAAGAAAGCTGCTGG - Intronic
1158576690 18:58644430-58644452 CAGCACTTGAAGCAAGCTCCTGG + Intergenic
1158791356 18:60784247-60784269 GAGGAATTCAAGCCAGCTGCAGG + Intergenic
1160011374 18:75109227-75109249 CAGGATAGGAACCAAACTGCAGG - Intergenic
1163867667 19:19787691-19787713 CATTAAATGCAGCAAGATGCAGG + Intronic
1163952738 19:20605493-20605515 CATTAAATGCAGCAAGATGCAGG + Intronic
1163962037 19:20705715-20705737 CATCAAATGCAGCAAGATGCAGG - Intronic
1165249243 19:34516255-34516277 CAGCACTTGAAGCAAGCTCCTGG - Intergenic
1166044170 19:40219733-40219755 CAGGAAAGGAAGCATGCAGGAGG + Intergenic
1166395958 19:42441314-42441336 GAGGAACTGAAGGAAGCTGTGGG + Intronic
1167014269 19:46830073-46830095 CAGTAACTGAAGGAAACTGCTGG - Intergenic
1168332135 19:55576954-55576976 CAAGAAATGAAACAATCAGCTGG + Intergenic
925078597 2:1041099-1041121 CAGGATATGTAACATGCTGCGGG - Intronic
925385590 2:3459667-3459689 TAGGGAAGGAAGCCAGCTGCAGG + Intronic
925877588 2:8326281-8326303 CAGGCAAAGAGGCAAGCTCCAGG - Intergenic
927371147 2:22356616-22356638 CAGTGACTGAAGCAAGGTGCAGG - Intergenic
928436286 2:31256729-31256751 CAGGGATTGCAGCAAGTTGCAGG + Intronic
928483505 2:31707022-31707044 CTGGAACTGGAGCCAGCTGCAGG - Intergenic
928617754 2:33056428-33056450 CAGGGAACTAAACAAGCTGCTGG - Intronic
928732995 2:34254592-34254614 CAGTAAGTGAAGCAAGTTGAGGG - Intergenic
931627931 2:64273719-64273741 AAGGAAATGAAGCTTCCTGCTGG + Intergenic
936801871 2:116279319-116279341 CAGGAAATGAAGAAAGATATAGG + Intergenic
940485211 2:154288852-154288874 CAGGACATGGTGCAAGCTGTTGG + Intronic
941551342 2:166919082-166919104 CTGGAGATCAAGCAAACTGCAGG + Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
941930166 2:170930464-170930486 CAGGAAATGAAGGTAGCACCAGG - Intronic
943778014 2:191788525-191788547 CCAGAAATGAGGCAGGCTGCAGG + Intergenic
944000136 2:194824488-194824510 CAGGAATTTAAGCAGGCTACTGG + Intergenic
944890673 2:204114377-204114399 CAGGAAGGGGAGAAAGCTGCAGG - Intergenic
946090592 2:217219302-217219324 CAGCAAAGGAGGCAAGATGCAGG + Intergenic
946522833 2:220485391-220485413 CTGGAAACGAAGAAAGCTGTTGG + Intergenic
947588266 2:231370282-231370304 GAGGAAAGGAAGCCACCTGCTGG - Intronic
1171077635 20:22145053-22145075 CAGGATATGAGGCAGGCAGCAGG - Intergenic
1172320158 20:33990252-33990274 CAGGAGATGAGGCAGGCTTCAGG + Intergenic
1172757242 20:37294524-37294546 CAGTCAAGTAAGCAAGCTGCAGG - Intronic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175162807 20:57021501-57021523 CTGGAAATGAAGGAACCAGCTGG + Intergenic
1177646112 21:23901545-23901567 CAGGAACTGAAGGAAGCATCTGG + Intergenic
1178710637 21:34913334-34913356 CAGGAAAGGAAGAAACCTGTTGG + Intronic
1179172649 21:38984475-38984497 CAGGCAATGAAGCACACTGTGGG + Intergenic
1179411347 21:41166027-41166049 CAGAAAATAATGCAAGCTGAAGG - Intergenic
1179904419 21:44414914-44414936 CGGGAAAAGAAGCCACCTGCTGG - Intronic
1181985095 22:26794981-26795003 CAGGAACAGGAGCAAGGTGCAGG - Intergenic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1183001125 22:34860010-34860032 AAGAAAATGAAGCAAGGTGATGG - Intergenic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1184077932 22:42195324-42195346 CAAGAAATTAAGAATGCTGCTGG + Intronic
1184199741 22:42959901-42959923 CAGGAAATGATGAAATGTGCTGG - Intronic
1185053198 22:48564374-48564396 CACAAAATGAAGGAAGCTGGTGG + Intronic
1185064872 22:48627059-48627081 CAGGAAACAGAGGAAGCTGCAGG - Intronic
1185161307 22:49231540-49231562 CAGAGAGTGAAGCATGCTGCTGG - Intergenic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
952166649 3:30757028-30757050 CTGGAAATGGAGGAAGCTGAGGG - Intronic
952390179 3:32873262-32873284 CAGGCACTCAAGCAAGCTACAGG - Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
952853454 3:37748450-37748472 CAGAAAAAGAAGGAAGCTGGCGG + Intronic
954909041 3:54087830-54087852 CAGGAAATGAAGAAAACAGCAGG - Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
961815525 3:129548217-129548239 CAGGAAGTTAGGCAAGATGCAGG - Intronic
962967280 3:140366591-140366613 CAGGAAAGGCAGCAACTTGCTGG - Intronic
965003423 3:162986913-162986935 CAGGAGATGAATAAAGCAGCAGG + Intergenic
965381627 3:167996468-167996490 GAGGACATGAAGAAACCTGCTGG - Intergenic
966882502 3:184358258-184358280 CAGGTACTGGAGCAAGATGCTGG + Exonic
967723877 3:192843729-192843751 CAGGAAGTGAAATAACCTGCAGG - Intronic
969130061 4:4984426-4984448 CAGGAAATGGAGACAGCTGAAGG + Intergenic
970996930 4:22278456-22278478 CAGGAATTGAAGAGAGATGCTGG - Intergenic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971498665 4:27295098-27295120 CAAGAAAAGGAGAAAGCTGCTGG + Intergenic
971687666 4:29789233-29789255 CAGGAAATGAAGTAACCAGCAGG + Intergenic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
972461400 4:39306983-39307005 CAGGCCATGGAGCACGCTGCCGG + Intronic
973057473 4:45678978-45679000 CAGGCAGAGAAGCAAGCAGCTGG - Intergenic
975107709 4:70587324-70587346 CAGCAAATGAAGCAAGTTAGAGG + Intergenic
975918864 4:79358663-79358685 CAGATAATGAAGTTAGCTGCTGG + Intergenic
976291989 4:83428645-83428667 CAGGAAAAAAAGCAAGTTGCAGG + Intronic
979192747 4:117882883-117882905 TAGGAAATGAAGCAGGATGCGGG + Intergenic
980797457 4:137702647-137702669 CAGGCAATGAAGAAAGCAGAGGG - Intergenic
981660163 4:147157513-147157535 CAGGAAATGAAGAAAGTGGCAGG - Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982616548 4:157644431-157644453 CAGGAGATGAAGGAAGCGGCTGG - Intergenic
984164308 4:176288960-176288982 GAGGGAATGAACCAAGCTGCTGG - Intergenic
986677269 5:10197065-10197087 CAGGAAAGGAAGCGAGCATCTGG - Intergenic
986683966 5:10259695-10259717 CAGGGATTGAAGCATGCTGGCGG + Intronic
987730351 5:21763027-21763049 CAGAAACTAAAGAAAGCTGCAGG + Intronic
987941084 5:24538410-24538432 CAGGAAAAGAAGCAAGACACAGG - Intronic
989601275 5:43202921-43202943 CAGGACATGGAGCCAGCAGCAGG - Intronic
989615578 5:43334329-43334351 GAGTAAATGAGGCAATCTGCAGG - Intergenic
990400141 5:55429656-55429678 CAGGGAATGATGCAGTCTGCTGG - Intronic
990739304 5:58895944-58895966 TAACAAATGCAGCAAGCTGCTGG - Intergenic
995180352 5:109225033-109225055 CAAGAATTGAAGAAAGCTGATGG + Intergenic
996985152 5:129553025-129553047 CAGGAAAAGAAGAAAACTGGGGG - Intronic
997026355 5:130066758-130066780 CAGGAAAAGGCGTAAGCTGCAGG + Intronic
998077559 5:139248775-139248797 CAGGAAATGTGGCTTGCTGCTGG + Intronic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
1000356491 5:160400955-160400977 CAGGACATGAAGCTAGCTGTGGG - Intergenic
1000640478 5:163696439-163696461 CAGGAATGGAAATAAGCTGCCGG - Intergenic
1001637964 5:173226270-173226292 CAGGCCAAGAAGAAAGCTGCTGG - Intergenic
1002904148 6:1435328-1435350 CAGGAACTGTAAGAAGCTGCTGG + Intergenic
1003357199 6:5384908-5384930 GAGGAAATGAGACAAGCAGCAGG + Intronic
1003861780 6:10328830-10328852 CAGTAAATGAAGCAAGAGGGTGG - Intergenic
1005794570 6:29345685-29345707 CAAAAAATGAACAAAGCTGCAGG + Intergenic
1007028275 6:38600489-38600511 CAGGAAATTCAGAAAGCTACTGG + Intronic
1007032674 6:38642219-38642241 CAGGTAATGGAGAAAGCTGCAGG - Intergenic
1007738130 6:43994509-43994531 CAGGAAGGGAGGGAAGCTGCAGG + Intergenic
1007817168 6:44532719-44532741 CAAGAAATGAAGCAAGTTCTTGG - Intergenic
1007819508 6:44550666-44550688 CAGGAAATGAAGAAGGCTAGAGG + Intergenic
1007839374 6:44703083-44703105 CAGGCAATGGAGCCAGCTGCTGG + Intergenic
1008474926 6:51926251-51926273 CTGAAAATGAAGCCAGCTGAGGG + Intronic
1009480926 6:64157401-64157423 GAGAAATTGAAGCCAGCTGCAGG + Intronic
1010917260 6:81635544-81635566 CAGGCAATGAAGAAATCTGAGGG + Intronic
1011053521 6:83180614-83180636 AAGGACATGATGCAAGCTTCAGG + Intronic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1011369264 6:86615510-86615532 CAGGGAGTGAAGCAGCCTGCAGG + Intergenic
1014038152 6:116791937-116791959 TAGGAAATGAAGGGAGCTTCAGG + Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1016069557 6:139723893-139723915 CAGGATAGGAAGCAAGTTGAAGG - Intergenic
1017019917 6:150131713-150131735 CAGTACAAGAAGCATGCTGCTGG - Intergenic
1017568173 6:155710879-155710901 CAGGAAGTCAAGCCAGCTTCTGG - Intergenic
1017964326 6:159250984-159251006 CAGGAATGGCAGCGAGCTGCAGG + Intronic
1019631245 7:2050978-2051000 AAGGAAAGGAAGTTAGCTGCAGG - Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1021072864 7:16264264-16264286 CAACAAATGAAACAATCTGCTGG + Intronic
1022065218 7:26848285-26848307 CAGGAAATGAAGTAATATACAGG + Intronic
1022535230 7:31094348-31094370 CAGGAGATGAGGCGAGCAGCGGG - Intronic
1023063740 7:36354200-36354222 CAGGACATACAGCAGGCTGCAGG - Intronic
1025050886 7:55733655-55733677 CAGGAAATGAAGTTACCTACGGG + Intergenic
1028874228 7:95802438-95802460 CTAGAAATAAGGCAAGCTGCTGG - Intronic
1030740423 7:113102733-113102755 CAGGAGATGAAGCAAGCATATGG - Intergenic
1031526648 7:122829653-122829675 CATGAAATGATGGAAGCTGATGG - Intronic
1031971584 7:128068620-128068642 CAGGAAATGAAACAAGTTCCTGG + Intronic
1032122416 7:129166912-129166934 GAGGAAATGAGGCAGGATGCTGG - Intronic
1033885628 7:145941511-145941533 GAGGAAAAGAACCAAGCTGGTGG + Intergenic
1034257215 7:149731239-149731261 CTGTAAATGGAGCCAGCTGCAGG - Intronic
1034452247 7:151143246-151143268 CAGGAAAGGAAGCGAGCACCCGG - Intronic
1035567695 8:652229-652251 CAGGAAATGCAGCCAGCAGGAGG + Intronic
1035983317 8:4397427-4397449 ATGGAAATGAAGAAAGCTTCGGG + Intronic
1037013500 8:13874482-13874504 GAGGAAAAGAAGCAAGCACCAGG - Intergenic
1038953124 8:32437554-32437576 CATGAAATGAAGGAAACTTCCGG - Intronic
1039355323 8:36809120-36809142 AAGGAAATGAAGCCAGTTACAGG + Intronic
1039523644 8:38194304-38194326 GAGCAAAAGAAGCAAGCTGCAGG - Intronic
1039839631 8:41284603-41284625 CAGCAAATGAAGTGACCTGCAGG + Intronic
1041704890 8:60836141-60836163 CAGGCAATGATCCAGGCTGCTGG + Exonic
1043406540 8:79940398-79940420 CAGGAAATGAAGTATGGTGAGGG + Intronic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1045921799 8:107538782-107538804 CAGGAAATGATGCCAGCTCTTGG + Intergenic
1048039281 8:130709957-130709979 CAGCAGATGAAGAAAACTGCAGG - Intergenic
1049388737 8:142357470-142357492 CAGGATTGGGAGCAAGCTGCTGG + Intronic
1050064440 9:1744106-1744128 TAGGAAAGAAAGCAAGCTGTAGG - Intergenic
1052904052 9:33817987-33818009 CAGGAACTGCAGAAAGCGGCGGG - Intronic
1052935118 9:34086646-34086668 CAGGGAATTAAGCAAAATGCTGG - Exonic
1055810049 9:80139669-80139691 CAGCACATGTAGCAAGCTCCTGG - Intergenic
1057858938 9:98624628-98624650 CAGCCAAGGAAGCAAGCTGCAGG + Intronic
1060346728 9:122823285-122823307 CAGTAGATGGAGCAAGCTTCAGG - Intronic
1060530037 9:124342613-124342635 AGGGAAATGTGGCAAGCTGCAGG - Intronic
1186290501 X:8092391-8092413 CAAGAAATGTAGCAGACTGCTGG - Intergenic
1186471141 X:9822932-9822954 CAGGAAATGAAGCAATTTGTTGG + Intronic
1187062029 X:15795754-15795776 TAGGAAGAGAAGCAAGCAGCAGG - Intronic
1189193883 X:39135433-39135455 AAGGAAATGAAGAAAGTAGCCGG - Intergenic
1189394033 X:40604026-40604048 CAGGAGATGAAGCTAGAAGCAGG - Intronic
1189915711 X:45853493-45853515 GAAGAAATGAAGCATGCTTCTGG - Intergenic
1190499649 X:51062167-51062189 CAGGAATTCAAGCAGGCTGTGGG + Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1190892806 X:54586134-54586156 AAGGAAATGAAGCATCCTGCTGG + Intergenic
1192454600 X:71266441-71266463 CAGCACATGAAGCAAGATTCTGG - Intergenic
1193621434 X:83756801-83756823 CAGGGAATGCCGCAAGTTGCTGG + Intergenic
1195026920 X:100886792-100886814 CAGGAATAGAAACTAGCTGCTGG - Intergenic
1196410351 X:115411921-115411943 GAGGGAATGAAGTAAGCAGCTGG - Intergenic
1196725126 X:118888653-118888675 TAGGAAATTAAGCAAGCTTATGG - Intergenic
1197974685 X:132154120-132154142 CAGGAAATGCAGGAAGCCTCTGG + Intergenic