ID: 1142008723

View in Genome Browser
Species Human (GRCh38)
Location 16:87702664-87702686
Sequence TCAGGGGAGCCACGCGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142008709_1142008723 20 Left 1142008709 16:87702621-87702643 CCCCAGAGCCCGGCGGAGAAAAA No data
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008708_1142008723 25 Left 1142008708 16:87702616-87702638 CCTGTCCCCAGAGCCCGGCGGAG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008711_1142008723 18 Left 1142008711 16:87702623-87702645 CCAGAGCCCGGCGGAGAAAAAAA 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008710_1142008723 19 Left 1142008710 16:87702622-87702644 CCCAGAGCCCGGCGGAGAAAAAA 0: 1
1: 0
2: 1
3: 4
4: 106
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008713_1142008723 11 Left 1142008713 16:87702630-87702652 CCGGCGGAGAAAAAAACCACAGG 0: 1
1: 0
2: 2
3: 9
4: 152
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008707_1142008723 26 Left 1142008707 16:87702615-87702637 CCCTGTCCCCAGAGCCCGGCGGA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008717_1142008723 -5 Left 1142008717 16:87702646-87702668 CCACAGGGGCCTCTCTGCTCAGG 0: 1
1: 1
2: 7
3: 42
4: 402
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1142008712_1142008723 12 Left 1142008712 16:87702629-87702651 CCCGGCGGAGAAAAAAACCACAG No data
Right 1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142008723 Original CRISPR TCAGGGGAGCCACGCGGAAG AGG Intronic
900678671 1:3904122-3904144 TGATGGGAGCCACGGGGGAGAGG + Intergenic
901120087 1:6884171-6884193 TGAGGGGAGCAAGGCTGAAGAGG + Intronic
920574488 1:207049237-207049259 TCAGGGAAGTTACGCTGAAGTGG + Exonic
922061117 1:222092954-222092976 TCAGGGGAGCCTCAGGAAAGAGG + Intergenic
924068838 1:240254817-240254839 TCAGGGGAGCCCCGGGGATGTGG + Intronic
1063959768 10:11297495-11297517 TCAGGGGAGCCAAGCAGGATGGG + Intronic
1069707410 10:70467454-70467476 TGAGGGGAGCCACTGAGAAGTGG + Intergenic
1069885675 10:71622159-71622181 TCTGGGGAGCCACGGTGAATCGG + Intronic
1070680751 10:78447506-78447528 TCAGGGGAGGCAAGGGGATGTGG + Intergenic
1075587504 10:123668141-123668163 CCAGGGGAGCCTCGGGGCAGAGG + Intronic
1075787580 10:125060644-125060666 GCAGGGCAGTCATGCGGAAGAGG + Intronic
1076003722 10:126931669-126931691 TCAGGGAAGCCATTCTGAAGCGG + Intronic
1077875544 11:6302023-6302045 TCAGGGAAGCAAGGAGGAAGGGG + Intergenic
1077896363 11:6456468-6456490 GCAGGGCACGCACGCGGAAGGGG + Exonic
1083704025 11:64500831-64500853 TCACGTGAGCAACGGGGAAGCGG + Intergenic
1089831020 11:121328407-121328429 TCAGGGGAGCGAGCAGGAAGTGG + Intergenic
1090066650 11:123509704-123509726 TCAGGGGAACCCTGAGGAAGGGG - Intergenic
1090205458 11:124881274-124881296 TCATGAGTGCCACGGGGAAGGGG + Exonic
1090665441 11:128912074-128912096 TCAGAGGAGACACAAGGAAGAGG - Exonic
1091207758 11:133833039-133833061 TCAGGGGAGCCTCGCGGGCGAGG + Intergenic
1091405748 12:208241-208263 TCAGGGGAGGCAAGATGAAGGGG - Intronic
1092325505 12:7527489-7527511 TGAGGGGAGCCCCTAGGAAGAGG - Intergenic
1097956922 12:65495700-65495722 TCAGGGCAGTCAAGAGGAAGTGG - Intergenic
1102361554 12:112292334-112292356 TCAGGGGAGCCTCTCTGAGGAGG - Intronic
1103715907 12:122945231-122945253 ACAGGGGAGCCAGGGGAAAGAGG - Intronic
1104038439 12:125114452-125114474 GCAGGGGAGACACGGGGGAGCGG - Intronic
1117842011 14:59870309-59870331 CCAGGAGAGCCGCGCAGAAGGGG + Intronic
1121314848 14:92954862-92954884 TGAGGGGAGCCACTTGGAAAGGG - Intronic
1122033220 14:98928673-98928695 TCAGGGAAGCCATGGGGCAGAGG - Intergenic
1122980692 14:105191235-105191257 TCAGAGGTGCCCCGGGGAAGGGG - Intergenic
1123632700 15:22272941-22272963 TCAGGGGAGCCATGTGGTGGAGG + Intergenic
1128314291 15:66650596-66650618 TCATGGGAGCCATGGGGAAGTGG + Intronic
1128607520 15:69047806-69047828 TGAGGGGAGGCAGGAGGAAGGGG - Intronic
1128992408 15:72272232-72272254 TCAGGGGAGCCCCGGAGAACAGG - Intronic
1132882059 16:2166828-2166850 TCAGGGAGACCATGCGGAAGTGG + Intronic
1133101237 16:3481453-3481475 TCAGGAAAGCCACCCGGAGGGGG - Intronic
1134116061 16:11549699-11549721 GCAGGGCATCCACGCAGAAGGGG + Exonic
1136141719 16:28292772-28292794 TCCGGCGAGCCTCGGGGAAGAGG + Exonic
1136270742 16:29146841-29146863 TCAGGGAAGTCACGCTGAAGTGG - Intergenic
1136382168 16:29900756-29900778 CCAGGGGAGCTAGGAGGAAGCGG + Exonic
1140252370 16:73305243-73305265 CCAGGGGAGCCTGGAGGAAGGGG + Intergenic
1141828396 16:86496465-86496487 TCAGGGCAGCCAGGCTGATGCGG - Intergenic
1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG + Intronic
1142074322 16:88108622-88108644 TCAGGGAAGTCACACTGAAGTGG - Intronic
1144269582 17:13602919-13602941 TCAGGGGAGGCAAGGGAAAGAGG - Intergenic
1145165759 17:20612548-20612570 TCAGGTGAGCGACGCGGGAGCGG + Intergenic
1148088205 17:45007026-45007048 TCAGAGGAGCCACGCGGGGGCGG - Intergenic
1150265075 17:63827111-63827133 GCAGGGGACGCAAGCGGAAGCGG - Exonic
1157359349 18:46963822-46963844 CCCGGGGAGCAACCCGGAAGAGG - Exonic
1157360344 18:46969749-46969771 CCCGGGGAGCAACCCGGAAGAGG - Intronic
1157360943 18:47023341-47023363 CCCGGGGAGCAACCCGGAAGAGG - Exonic
1157361933 18:47029256-47029278 CCCGGGGAGCAACCCGGAAGAGG - Exonic
1159949832 18:74474864-74474886 TCACGGGAACCACCTGGAAGGGG - Intergenic
1160017160 18:75153858-75153880 TCCTGGGAGCCATGCAGAAGGGG - Intergenic
1160805011 19:988782-988804 ACAGGGGCTCCACGCGGCAGTGG - Intronic
1160814390 19:1028500-1028522 TCAACTGAGCCACGGGGAAGCGG - Intronic
1162129225 19:8515259-8515281 TCAGGGAAGCCACTCTGAGGAGG + Intergenic
1162948523 19:14057508-14057530 TCCGGTGAGCCCCGCGGAGGAGG - Intronic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1164505773 19:28860101-28860123 TGAGGCCAGCCACACGGAAGAGG + Intergenic
1167144463 19:47673473-47673495 TCAGGGGAGCCCCCTGGAGGGGG - Intronic
1168315312 19:55482405-55482427 TCAGCAGTGCCACGTGGAAGAGG + Exonic
1168686337 19:58351592-58351614 TCAGGGGAGCCACGCAGGTGAGG + Exonic
934683743 2:96305574-96305596 TCTGGGGCGCGACCCGGAAGCGG - Intergenic
938119288 2:128622560-128622582 TCAAGAGAGCCAGGCAGAAGTGG + Intergenic
946038743 2:216765921-216765943 GCCGGGGAGCCAGGCGGGAGGGG + Intergenic
947705693 2:232273716-232273738 TCAGGGGAGCATGGTGGAAGGGG + Intronic
948423638 2:237875199-237875221 TCAGGGCAGCCTTGGGGAAGGGG - Intronic
948954795 2:241279959-241279981 GCAGTGGAGCCATGCTGAAGGGG + Intronic
1168826961 20:820239-820261 TCAGGGGGGCCCAGGGGAAGGGG + Intergenic
1169922029 20:10745257-10745279 TCAAGGGCCCCACACGGAAGTGG - Intergenic
1171409342 20:24935607-24935629 GCATGGGAGCCAAGCTGAAGAGG - Intergenic
1172627818 20:36358297-36358319 GCTGGGGAGCCACGAGGACGGGG - Intronic
1174397752 20:50258545-50258567 TGAGGGGAGCGAAGGGGAAGAGG - Intergenic
1175435535 20:58944943-58944965 TCACGGGAGCCACATGGAGGCGG - Intergenic
1176287914 21:5028596-5028618 TCAGGGGACACACGCCCAAGAGG - Intronic
1179869267 21:44234879-44234901 TCAGGGGACACACGCCCAAGAGG + Intronic
1182468602 22:30533130-30533152 CCAGGGCAGCCATGCGGGAGGGG - Intronic
1183063772 22:35350225-35350247 CCAGGGGAGCCAGGAGGGAGAGG - Intergenic
1183725451 22:39586736-39586758 GCAGGGGAGACACGCGGCAGAGG + Intronic
949504965 3:4719259-4719281 CCAGGGGAACAACGCAGAAGGGG - Intronic
953890516 3:46748916-46748938 TCAGGGGAGCCCAGAAGAAGTGG + Intronic
954200073 3:49018726-49018748 GCAGGTGGACCACGCGGAAGGGG - Intronic
961749266 3:129085949-129085971 TCAGGGAAGCCAGGAGGCAGGGG - Intergenic
961756131 3:129128336-129128358 TCAGGGAAGCCAGGAGGCAGGGG + Intronic
966866057 3:184259824-184259846 GCAGGGGAGCCGTGCGGGAGGGG + Exonic
969271936 4:6108808-6108830 TGAAGGGAGCCATGCGGCAGTGG + Intronic
969340002 4:6534746-6534768 CCAGGGCAGCCATGCGGAGGCGG - Intronic
972734420 4:41826751-41826773 TCAGAGGAGCCCTGCAGAAGTGG - Intergenic
982404208 4:155002315-155002337 TCAGGGGAGCACAGGGGAAGAGG - Intergenic
982792322 4:159607252-159607274 TGAGGGGAGCCAAGTGGATGTGG - Intergenic
983697025 4:170545119-170545141 TTAGGGAAGCCATGAGGAAGAGG + Intergenic
991522363 5:67515265-67515287 TCATGAGAGCCACGCTGAGGGGG + Intergenic
996355494 5:122591883-122591905 CCATGGGAGGCACGGGGAAGAGG - Intergenic
997363081 5:133307659-133307681 TCAGGAGACTCACGTGGAAGTGG + Intronic
997415828 5:133727846-133727868 TCAGGGGAGCCAAGAGCACGAGG + Intergenic
997734025 5:136200366-136200388 TCAGTGGACCCAGGCAGAAGGGG + Intergenic
1002473435 5:179451052-179451074 TCCGGGGAACCTGGCGGAAGAGG - Intergenic
1006502708 6:34468539-34468561 TCAGGGCAGCCAGGGGGCAGAGG - Intronic
1006802772 6:36769874-36769896 TCAAGGGTGCCAGGCAGAAGTGG + Intronic
1007059803 6:38927626-38927648 CCAGGGGAGCCAAGGGGAATGGG - Intronic
1011640408 6:89412103-89412125 TCAGCGGGGCCCGGCGGAAGCGG + Exonic
1014688831 6:124536041-124536063 TCCGTGGAGCCACGCAGAAGAGG + Intronic
1019346169 7:531763-531785 ACAGGGGAGCCACGAGGCGGAGG + Intergenic
1019481752 7:1270193-1270215 CCAGGGGAGCCCTGGGGAAGGGG - Intergenic
1023965894 7:44962914-44962936 TCAGGGCGGCCACGCGGCCGGGG + Intronic
1025115997 7:56258656-56258678 TCAGAGAAGCCACCCGGATGGGG + Intergenic
1029270597 7:99374814-99374836 TCAGGGGAGCCACCTGGAGGTGG + Intronic
1029473450 7:100768734-100768756 TCAGGGGAGCCAGGCAGGAGGGG + Intronic
1032394875 7:131582041-131582063 TCAGAGGAGCCAGGAGGGAGGGG - Intergenic
1032911605 7:136438252-136438274 TCAGAGGAGTCACCCTGAAGAGG + Intergenic
1033236940 7:139645665-139645687 TGAGGGGAGCCAGGTGGATGAGG + Intronic
1033603688 7:142909317-142909339 TCAGGGCAGCCACGTGTAAAAGG - Intronic
1034494189 7:151410230-151410252 TCAGGGGACCCAGGCGGCGGCGG - Intronic
1036703570 8:11030191-11030213 TATGTGGAGCCACGCGGAGGTGG - Intronic
1037963735 8:23117773-23117795 TCAGGGCAGCCATGAGGAAAAGG - Intergenic
1038005359 8:23425163-23425185 TCCGGAGAGCCACGCGCAAGTGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1049346833 8:142143698-142143720 TCAGAGGAGCCAGTGGGAAGGGG - Intergenic
1052806094 9:33014588-33014610 TCAGGGGAGCCGCCCTAAAGGGG + Intronic
1054765045 9:69036080-69036102 TCAGGGCGGCCCGGCGGAAGCGG + Intronic
1062346405 9:136117283-136117305 CCAGGGGAGGCCCCCGGAAGTGG + Intronic
1062686096 9:137814178-137814200 GCAGGGCAGCGACGCGGCAGTGG - Intronic
1199802168 X:151262211-151262233 TCACTGAAGCCATGCGGAAGGGG + Intergenic
1200078669 X:153564898-153564920 CTGGGGGAGCCACACGGAAGTGG - Intronic
1200184488 X:154173311-154173333 TCAGGGGAGCCACAGTGAGGAGG - Intergenic
1200190140 X:154210449-154210471 TCAGGGGAGCCACAGTGAGGAGG - Intergenic
1200195893 X:154248251-154248273 TCAGGGGAGCCACAGTGAGGAGG - Intergenic
1200201547 X:154285369-154285391 TCAGGGGAGCCACAGTGAGGAGG - Intronic
1200763840 Y:7063801-7063823 GCAGGAGAGGCACGGGGAAGTGG - Intronic