ID: 1142008972

View in Genome Browser
Species Human (GRCh38)
Location 16:87704251-87704273
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 3, 1: 0, 2: 2, 3: 5, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142008956_1142008972 27 Left 1142008956 16:87704201-87704223 CCTCGTCACCTGAACGACACGTG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1142008972 16:87704251-87704273 GGAGGGTCCTGAACGTCACGGGG 0: 3
1: 0
2: 2
3: 5
4: 61
1142008966_1142008972 -6 Left 1142008966 16:87704234-87704256 CCTGTGGAGAGCCCTGGGGAGGG 0: 1
1: 0
2: 9
3: 54
4: 445
Right 1142008972 16:87704251-87704273 GGAGGGTCCTGAACGTCACGGGG 0: 3
1: 0
2: 2
3: 5
4: 61
1142008959_1142008972 19 Left 1142008959 16:87704209-87704231 CCTGAACGACACGTGGAAGGAGG No data
Right 1142008972 16:87704251-87704273 GGAGGGTCCTGAACGTCACGGGG 0: 3
1: 0
2: 2
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910742401 1:90534241-90534263 TGAGGGTTCTGAAAGTCATGAGG - Intergenic
913189354 1:116400408-116400430 GGAGGGTCCTGAAGGTGGGGAGG + Intronic
917904261 1:179574059-179574081 GGAGGTTTCTGAAGCTCACGGGG - Intronic
920160039 1:203990294-203990316 GGTGTGTCCTGCAAGTCACGTGG - Intergenic
922767503 1:228163506-228163528 GGAGGGTCCAGAAGGGCAAGCGG + Intergenic
923789509 1:237100030-237100052 GGAGGGTCCTGGAAGGCAGGAGG - Intronic
1073097122 10:100986759-100986781 GCAGGATCCTGAACCTCTCGGGG + Exonic
1084830272 11:71763424-71763446 CAAGGGTGCTGAACGTCAAGAGG + Intergenic
1090272931 11:125400504-125400526 GGAGGGCCTTGAATGTCAGGTGG - Intronic
1090366592 11:126211705-126211727 GGTGGGCCCTGCAGGTCACGTGG + Exonic
1096537645 12:52285841-52285863 GGAGGGTCCCCAAAGTCACATGG - Intronic
1099849069 12:88069094-88069116 GGAGGGTCTTGTAGGTCAAGTGG - Intronic
1102141954 12:110622538-110622560 GCTGGGTCCTGAAGGACACGTGG + Intronic
1105277976 13:18947285-18947307 GGAGGGTCCAGACCCTCACATGG + Intergenic
1107358709 13:39595926-39595948 GGATGGTCCTGGACGTCCCTTGG - Intronic
1107835912 13:44412503-44412525 GGTGTGTCCACAACGTCACGTGG + Intergenic
1123142533 14:106094959-106094981 GGTGGTTCCTGAACGTCTCCTGG + Intergenic
1123716698 15:23039163-23039185 GACGCGTCCTGATCGTCACGGGG - Intronic
1124956037 15:34361055-34361077 GGAGAGTCATGAAGGTTACGTGG - Intronic
1132843626 16:1990240-1990262 GTAGGGGCCTGAAGGTCGCGAGG - Intronic
1141082122 16:81061724-81061746 GGAGGGCCCTGGAAGTCAGGGGG + Exonic
1141771106 16:86090109-86090131 GGAGGCTGCTGAAAGTCACCTGG - Intergenic
1141943750 16:87296187-87296209 TGAGGCTCCTGAAGCTCACGTGG + Intronic
1142008972 16:87704251-87704273 GGAGGGTCCTGAACGTCACGGGG + Intronic
1142008984 16:87704288-87704310 GGAGGGTCCTGAACCACACGGGG + Intronic
1142009003 16:87704337-87704359 GGAGGGTCTTGAATGTCACAGGG + Intronic
1142009013 16:87704374-87704396 GGAGGGTCCTGAACATGACAGGG + Intronic
1142009025 16:87704411-87704433 GGAGGGTCCTGAACGTCACGGGG + Intronic
1142009036 16:87704448-87704470 GGAGGGTCCTGAACATGACAGGG + Intronic
1142009048 16:87704485-87704507 GGAGGGTCCTGAACGTCACGGGG + Intronic
1142009068 16:87704535-87704557 GAGGGGTCCTGAACGTCACGGGG + Intronic
1147893512 17:43734328-43734350 GGGGGCTCCTGAATGTCACTGGG - Intergenic
1157289865 18:46401712-46401734 GGAGAAGCCTGAACCTCACGGGG - Intronic
1159328400 18:66954460-66954482 GGAGGGTGGAGAACGTCATGGGG - Intergenic
1161155557 19:2730601-2730623 GCAGTGTCCTGAACCTGACGTGG - Intronic
1163610995 19:18301476-18301498 GGGGTGTCCAGAACCTCACGGGG - Intergenic
1165736978 19:38183158-38183180 GGAGGGTCTTGAGGGCCACGTGG + Intronic
927678427 2:25123888-25123910 GGAGTTTCCTGAACATCAGGAGG + Intronic
937673521 2:124564223-124564245 GGAGGGTGCTGAAGGTGAGGAGG + Intronic
943537668 2:189172564-189172586 AGAGGGTCCTTAACCTCACTGGG - Intronic
1174081587 20:47973918-47973940 GGAGGGTCCTCAGCGTCCCCAGG + Intergenic
1178114079 21:29399075-29399097 GGATGGTCCTTAAAGTCATGAGG - Intronic
1180233448 21:46442118-46442140 GGAGGGTCCTGCACACCAGGCGG + Intronic
1182422210 22:30254086-30254108 GGAGGGTCCTGGAGGTCTAGGGG - Intergenic
1185086995 22:48746254-48746276 GGTGCTTCCTGAACGGCACGGGG - Intronic
968068124 3:195770255-195770277 GGTGGGCCCTAAAGGTCACGTGG - Exonic
969568789 4:7995918-7995940 GCAGGTTCCTGCACGTCTCGGGG - Intronic
970665261 4:18329397-18329419 GGAGGGTACTAAATGTCAGGTGG + Intergenic
974967020 4:68773424-68773446 TGAGGGTCCTGAACGTTAGAAGG - Intergenic
995240892 5:109884650-109884672 TGAGGGTCCTGAGCGCCACTCGG + Exonic
1000332367 5:160215880-160215902 GGAGGGTCATGAACTTGAGGTGG + Intronic
1002643136 5:180640106-180640128 GGAGGGTCCTGCACCTCCCCTGG + Intronic
1006836862 6:37004338-37004360 GGAGGGCCCTGAACGGCCTGTGG + Intergenic
1008349974 6:50478442-50478464 GGAGGGTCCTGACTGTCAGAAGG + Intergenic
1010215240 6:73395257-73395279 GGAGAGACCTGAACCTCACTAGG - Intronic
1015247161 6:131087247-131087269 TGAGGGTCCTGACTGTTACGAGG + Intergenic
1018407130 6:163498547-163498569 GGAGGGGCCTGAAAGTGAAGGGG - Intronic
1019713889 7:2529694-2529716 GGAGGGCCCTCACCGTCACGTGG + Intergenic
1032091525 7:128913945-128913967 GGAGTGTCCTGAGGGCCACGTGG - Intergenic
1033021703 7:137731786-137731808 GCAGGTTCCTGAAGGTCAAGTGG - Intronic
1034513384 7:151554003-151554025 GGATTGTCCTGAATGTCACCTGG - Intergenic
1035476893 7:159150026-159150048 GGAGGGTCCTGGGAGTGACGGGG + Intergenic
1036768515 8:11563827-11563849 GGGGGGCCCTGAGCGTCCCGCGG - Intronic
1038521167 8:28233398-28233420 GGAGGCTCAGGAACCTCACGGGG + Intergenic
1049474010 8:142788538-142788560 GGAGGGTCCGGGATGTCAGGTGG + Intergenic
1049726358 8:144148228-144148250 GGAGGGTCCTGGGTGTCGCGGGG + Intronic
1053196778 9:36125905-36125927 GGATGGTCTTGAAGGTCTCGTGG - Intergenic
1060124159 9:121025781-121025803 GAAGGGTCTTGAACATCACATGG + Intronic
1189273728 X:39769859-39769881 GGAGGGTCCTGGACCACACTTGG - Intergenic
1191748327 X:64513886-64513908 GGAGGGTCCTGACCGTTAGAAGG + Intergenic
1199743908 X:150759983-150760005 GCAGGGTCCTGAGCCTCACGGGG + Intronic