ID: 1142009068

View in Genome Browser
Species Human (GRCh38)
Location 16:87704535-87704557
Sequence GAGGGGTCCTGAACGTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142009061_1142009068 -5 Left 1142009061 16:87704517-87704539 CCTGGGGAGGGCCCTGGGGAGGG 0: 2
1: 3
2: 23
3: 165
4: 1036
Right 1142009068 16:87704535-87704557 GAGGGGTCCTGAACGTCACGGGG No data
1142009050_1142009068 20 Left 1142009050 16:87704492-87704514 CCTGAACGTCACGGGGAAGGAGG 0: 4
1: 1
2: 2
3: 9
4: 93
Right 1142009068 16:87704535-87704557 GAGGGGTCCTGAACGTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142009068 Original CRISPR GAGGGGTCCTGAACGTCACG GGG Intronic
No off target data available for this crispr