ID: 1142009244

View in Genome Browser
Species Human (GRCh38)
Location 16:87705367-87705389
Sequence CTCCCACGGTTCCACACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142009241_1142009244 -4 Left 1142009241 16:87705348-87705370 CCTGTGTTGTGTTCCGCGTCTCC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009237_1142009244 11 Left 1142009237 16:87705333-87705355 CCAGGAATCCACCACCCTGTGTT No data
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009236_1142009244 12 Left 1142009236 16:87705332-87705354 CCCAGGAATCCACCACCCTGTGT 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009240_1142009244 -3 Left 1142009240 16:87705347-87705369 CCCTGTGTTGTGTTCCGCGTCTC 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009235_1142009244 15 Left 1142009235 16:87705329-87705351 CCGCCCAGGAATCCACCACCCTG 0: 1
1: 0
2: 4
3: 25
4: 285
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009238_1142009244 3 Left 1142009238 16:87705341-87705363 CCACCACCCTGTGTTGTGTTCCG 0: 1
1: 0
2: 3
3: 11
4: 115
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1142009239_1142009244 0 Left 1142009239 16:87705344-87705366 CCACCCTGTGTTGTGTTCCGCGT 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142009244 Original CRISPR CTCCCACGGTTCCACACTGA AGG Intronic
905484829 1:38288168-38288190 TTCCCACGGTTACACAGTGATGG + Intergenic
908252091 1:62273549-62273571 CTCCCCTGGTTCCTCCCTGAGGG + Exonic
909140171 1:71854611-71854633 GACCCACAGTTCCACACTGCTGG + Intronic
913597462 1:120392698-120392720 GTCCCACCATTGCACACTGAGGG - Intergenic
914089868 1:144486616-144486638 GTCCCACCATTGCACACTGAGGG + Intergenic
914308742 1:146447600-146447622 GTCCCACCATTGCACACTGAGGG - Intergenic
914593367 1:149125531-149125553 GTCCCACCATTGCACACTGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
922813790 1:228434463-228434485 CTCAGGCTGTTCCACACTGATGG + Intergenic
923977674 1:239282396-239282418 CCCCAACAGTTCAACACTGAAGG - Intergenic
924438794 1:244069732-244069754 CTCCCATGGTGCCATATTGAAGG + Intergenic
1063346061 10:5313510-5313532 CTGCCACGGTACCCCAGTGAAGG - Intergenic
1064890648 10:20168443-20168465 CTCCTGTGGTTCCACTCTGAAGG - Intronic
1066622204 10:37368520-37368542 CTCCCACCCTTCCACACTTCTGG + Intronic
1067431856 10:46250482-46250504 CTCCCACAGTTCCAGGCTGGGGG + Intergenic
1069721395 10:70551738-70551760 CTTCCACTGTTCCCAACTGAGGG - Intronic
1069733207 10:70632572-70632594 CCCCATCGGTTCAACACTGAAGG + Intergenic
1070558105 10:77545706-77545728 CTCCCTTGGTTTCACACAGAGGG + Intronic
1071225081 10:83519657-83519679 CTGCCAAGGTTCCACACAGCAGG + Intergenic
1074040591 10:109784505-109784527 TCCCCACGATTCCACACTGCAGG - Intergenic
1076857215 10:133123296-133123318 CGCCCACTCTTCCTCACTGACGG + Intronic
1077911087 11:6571652-6571674 ATCCCACGGTTCCAGAGAGAGGG + Exonic
1081602328 11:44503864-44503886 CTCCCACGGTCCCAACCTGAGGG + Intergenic
1081797109 11:45828229-45828251 CTCCCAGAGTTCAACTCTGATGG - Intergenic
1092049340 12:5456702-5456724 CTCCCACGGTTCAGCACAGATGG + Intronic
1093971727 12:25382214-25382236 CTCCCACCGTGACACACTGGAGG + Intergenic
1102644819 12:114397028-114397050 ATCTCAGGGGTCCACACTGATGG - Intronic
1106759181 13:32850847-32850869 CTCCCACGGCTCAGCACTAAAGG - Intergenic
1112371333 13:98796343-98796365 CTTCCACTGTGCCAGACTGAAGG + Intronic
1117459789 14:55933994-55934016 CTCACAGGCTGCCACACTGAGGG - Intergenic
1117605997 14:57429965-57429987 CTCCCAGGGTGCCAACCTGATGG + Intergenic
1119431826 14:74573417-74573439 CTGCCACAGTTCCCCACTGATGG - Intronic
1121664370 14:95660677-95660699 CTCCCATGGTCCAACCCTGAGGG + Intergenic
1122745771 14:103896475-103896497 CTGCCATGGCCCCACACTGAGGG + Intergenic
1125311599 15:38385146-38385168 CTCCCTGGGTTCAACAGTGAAGG + Intergenic
1127642647 15:60930400-60930422 CTCCCACCGTCCCACATGGAAGG - Intronic
1130037114 15:80370869-80370891 CTCCAAGGGTTCCATCCTGAAGG + Intronic
1130808157 15:87348921-87348943 CACCCACGGTTACACAGTGATGG - Intergenic
1130914694 15:88295662-88295684 CTCCCTCAGTTCCTCACTGCAGG - Intergenic
1131648613 15:94374704-94374726 CTCCCTCTGTTTCACACTCATGG + Intronic
1132702840 16:1229414-1229436 CTCCCGCAGTTGCACCCTGAGGG + Exonic
1132705486 16:1241454-1241476 CTCCCGCAGTTGCACCCTGAGGG - Exonic
1132708614 16:1256817-1256839 CTCCCGCAGTTGCACCCTGAGGG - Exonic
1133546719 16:6814731-6814753 CCCCCAGGGTTCCAGACTGAAGG - Intronic
1133667329 16:7981742-7981764 CTCCCATGGTTCCAATCAGATGG + Intergenic
1141167466 16:81669933-81669955 CACCCGCGCTTCCACTCTGAAGG - Intronic
1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG + Intronic
1142056992 16:88004182-88004204 CTCCCAGGGACCCGCACTGAGGG - Intronic
1143803511 17:9405326-9405348 CCCCAAAGGTTCAACACTGAAGG - Intronic
1147788852 17:43000333-43000355 CTTCCACTGTTCCACCCTCAAGG + Intronic
1153059613 18:981860-981882 CTCCCATGGCTACACTCTGATGG + Intergenic
1154081157 18:11258611-11258633 CTCCCACTGTGCCACTCCGAGGG + Intergenic
1166203919 19:41256627-41256649 CTCCCATGGTTCCCCACTCTTGG - Intronic
931695997 2:64871014-64871036 CTCCCAGGGTACCAAACCGAAGG - Intergenic
933657806 2:84904167-84904189 TTCCCACTGTTCCAAACTGAAGG + Intronic
940368609 2:152876446-152876468 CTCCCACAGTTCCACAATCCAGG + Intergenic
943623934 2:190178889-190178911 ACCCCTGGGTTCCACACTGAGGG - Intronic
1168838846 20:895808-895830 CTCCAATGGTTCCATACTGTAGG + Intronic
1174395637 20:50245209-50245231 CTCCCACCCTTCCACACAAATGG + Intergenic
1178468599 21:32871488-32871510 CTACCAGCTTTCCACACTGAAGG + Intergenic
1184837792 22:47034233-47034255 CTCCAAGAGCTCCACACTGAGGG - Intronic
1185128170 22:49023169-49023191 CACCTGCCGTTCCACACTGACGG - Intergenic
1185254151 22:49822895-49822917 CTCCCAGGGTCCCACACTGCAGG + Intronic
949875539 3:8623942-8623964 ACCCCACGAGTCCACACTGACGG - Intronic
951843663 3:27062380-27062402 GTCCCACACTTCCACAATGAAGG - Intergenic
953373795 3:42411860-42411882 CTCCCACTGTTCCACCTAGAAGG - Intergenic
953412321 3:42697424-42697446 CCCCCACGGTGCCACAGTCAGGG - Intronic
954618528 3:51983026-51983048 CTCCAACGGCTCCCCACTGCAGG - Intronic
956531077 3:70219767-70219789 CTCCCACAGTTCAAAAGTGAAGG + Intergenic
967980038 3:195060204-195060226 TCCCCATGGATCCACACTGAGGG - Intergenic
967994231 3:195154621-195154643 CTCCCCCGGTTCTTCCCTGAGGG - Intronic
981077166 4:140603277-140603299 CTCCCACGGTGCCCCGCTAATGG + Intergenic
981088558 4:140708972-140708994 CTCCCACCATTCGACACTGAAGG - Intronic
985235654 4:187871180-187871202 GTCCCACTTTTCCACACTGCTGG + Intergenic
989774656 5:45189588-45189610 ATCCCAAGGTACCACACTAAGGG - Intergenic
990948072 5:61270539-61270561 TTCCCACAGTTCCACAGAGAAGG - Intergenic
1000046778 5:157528369-157528391 TTCCCACTGCTCCAGACTGAGGG + Intronic
1000997424 5:167973646-167973668 CTCTCACTGTTCCACCCAGATGG - Intronic
1004424561 6:15498529-15498551 CTCCCATGGGTCTAGACTGATGG - Intronic
1004971595 6:20916642-20916664 CTCCCAATTTTCCCCACTGAAGG - Intronic
1018055292 6:160047087-160047109 CTCCAAGGCTGCCACACTGAAGG - Intronic
1019324099 7:429568-429590 CTCCGAGGGGTCCAGACTGAGGG - Intergenic
1019622940 7:2001469-2001491 CCCCCACGGGCCCACACTGCGGG + Intronic
1020058531 7:5135311-5135333 CTTCCACTGTTCCACAATCATGG - Intergenic
1020728081 7:11841998-11842020 CTCCCATGGTTCCAGACTCCAGG - Intergenic
1021329243 7:19314454-19314476 CTCCTACGGTTCATCACAGAAGG - Intergenic
1024465434 7:49707172-49707194 CTTCCACTGCTCCACACTGTTGG - Intergenic
1028194998 7:87895827-87895849 CTCCCACAGTTCTGCCCTGAGGG - Intronic
1030209310 7:106980796-106980818 CAGCCACGGTTCCACTCTGAAGG - Intergenic
1035100994 7:156396498-156396520 GTCCCACGGTTACACACCCAAGG + Intergenic
1043514657 8:80984993-80985015 CTCCCAGGGCCCCAGACTGAAGG - Exonic
1054784774 9:69200264-69200286 CTCCCACAGCTCCATGCTGAAGG - Intronic
1056326882 9:85487528-85487550 CTCCCACAGTGCCACAGTGCTGG - Intergenic
1059667403 9:116461708-116461730 CACTCAGGGATCCACACTGATGG - Intronic
1060484188 9:124036859-124036881 CTCCCAGGGGGCCACAGTGATGG + Intergenic
1061728566 9:132595606-132595628 CCTCCAGGGTTCCACAGTGAAGG + Intronic
1061923835 9:133796509-133796531 CTCCCAGGAGTGCACACTGAAGG - Exonic
1062729611 9:138101732-138101754 CTCCCACGGTTCCAGACCAGGGG - Intronic
1191086756 X:56576374-56576396 CTCCCTCCCTTCCACACTAATGG + Intergenic
1199701961 X:150386447-150386469 CTCCATGGGTTCAACACTGAAGG - Intronic