ID: 1142009782

View in Genome Browser
Species Human (GRCh38)
Location 16:87707996-87708018
Sequence GCCGTGTTGAGTGAAGCTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142009782_1142009787 -9 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009787 16:87708010-87708032 CAACACGGCTGGGTCCTGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 152
1142009782_1142009793 27 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009793 16:87708046-87708068 ACTTGCCAGGCGCCCCTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 127
1142009782_1142009791 14 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009791 16:87708033-87708055 ACGTGGGCACAGCACTTGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1142009782_1142009794 28 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009794 16:87708047-87708069 CTTGCCAGGCGCCCCTGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 208
1142009782_1142009795 29 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009795 16:87708048-87708070 TTGCCAGGCGCCCCTGGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 180
1142009782_1142009788 -3 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009788 16:87708016-87708038 GGCTGGGTCCTGGGCGGACGTGG 0: 1
1: 0
2: 3
3: 24
4: 310
1142009782_1142009792 23 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009792 16:87708042-87708064 CAGCACTTGCCAGGCGCCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 234
1142009782_1142009789 -2 Left 1142009782 16:87707996-87708018 CCAAGAGCTTCACTCAACACGGC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1142009789 16:87708017-87708039 GCTGGGTCCTGGGCGGACGTGGG 0: 1
1: 0
2: 2
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142009782 Original CRISPR GCCGTGTTGAGTGAAGCTCT TGG (reversed) Exonic