ID: 1142012234

View in Genome Browser
Species Human (GRCh38)
Location 16:87721459-87721481
Sequence GGCCACAGGTCTGCGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142012231_1142012234 -8 Left 1142012231 16:87721444-87721466 CCCAGAAACAGGTGTGGCCACAG 0: 1
1: 0
2: 1
3: 34
4: 257
Right 1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
1142012232_1142012234 -9 Left 1142012232 16:87721445-87721467 CCAGAAACAGGTGTGGCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 220
Right 1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142012234 Original CRISPR GGCCACAGGTCTGCGTGTGC TGG Intronic
900114410 1:1022354-1022376 GGCCACAGGTATGGGGGTGCAGG - Exonic
900343176 1:2198316-2198338 GCCCACCGGTCTGCAGGTGCGGG - Intronic
900948194 1:5843192-5843214 GGCCACAGATCCCCATGTGCTGG + Intergenic
902726170 1:18337664-18337686 CCCCAAAGGTCTGCGTGTCCTGG + Intronic
902918653 1:19653646-19653668 GGAAACAGGTCTGAGTGTCCCGG + Intronic
904009060 1:27379739-27379761 GGCCACAGGCTTGCCTGGGCTGG + Exonic
904972297 1:34428433-34428455 ATCCACAGGTGTGTGTGTGCTGG + Intergenic
905990840 1:42335542-42335564 GGCCCCAGGTATCCGTGGGCAGG - Intronic
906116938 1:43363472-43363494 GGCCAAAGGTCAGGGTGGGCGGG - Exonic
911440485 1:97920703-97920725 AGCCACAGGCCCGCGTGGGCAGG - Intronic
918041774 1:180918025-180918047 GTCCACTGGTCTGCTGGTGCAGG - Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
923091407 1:230743877-230743899 CGCCACAGGCCTGAGTGTGGAGG + Intergenic
1065455375 10:25901658-25901680 GGCCACACCTCTGCTGGTGCAGG + Intergenic
1069490830 10:68859016-68859038 GGCCCCAGGTCTCTGTGGGCAGG - Intronic
1071547053 10:86536884-86536906 GGCCACAGGTCTGTGGCTGTCGG - Intergenic
1071602283 10:86964230-86964252 GGCCACTGGCCAGCGTGTCCTGG + Intronic
1073214939 10:101830919-101830941 TGCCCCAGGCCTGCGTGTGTGGG - Intronic
1077130852 11:971734-971756 GGCCACGCGTCTGAGTGTTCCGG - Intronic
1077166208 11:1140410-1140432 GGCCACAGCTCTGCCTCTGCTGG - Intergenic
1077219725 11:1410642-1410664 GGCCACAGGTGTGCCTGGGTGGG - Intronic
1077320074 11:1937144-1937166 GGCCACAGGCCTGCGCATGCTGG - Intronic
1077375316 11:2202883-2202905 GGCCACAGGGCTGGGTGGGTGGG - Intergenic
1077390064 11:2296708-2296730 GGCCACAGGGCTCCATGGGCTGG + Intronic
1079847434 11:25489095-25489117 GCCCTCAAGTCTGCGTGTGGCGG - Intergenic
1084437589 11:69153266-69153288 GGCCACAGGCCTTCGTGGGGTGG + Intergenic
1084747635 11:71183405-71183427 GGCCACAGGGCTGCAGCTGCTGG + Intronic
1087167821 11:95022370-95022392 GCCCTCATGTCTGCGTGTGGTGG - Intergenic
1091049234 11:132352608-132352630 GGACACAGGCCTGGGGGTGCAGG - Intergenic
1095778440 12:46033983-46034005 GCCCTCATGTCTGCGTGTGGTGG + Intergenic
1104083962 12:125457844-125457866 GGCCACAGGTGTACATGTCCAGG + Intronic
1104573541 12:129946037-129946059 GGCCACACGTCTCCGAATGCAGG - Intergenic
1104963996 12:132500962-132500984 GGCCACAGGACAGGGTGTGAGGG - Intronic
1105008776 12:132740395-132740417 GGCCACAAGTCACTGTGTGCTGG + Intronic
1108611039 13:52083971-52083993 GGACAGAGGACTGTGTGTGCTGG - Intronic
1113694120 13:112331867-112331889 GGCCCCAGGTCTGAGTGCACAGG + Intergenic
1114737444 14:25057078-25057100 GGCCACACATCTGGCTGTGCAGG - Intergenic
1118708688 14:68502422-68502444 GGCAACAGGGCTGCCTTTGCAGG + Intronic
1119674133 14:76541090-76541112 TGCCACATCTCTGAGTGTGCAGG + Intergenic
1126174938 15:45727526-45727548 GGCCACAGGTTTACCTGTGATGG - Intergenic
1126661564 15:51038400-51038422 GGCCCCAGGGCAGCGTATGCTGG + Intergenic
1129144563 15:73634748-73634770 GGCTACAGGGCTGCCTGTGGTGG + Intergenic
1130283830 15:82539830-82539852 GGCTAGAGCTCTGCGTGTGCAGG - Intronic
1130507188 15:84556195-84556217 TGCCAGAGGTCAGAGTGTGCAGG - Intergenic
1132179087 15:99738194-99738216 GGCGGCATGTCTGCTTGTGCAGG - Intergenic
1132284929 15:100655820-100655842 TGCCACTGGCCTGTGTGTGCAGG - Intergenic
1132854190 16:2037470-2037492 GTGCACATGTGTGCGTGTGCAGG + Intronic
1133382815 16:5345416-5345438 GGCCACATGTCTGCATGGGTGGG - Intergenic
1134431269 16:14209140-14209162 GGCCACGTGCCTGCGTCTGCAGG + Intronic
1134678274 16:16105547-16105569 GGACACAGTTCTGGGGGTGCAGG + Intronic
1138423251 16:56913426-56913448 GTCCACAGCTCTGAGTGTGTGGG + Exonic
1140282318 16:73566039-73566061 TGCCACAGCTCTGCATGAGCAGG - Intergenic
1141163944 16:81647916-81647938 GGCTACGGCTCTGCGGGTGCGGG - Intronic
1141163956 16:81647948-81647970 GGCTACGGCTCTGCGGGTGCGGG - Intronic
1141163980 16:81648012-81648034 GGCTACGGCTCTGCGGGTGCGGG - Intronic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1142365013 16:89645595-89645617 CACCACAGGTCTATGTGTGCTGG - Exonic
1142409598 16:89909001-89909023 GGTCACAGCTCTGCGTTTGCAGG + Intronic
1142434672 16:90048383-90048405 AGCCATAGAACTGCGTGTGCCGG + Intergenic
1143720172 17:8803716-8803738 TGCCACAGGTCAGCCTGTGTGGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1146970204 17:37066161-37066183 GGCCGCAGGTGTGTGTGTCCGGG + Intergenic
1147219346 17:38919423-38919445 CGCTGCAGGTCTGCGTGGGCAGG - Exonic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1150705982 17:67487753-67487775 GGCCACTGGTCTGAGGGTGGGGG + Intronic
1150896167 17:69213395-69213417 GGCGACAGGTTTGCGGGTGGGGG + Intronic
1151190702 17:72395792-72395814 TGTCACAGGCCTGGGTGTGCAGG - Intergenic
1152600025 17:81257637-81257659 GGCCACAGTTCTGTGTGCTCAGG - Intronic
1152656582 17:81522701-81522723 GCCCACAGGTCTGCAGGTGGCGG - Intronic
1153957857 18:10113405-10113427 GGCCACAAGGTTGCGTGTGTGGG - Intergenic
1155494586 18:26430007-26430029 GGCCACAGCTCTGCCAGTGATGG - Intergenic
1160837029 19:1129639-1129661 GGCCACAGGTCAGCGTGACCAGG - Intronic
1160846417 19:1168112-1168134 AGCCACAAGTCTGCGTTTGAGGG + Intronic
1161314450 19:3611351-3611373 GGCCTCAGTGCTGCCTGTGCGGG + Exonic
1162698326 19:12494967-12494989 GGTCACAGTTCTGAGTGTCCTGG + Intronic
1163520223 19:17787724-17787746 AGCCACGGGGCTGGGTGTGCTGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1166805691 19:45485653-45485675 GGCCAGAGGGCTGCGGGGGCTGG + Exonic
1166997063 19:46724686-46724708 GGCCTCAGGAGTGCGTGTGACGG - Intronic
1167018307 19:46856308-46856330 GGGACCAGGTCTGCGTGTGACGG - Intergenic
1167092273 19:47352835-47352857 GGCCAGAGGCCTGCTTGAGCTGG - Exonic
1167666284 19:50824157-50824179 GGCACCAGGTCTGGGGGTGCAGG - Intergenic
927434028 2:23051995-23052017 TGACACAGGTCTGAGTGTGTTGG + Intergenic
928949757 2:36804303-36804325 GGGCACAGGTCTGGTTGGGCAGG - Intronic
930958613 2:57232520-57232542 GCCCTCAGGTCTGCGTGCGGCGG + Intergenic
936091118 2:109501949-109501971 AGCCACAGGCCTGCCTGCGCCGG - Intronic
936241473 2:110791907-110791929 GGCTTCAGGTCTGGGTGTGCAGG + Intronic
938647944 2:133350703-133350725 AGCCACAGGTCTGTGTAGGCAGG - Intronic
940362586 2:152812732-152812754 GGCCCCAGGGCTGTGTGTGCTGG + Intergenic
942249732 2:174037590-174037612 GACCCCAGATCTGCCTGTGCGGG + Intergenic
945889160 2:215409935-215409957 GGTCACAGGTGTGCTGGTGCTGG + Exonic
948629992 2:239296135-239296157 GGCTCCAGGTCAGCCTGTGCAGG - Intronic
948835221 2:240623103-240623125 GGCCGCGGGGCTGCGAGTGCCGG - Intronic
1168998914 20:2152548-2152570 GGTCACAGCTCTGGGTGTGTGGG + Intronic
1171252992 20:23663510-23663532 GCACACAGGCCTGTGTGTGCTGG + Intergenic
1172885398 20:38227659-38227681 GGCCACAGGGTTGGGTGTGGAGG + Intronic
1173335852 20:42111995-42112017 GACCACAGGCCTGGGGGTGCAGG + Intronic
1173646257 20:44634962-44634984 GAACACAGGTCTGCGGGGGCAGG + Intronic
1174444676 20:50582634-50582656 GGCGACAGCTCTGCAGGTGCGGG + Intronic
1175720873 20:61286286-61286308 GTCCAGAGGAGTGCGTGTGCTGG + Intronic
1175889733 20:62310815-62310837 GCCCCCAGGTCTCCGTGCGCTGG - Exonic
1180854379 22:19036924-19036946 GGCCTCAGAACTGTGTGTGCGGG - Exonic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183530717 22:38351898-38351920 GGCCACTGGGCTGTGTATGCAGG + Intronic
950111533 3:10421768-10421790 AGCCACGGGTCTGCATGTGCCGG + Intronic
953979827 3:47408014-47408036 GGCCCCAGGGCTGCCTATGCTGG + Intronic
954467742 3:50666470-50666492 GGACGCTGGTCTGAGTGTGCAGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960037294 3:113114610-113114632 GGTCACAGGGCTGCCTCTGCAGG + Intergenic
961347555 3:126274040-126274062 GCCCACAGGGCTGGGTGTGGGGG - Intergenic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
961712499 3:128838415-128838437 GCCCTCATGTCTGCGTGTGGCGG - Intergenic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
964100945 3:152988000-152988022 GGACAAAGGTCTGCATGTGGTGG + Intergenic
965070567 3:163911374-163911396 GCCCTCAAGTCTGCGTGTGGTGG + Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
968501463 4:952072-952094 GGCCGCTAGTCTGAGTGTGCGGG + Intronic
968869504 4:3234516-3234538 GGCCAAAGCCCTGCCTGTGCTGG + Intronic
969605704 4:8201359-8201381 GGCCCCACGTCTCCGTGTTCTGG + Intronic
975342711 4:73259092-73259114 GGCTGCAGGGCTGTGTGTGCGGG - Intergenic
980528079 4:134015795-134015817 GCCCTCAAGTCTGCGTGTGGCGG + Intergenic
984219159 4:176952321-176952343 GGCCACAGGCTGGCGTGGGCAGG - Intergenic
985500086 5:237859-237881 GACGCCAGCTCTGCGTGTGCTGG - Intronic
985577693 5:681390-681412 GGGCACAGGCCTGGGAGTGCAGG - Intronic
985577704 5:681429-681451 GGGCACAGGCCTGGGAGTGCTGG - Intronic
985589295 5:756449-756471 TGGCACAGGGCTGTGTGTGCAGG - Intronic
985592625 5:773527-773549 GGGCACAGGCCTGGGAGTGCAGG - Intergenic
985737309 5:1591849-1591871 GACGCCAGCTCTGCGTGTGCTGG + Intergenic
985836929 5:2278365-2278387 GGCTACAGGGCTGCAGGTGCAGG - Intergenic
994125882 5:96168967-96168989 GCCCTCATGTCTGCGTGTGGTGG - Intergenic
995540263 5:113178845-113178867 GACCACAGCTCTGTGTTTGCAGG - Intronic
996195109 5:120595653-120595675 GTTCACAGGTGTGCGTGTGCAGG - Intronic
998396156 5:141819690-141819712 TGAGACAGGTCTGCTTGTGCAGG - Intergenic
998423777 5:142010444-142010466 GGCCACAGGGCCGGGTGTGGTGG - Intronic
999430574 5:151521891-151521913 GGCTATAGGTCAGCGTGTCCTGG + Exonic
1001203469 5:169740640-169740662 GGCCACAGAGGTGCCTGTGCAGG - Intronic
1001204989 5:169754058-169754080 GGCCAGAAGTCTGAGTGTACTGG + Intronic
1004131138 6:12921345-12921367 GGGCACAGGGCTGAGTGTGCAGG + Intronic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006728267 6:36215686-36215708 GGCCTCAGGCCTGGGTGTGTGGG + Intronic
1007608436 6:43132728-43132750 GAACACAGGTCTGGGTGTGATGG + Intronic
1010380214 6:75215479-75215501 GTCCACAGGTCAGTGAGTGCAGG + Intergenic
1017565678 6:155683262-155683284 GGTTACAGGTCTGGATGTGCAGG - Intergenic
1017717397 6:157222409-157222431 GGCCACAGGGCTGGGAGTGAGGG - Intergenic
1017764663 6:157596775-157596797 TGCCGCAGGTCTGTCTGTGCTGG - Intronic
1019130557 6:169869966-169869988 GGCCACAGATCTGCTTCTGGAGG + Intergenic
1019274742 7:170049-170071 AGCCACCGGGCTGGGTGTGCAGG - Intergenic
1019414244 7:920099-920121 GGCCAGAGAGCGGCGTGTGCTGG - Intronic
1024658286 7:51470812-51470834 GGCCAGACTTCTGAGTGTGCAGG + Intergenic
1027649423 7:80847031-80847053 CCCCACAAGTCTGAGTGTGCTGG + Intronic
1032584694 7:133135366-133135388 GGCCCCAGGTCTCCTTATGCAGG + Intergenic
1033084916 7:138332494-138332516 GCCCTCATGTCTGCGTGTGGTGG + Intergenic
1035343002 7:158176542-158176564 GAGCACAGGTCTGGGTGTGGAGG + Intronic
1035704803 8:1667420-1667442 GGCCACAGGTGAGCGTGGCCTGG + Intronic
1036090289 8:5657779-5657801 GGCCATAGCTCTGCGAGTTCTGG + Intergenic
1040284320 8:46092193-46092215 GGCCACAGGTCGGTCTGTGCTGG + Intergenic
1040284715 8:46093893-46093915 GGCCGCAGGTGGGCCTGTGCAGG + Intergenic
1040284872 8:46094550-46094572 GGCCACAGGTGGGCCTGTGCAGG + Intergenic
1040287786 8:46109318-46109340 GGCCACAGGTTGTCGTGGGCAGG - Intergenic
1040287882 8:46109735-46109757 GGCCACAGGGTGGCGTGGGCAGG - Intergenic
1040289781 8:46118346-46118368 GGCCACAGGGTGGCGTGTGCAGG - Intergenic
1040295257 8:46145709-46145731 GGCCACAGGTTTGCGTGGGTGGG - Intergenic
1040295897 8:46148932-46148954 GGCCACAGGGTGGCGTGGGCTGG - Intergenic
1040296620 8:46152264-46152286 GGCCACAGGTTAGCCTGTGCAGG - Intergenic
1040307060 8:46217557-46217579 GGCCTCAGGTTGGCGTGGGCGGG + Intergenic
1040315803 8:46260270-46260292 GGCCACAGGGTGGCGTGGGCGGG + Intergenic
1040318606 8:46277743-46277765 GGCATCAGGTGGGCGTGTGCAGG - Intergenic
1040324290 8:46333884-46333906 GGCCACAGGGTGGCGTGTTCAGG + Intergenic
1040324693 8:46335760-46335782 AGCCACAGGGTGGCGTGTGCGGG + Intergenic
1040329591 8:46379068-46379090 GGCCACAGGGTGGCGTGGGCGGG + Intergenic
1040331790 8:46389370-46389392 GGCCACAGGATGGCGTGAGCAGG + Intergenic
1040332965 8:46401638-46401660 GGCCACAGGCAGGCCTGTGCGGG - Intergenic
1040338531 8:46428289-46428311 GGCCACAGGGTGGCGTGGGCTGG + Intergenic
1042050104 8:64694532-64694554 GGCCTCGGGACTGCCTGTGCTGG + Intronic
1043837950 8:85066599-85066621 GCCCTCAAGTCTGCGTGTGGTGG + Intergenic
1047489718 8:125364516-125364538 GGCCAGAGCTCTGTGTGGGCAGG + Intronic
1048469133 8:134691484-134691506 GGCCACAGGGCAGCTTGTTCTGG + Intronic
1049175948 8:141192825-141192847 GCCCACAGGTCACCATGTGCTGG + Intronic
1049420890 8:142516146-142516168 GGCCCCAGGTGTGCGTGTGTGGG + Intronic
1049509472 8:143020118-143020140 GGCCCCAGGTCTCCATGTGAGGG + Intronic
1049636227 8:143690998-143691020 GCCCACAGGTCTGGGTGGGAAGG - Intronic
1050296975 9:4215278-4215300 GGCCACAGTTTTGCCTGTGAGGG + Intronic
1052971869 9:34381511-34381533 GGCGATAGGTCTGGGTGTTCTGG - Intronic
1056083500 9:83122144-83122166 GGCCACGGATGTGGGTGTGCTGG - Intergenic
1056713610 9:89010727-89010749 GGCCACATCTCTGCCTGGGCAGG - Intergenic
1057277103 9:93681797-93681819 GACCACAGGACAGCGTGTGGGGG + Intergenic
1058703441 9:107619846-107619868 GGCCACAGGTGAGCCTGAGCGGG + Intergenic
1060107982 9:120886285-120886307 GGCCCCAGGCATGTGTGTGCAGG + Intronic
1060593724 9:124835288-124835310 GGCTCCAGGTCTGGGTGTACGGG + Intergenic
1061408614 9:130406161-130406183 AGTCACAGGTCTGGGTCTGCTGG + Intronic
1062306367 9:135908962-135908984 GGCCACAGTTCTGACTGTGCAGG - Intergenic
1062392038 9:136337733-136337755 GGCCAGAGATCTGTGTGTCCGGG - Intronic
1190054950 X:47175932-47175954 GGCCCCAGGGCTGCCTCTGCCGG - Intronic
1190244887 X:48684467-48684489 GGACACAGATCTGGGTTTGCGGG - Intronic
1191256585 X:58282164-58282186 GGCCACATGTCTCCGTCTCCTGG + Intergenic
1196811911 X:119635654-119635676 GGCCACAAGTCTGCGATTCCTGG + Intronic