ID: 1142013133

View in Genome Browser
Species Human (GRCh38)
Location 16:87727150-87727172
Sequence GACGCAATCTACCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142013127_1142013133 25 Left 1142013127 16:87727102-87727124 CCTGCAACGAGCCAGAGACGCCA 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG No data
1142013129_1142013133 14 Left 1142013129 16:87727113-87727135 CCAGAGACGCCAGTCAGGTCTCC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG No data
1142013131_1142013133 -7 Left 1142013131 16:87727134-87727156 CCTCAAACTCAATCTTGACGCAA 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG No data
1142013126_1142013133 26 Left 1142013126 16:87727101-87727123 CCCTGCAACGAGCCAGAGACGCC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG No data
1142013130_1142013133 5 Left 1142013130 16:87727122-87727144 CCAGTCAGGTCTCCTCAAACTCA 0: 1
1: 0
2: 2
3: 17
4: 162
Right 1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142013133 Original CRISPR GACGCAATCTACCTGGAGAC AGG Intronic
No off target data available for this crispr