ID: 1142018543

View in Genome Browser
Species Human (GRCh38)
Location 16:87765708-87765730
Sequence CCCGTAACCCCGGGGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142018528_1142018543 16 Left 1142018528 16:87765669-87765691 CCAGCTCTCCCGCAGGGCCGGCG 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142018533_1142018543 -1 Left 1142018533 16:87765686-87765708 CCGGCGCGGCTCCCACGGCCGAC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142018526_1142018543 19 Left 1142018526 16:87765666-87765688 CCTCCAGCTCTCCCGCAGGGCCG 0: 1
1: 0
2: 5
3: 9
4: 291
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142018523_1142018543 26 Left 1142018523 16:87765659-87765681 CCTACGGCCTCCAGCTCTCCCGC 0: 1
1: 0
2: 2
3: 14
4: 264
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142018530_1142018543 8 Left 1142018530 16:87765677-87765699 CCCGCAGGGCCGGCGCGGCTCCC 0: 1
1: 0
2: 2
3: 34
4: 262
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1142018531_1142018543 7 Left 1142018531 16:87765678-87765700 CCGCAGGGCCGGCGCGGCTCCCA 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142018543 Original CRISPR CCCGTAACCCCGGGGGGCGC AGG Intronic
903522344 1:23960085-23960107 CGGGTAACCCGGGCGGGCGCGGG + Intronic
903819136 1:26087778-26087800 CCCTTGACCCCGGGGGGCGGAGG + Intergenic
905886696 1:41495636-41495658 CCCGTATCACCGGAGGGTGCTGG + Intergenic
906195563 1:43928514-43928536 CCCTTGAACCCGGGGGGCGGAGG + Intronic
908534895 1:65067603-65067625 CCCGGGACCCCCGGGGGCGCAGG - Intergenic
915325740 1:155080460-155080482 CCAAGAACTCCGGGGGGCGCTGG + Intronic
915345517 1:155195120-155195142 CCCGGGAACCCGGGGCGCGCTGG - Intergenic
915585299 1:156840959-156840981 CCCGGAATGCCGGGGGGCCCGGG - Exonic
916742636 1:167659858-167659880 CCTGTAACCCTGGGAGGCCCTGG - Intronic
917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG + Intergenic
919830980 1:201539861-201539883 CCCGCACCCCCGGGATGCGCCGG + Intergenic
919924024 1:202183051-202183073 CCCGTCACCCAGGGGAGGGCAGG + Intergenic
922696946 1:227735605-227735627 CCCGCATCCCCGGGGGGTGGGGG + Intronic
924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG + Intronic
1063731079 10:8697913-8697935 CACTTAACCCCGGGAGGCGGAGG - Intergenic
1065189241 10:23195228-23195250 ACCGTAGCCCCGTGCGGCGCAGG + Intergenic
1075693640 10:124418427-124418449 CCCGGAACCCCGGGGCGCCTCGG + Intronic
1075736503 10:124667656-124667678 CCTGTGACCCCGGGCGGGGCTGG - Intronic
1076748567 10:132527988-132528010 CCCATGGCCCCGGGGGGCGGGGG - Intergenic
1078616456 11:12870559-12870581 GCCCCAACCCCGGGGGGGGCGGG - Intronic
1080655347 11:34253590-34253612 CCCTTGACCCCGGGAGGCGGAGG + Intronic
1082029653 11:47594934-47594956 CCCCTCACCCCGGGGAACGCAGG - Intergenic
1083595403 11:63916465-63916487 CCAGCTGCCCCGGGGGGCGCAGG + Exonic
1092695887 12:11171180-11171202 CGCGTAGCCCCGGGCGCCGCTGG - Intronic
1093736221 12:22623973-22623995 CCCTTAAACCCGGGAGGCGGAGG + Intergenic
1096771635 12:53939250-53939272 GCCGTAGCCCAGGGTGGCGCTGG - Exonic
1097233306 12:57524977-57524999 CCGGTGACCCCGGGTGGGGCTGG + Exonic
1097267752 12:57755609-57755631 GCCGCAACCCCGGGGGGGCCGGG + Exonic
1102197133 12:111033924-111033946 CCCCGACCCCCGGAGGGCGCGGG - Intergenic
1102587751 12:113934954-113934976 CCCAGCACCCCGGGGGGCCCAGG - Intronic
1110212297 13:72987944-72987966 CACATAAACCCGGGGGGCGGAGG - Intronic
1113654917 13:112061885-112061907 CCCGTAGCTCCGTGGGGCGGAGG + Intergenic
1113820600 13:113209718-113209740 CCCGCCAAGCCGGGGGGCGCGGG + Exonic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1121546965 14:94769813-94769835 CCCGTGGCCCCCGGCGGCGCGGG - Exonic
1122321177 14:100856722-100856744 CGCGTACCCCCGGGGGGTCCAGG - Intergenic
1122419318 14:101565110-101565132 CCAGGAAGCCCAGGGGGCGCAGG - Intergenic
1127922746 15:63505382-63505404 CTCGAAACCCCGAGAGGCGCTGG + Intronic
1132554835 16:567887-567909 CCCGGGACCCCGGGGGCCACTGG + Exonic
1134614888 16:15643256-15643278 CTGGGAACCCCGGGGGGGGCGGG + Exonic
1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG + Intronic
1142161188 16:88558562-88558584 CCCGGAGCACCGGGGGACGCGGG - Intergenic
1142355560 16:89600015-89600037 CCCCTAACCCCGTGGGTCACTGG + Intergenic
1142413081 16:89926033-89926055 GCAGTCACCCCGGGGGGGGCAGG + Intronic
1143061968 17:4209382-4209404 CACGTAAACCCGGGAGGCGGAGG - Intronic
1143150880 17:4807189-4807211 TCCGGAACCCCCGCGGGCGCTGG + Exonic
1143199556 17:5102885-5102907 GCCGTAAGCCCTGGGGGCGAGGG - Intergenic
1144784457 17:17823914-17823936 CCAGTAACCCCGGCAGACGCTGG - Intronic
1145969998 17:28950999-28951021 CCCCCAACCCCGGGGGGAGGGGG + Exonic
1146053002 17:29567442-29567464 CCCGGGACCCCGTGGGGCGGCGG + Intronic
1146275313 17:31512496-31512518 CCCTTCACCCCGGGGTCCGCTGG + Intronic
1150457642 17:65320521-65320543 CGCTTAAACCCGGGGGGCGAAGG - Intergenic
1152382865 17:79951335-79951357 CCCGTAAGCCCCCGGGGCCCGGG + Intronic
1152541924 17:80981149-80981171 CCGGAAACCCGCGGGGGCGCGGG - Intergenic
1152710934 17:81870329-81870351 CCCGTTACCCCGTAGGGCGAGGG - Intronic
1152781429 17:82228863-82228885 CCCGCAACCCCGCCGGGCCCAGG - Intronic
1154246392 18:12703006-12703028 CCCGGAGCCTCGCGGGGCGCGGG - Exonic
1154270117 18:12911622-12911644 CCCGCCACCCCGGGGTCCGCTGG - Intronic
1160886900 19:1354458-1354480 CCCAAGACCCCGGGGGGCACCGG - Intergenic
1162032538 19:7923688-7923710 CCCCAAACCCCTGGGGGTGCTGG + Intergenic
1162094490 19:8302516-8302538 CCAGTAACCCCAGTGGGCGGAGG + Exonic
1162900733 19:13794355-13794377 CACTTGACCCCGGGAGGCGCAGG + Intergenic
1163012158 19:14433230-14433252 CCCGCAGCCCCGGGGGCCTCTGG + Intronic
1164228632 19:23268232-23268254 CCCTTGAACCCGGGAGGCGCAGG + Intergenic
1164243602 19:23411231-23411253 CCCTTAAACCTGGGAGGCGCAGG + Intergenic
1168367954 19:55805621-55805643 CGCTTAAACCCGGGAGGCGCAGG - Intronic
927356341 2:22177740-22177762 CCCTTAAACCCGGGAGGCGGAGG + Intergenic
931339328 2:61383625-61383647 CCCCCACCCCCGGGGGGGGCGGG + Intronic
932758891 2:74426726-74426748 CCTGTAGCCCCAGGGGGCCCAGG - Intronic
938266966 2:129934509-129934531 CCCGTGCCCCCAGGAGGCGCGGG - Intergenic
940214431 2:151289669-151289691 GCCGGAACCCCGGGAGGCACTGG + Exonic
941906093 2:170716802-170716824 CCCGGAACCCCGGAGGCCCCCGG - Exonic
947353744 2:229271628-229271650 ACCGTAGCCCCGGGGGTCCCGGG + Intergenic
1173210710 20:41029323-41029345 CCCGTCCTCCCCGGGGGCGCAGG + Intronic
1173813704 20:45971776-45971798 CCTGCAACCCGGGGGGACGCGGG - Intronic
1174591321 20:51647465-51647487 CCCTTAAACCCGGGAGGCGGAGG + Intronic
1176184551 20:63771226-63771248 CCCTGAGCCCCGGGGGCCGCCGG - Intronic
1176194511 20:63831096-63831118 CCTGTGACCCCATGGGGCGCGGG + Intronic
1179810059 21:43864867-43864889 GCCGGGACCGCGGGGGGCGCGGG - Intergenic
1180064611 21:45405974-45405996 CCCGACACCACGGCGGGCGCGGG - Intronic
952788116 3:37176125-37176147 CCCATAGCCCCAGCGGGCGCCGG - Intronic
954218421 3:49137448-49137470 CGCTTGAACCCGGGGGGCGCAGG + Intergenic
959929434 3:111962843-111962865 CCCTTAAACCCGGGAGGCGGAGG + Intronic
964771254 3:160225993-160226015 CCCGGGCCTCCGGGGGGCGCCGG + Exonic
968503129 4:960357-960379 CCCGTGTCCCGGGTGGGCGCAGG - Exonic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
985293686 4:188412159-188412181 CCCGTGACCCCGCGCGGCCCAGG - Intergenic
995733000 5:115265459-115265481 CCCGGAGGCCCGGGGGGCTCTGG - Intergenic
1006750825 6:36375791-36375813 CAAGTACCCCCGGGGGGCCCAGG - Intronic
1011429584 6:87271205-87271227 CCCTTAAACCCGGGAGGCGGAGG - Intergenic
1013322511 6:109009165-109009187 CCCCTTCCCCCGAGGGGCGCAGG + Intronic
1019367210 7:640077-640099 CACTTAAACCCGGGAGGCGCAGG + Intronic
1022923411 7:35037656-35037678 CGCGGAACGCCGGGGGGCGGGGG + Intronic
1029649680 7:101882805-101882827 CCAGTGACCCCAGAGGGCGCCGG - Intronic
1032842802 7:135727364-135727386 CCCAGACCCCCGGTGGGCGCAGG + Intronic
1034902199 7:154914622-154914644 CCCGTCCCCCCGGGGGGCCTGGG + Intergenic
1047523505 8:125613664-125613686 CCCGACACCCCGGGGAGCCCAGG + Intergenic
1048063945 8:130948927-130948949 CCCGAAACCCCCGGAGCCGCGGG + Intronic
1049789644 8:144466764-144466786 CCCGCAAGCCCCGGGGTCGCCGG + Exonic
1053306161 9:36986148-36986170 TCCGGGGCCCCGGGGGGCGCGGG - Intronic
1055501459 9:76906226-76906248 CCAGGAGCCCCGGGGCGCGCCGG + Intergenic
1059176640 9:112174894-112174916 CCCGCGACGCCGGGGGACGCCGG - Intronic
1060811582 9:126613784-126613806 CGCGGAGCCCCGGGGCGCGCGGG + Intergenic
1062111011 9:134782133-134782155 CCAGTAACCCAGGGGTGCGCGGG + Intronic
1062565712 9:137163089-137163111 CCGGGCACCCCGGAGGGCGCGGG + Intronic
1190881460 X:54495401-54495423 CACCGAGCCCCGGGGGGCGCCGG - Exonic
1194977327 X:100408701-100408723 CCCGTGGCCCCGGAGGCCGCGGG + Exonic
1196675957 X:118420334-118420356 CCCTTGAACCCGGGAGGCGCAGG - Intronic
1198807297 X:140504741-140504763 CCCGCAGCCCCGGGAGGCGCAGG - Exonic
1199772581 X:150983991-150984013 CCGGTGGCCCGGGGGGGCGCGGG + Intronic