ID: 1142018839

View in Genome Browser
Species Human (GRCh38)
Location 16:87767184-87767206
Sequence ATTTTAAATGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142018839_1142018847 4 Left 1142018839 16:87767184-87767206 CCTTCCACCTTCCCATTTAAAAT No data
Right 1142018847 16:87767211-87767233 CAGACACTGTTAGGTACTAAGGG No data
1142018839_1142018848 29 Left 1142018839 16:87767184-87767206 CCTTCCACCTTCCCATTTAAAAT No data
Right 1142018848 16:87767236-87767258 TGTCCTCAAATGTCCTAACATGG No data
1142018839_1142018846 3 Left 1142018839 16:87767184-87767206 CCTTCCACCTTCCCATTTAAAAT No data
Right 1142018846 16:87767210-87767232 CCAGACACTGTTAGGTACTAAGG No data
1142018839_1142018844 -5 Left 1142018839 16:87767184-87767206 CCTTCCACCTTCCCATTTAAAAT No data
Right 1142018844 16:87767202-87767224 AAAATGTGCCAGACACTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142018839 Original CRISPR ATTTTAAATGGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr