ID: 1142023939

View in Genome Browser
Species Human (GRCh38)
Location 16:87802218-87802240
Sequence CAGTGTGTGCAGATGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142023939_1142023944 8 Left 1142023939 16:87802218-87802240 CCATCTGCCATCTGCACACACTG No data
Right 1142023944 16:87802249-87802271 GGGTCCCCAAGCTCCTGCCACGG No data
1142023939_1142023949 24 Left 1142023939 16:87802218-87802240 CCATCTGCCATCTGCACACACTG No data
Right 1142023949 16:87802265-87802287 GCCACGGCACTTCTGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142023939 Original CRISPR CAGTGTGTGCAGATGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr