ID: 1142024763

View in Genome Browser
Species Human (GRCh38)
Location 16:87806539-87806561
Sequence CTCCCTTTGCAGCCGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142024747_1142024763 18 Left 1142024747 16:87806498-87806520 CCAGGTAAAGCTGCAGCCGGGCC No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data
1142024744_1142024763 29 Left 1142024744 16:87806487-87806509 CCAACATACAGCCAGGTAAAGCT No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data
1142024753_1142024763 -7 Left 1142024753 16:87806523-87806545 CCGGCACCCCAGGCCCCTCCCTT No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data
1142024751_1142024763 -3 Left 1142024751 16:87806519-87806541 CCTCCCGGCACCCCAGGCCCCTC No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data
1142024750_1142024763 2 Left 1142024750 16:87806514-87806536 CCGGGCCTCCCGGCACCCCAGGC No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data
1142024752_1142024763 -6 Left 1142024752 16:87806522-87806544 CCCGGCACCCCAGGCCCCTCCCT No data
Right 1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142024763 Original CRISPR CTCCCTTTGCAGCCGGGGCA CGG Intergenic
No off target data available for this crispr