ID: 1142024952

View in Genome Browser
Species Human (GRCh38)
Location 16:87807382-87807404
Sequence CCAGCCATGCAGGGCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142024943_1142024952 28 Left 1142024943 16:87807331-87807353 CCTCACAGGGACGATGGGAGCCA No data
Right 1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG No data
1142024947_1142024952 -4 Left 1142024947 16:87807363-87807385 CCAGCGTTTCGAGATAACGCCAG No data
Right 1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG No data
1142024946_1142024952 8 Left 1142024946 16:87807351-87807373 CCAGGATGGCTGCCAGCGTTTCG No data
Right 1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142024952 Original CRISPR CCAGCCATGCAGGGCCTGGA AGG Intergenic
No off target data available for this crispr