ID: 1142027546

View in Genome Browser
Species Human (GRCh38)
Location 16:87822692-87822714
Sequence CTCTGGGGCTCTTCGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142027546_1142027551 -6 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027551 16:87822709-87822731 CCAGAGCGTGCAACCTCTCCGGG No data
1142027546_1142027555 4 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027555 16:87822719-87822741 CAACCTCTCCGGGGGAGTCTGGG No data
1142027546_1142027553 -4 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027553 16:87822711-87822733 AGAGCGTGCAACCTCTCCGGGGG No data
1142027546_1142027549 -7 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027549 16:87822708-87822730 CCCAGAGCGTGCAACCTCTCCGG No data
1142027546_1142027554 3 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027554 16:87822718-87822740 GCAACCTCTCCGGGGGAGTCTGG No data
1142027546_1142027552 -5 Left 1142027546 16:87822692-87822714 CCTGGAGACGAAGAGCCCCAGAG No data
Right 1142027552 16:87822710-87822732 CAGAGCGTGCAACCTCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142027546 Original CRISPR CTCTGGGGCTCTTCGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr