ID: 1142027839

View in Genome Browser
Species Human (GRCh38)
Location 16:87824019-87824041
Sequence AAGGCTGCCCAGAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142027831_1142027839 10 Left 1142027831 16:87823986-87824008 CCTTCTTAGAGCAAGTGAATTAG No data
Right 1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG No data
1142027830_1142027839 21 Left 1142027830 16:87823975-87823997 CCTAGAATGCTCCTTCTTAGAGC No data
Right 1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142027839 Original CRISPR AAGGCTGCCCAGAATGGGGT AGG Intergenic
No off target data available for this crispr