ID: 1142028521

View in Genome Browser
Species Human (GRCh38)
Location 16:87827089-87827111
Sequence CCGGGAAGGTTCCTGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142028521_1142028532 -4 Left 1142028521 16:87827089-87827111 CCTGTCTTCAGGAACCTTCCCGG No data
Right 1142028532 16:87827108-87827130 CCGGGGTGGGGGTGCACCCATGG No data
1142028521_1142028533 -3 Left 1142028521 16:87827089-87827111 CCTGTCTTCAGGAACCTTCCCGG No data
Right 1142028533 16:87827109-87827131 CGGGGTGGGGGTGCACCCATGGG No data
1142028521_1142028536 29 Left 1142028521 16:87827089-87827111 CCTGTCTTCAGGAACCTTCCCGG No data
Right 1142028536 16:87827141-87827163 GAACGCTAACACCAGCACTGCGG No data
1142028521_1142028537 30 Left 1142028521 16:87827089-87827111 CCTGTCTTCAGGAACCTTCCCGG No data
Right 1142028537 16:87827142-87827164 AACGCTAACACCAGCACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142028521 Original CRISPR CCGGGAAGGTTCCTGAAGAC AGG (reversed) Intergenic