ID: 1142028809

View in Genome Browser
Species Human (GRCh38)
Location 16:87828363-87828385
Sequence ACTCAGAGATGCCCCCACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142028809_1142028816 28 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028816 16:87828414-87828436 CTCTGCACAAGCAGAACACAGGG No data
1142028809_1142028817 29 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028817 16:87828415-87828437 TCTGCACAAGCAGAACACAGGGG No data
1142028809_1142028815 27 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028815 16:87828413-87828435 TCTCTGCACAAGCAGAACACAGG No data
1142028809_1142028811 -4 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028811 16:87828382-87828404 GAGTCTCCCTCAAGTCACATGGG No data
1142028809_1142028810 -5 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028810 16:87828381-87828403 TGAGTCTCCCTCAAGTCACATGG No data
1142028809_1142028813 2 Left 1142028809 16:87828363-87828385 CCGGGGTGGGGGCATCTCTGAGT No data
Right 1142028813 16:87828388-87828410 CCCTCAAGTCACATGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142028809 Original CRISPR ACTCAGAGATGCCCCCACCC CGG (reversed) Intergenic
No off target data available for this crispr