ID: 1142029573

View in Genome Browser
Species Human (GRCh38)
Location 16:87831812-87831834
Sequence CTCTGCAGGCGGGTGGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029573 Original CRISPR CTCTGCAGGCGGGTGGGGAC TGG Exonic
900152620 1:1185286-1185308 CTTTGCTGGCTGCTGGGGACAGG - Intronic
900187478 1:1339150-1339172 CTGTGCAGGGAGTTGGGGACAGG + Intronic
900269267 1:1778731-1778753 CGCGGCAGGTGAGTGGGGACGGG - Intronic
900555816 1:3279787-3279809 GCCTGCGGGGGGGTGGGGACAGG + Intronic
900573714 1:3372807-3372829 CTCTGGAGGAGGGTGGGATCTGG - Intronic
900798489 1:4723704-4723726 CTCTGCAGGGGTTTGGGGAAAGG + Intronic
901436022 1:9247942-9247964 CTCACCTGGCGGCTGGGGACTGG - Intronic
902225946 1:14996549-14996571 CACTGCAGGCAGGTGTGGTCAGG - Intronic
902395901 1:16132438-16132460 GTCTGTAGGGGGGTGGGCACAGG + Exonic
902645868 1:17797550-17797572 CTCTGCAGGCGGACAGGGCCAGG + Intronic
902920762 1:19665063-19665085 CCCTGCTGCCGGGTGGGGAGGGG + Intergenic
904295365 1:29516785-29516807 CACTGCAGCCTGGTGGGGGCAGG + Intergenic
904614854 1:31744154-31744176 CCCTGCAGGCAGGTGGGGTGGGG + Intronic
905366683 1:37455399-37455421 CCCTGCAGGCGGCTGGGCAGAGG - Intergenic
906507948 1:46394121-46394143 CCGAGCAGGCGGGTGGGGAAGGG - Intergenic
907451022 1:54545921-54545943 GTCTGCAGGGTGGTGGGGAGGGG + Intronic
913110754 1:115655157-115655179 CTCTGCTGGCTGCTGGGGCCCGG - Intronic
913259161 1:116982861-116982883 CTCTGGAGGGGGGAGGGTACAGG + Intronic
914845481 1:151281582-151281604 CTCTGCGGGAGGGCGTGGACGGG - Exonic
915128758 1:153682908-153682930 CTCTGCAAGCGAGCAGGGACAGG + Intronic
915341653 1:155179769-155179791 CGCTGCCAGCGGGTGGGGCCTGG - Exonic
915579892 1:156807258-156807280 GTCTCCAGGCGGGTGGGGGCTGG + Exonic
915587045 1:156849484-156849506 CTCTGCGGGGAGGTGGGGGCAGG + Intronic
918209433 1:182338004-182338026 GTCTGCAGGCGTGTGGGGTGTGG - Intergenic
919855405 1:201703078-201703100 ATCTGCAGGCAAATGGGGACGGG - Intronic
921265394 1:213417180-213417202 CTCTGGAAGCGGTTGGGGCCCGG - Intergenic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
922336670 1:224623841-224623863 ATCTGCCAGGGGGTGGGGACGGG - Intronic
922616656 1:226964881-226964903 CTCTGGAGGTGGGAGGGGGCGGG + Intronic
922784970 1:228278211-228278233 CTCTGCAGACAGGTGGGGTGGGG + Intronic
922804095 1:228376891-228376913 GGCTGCAGGCGGGTGGGGCCAGG + Intronic
922894251 1:229088267-229088289 CTGTGCAGGCGGCTGGCGGCAGG + Intergenic
923163451 1:231337629-231337651 CGCAGCAGTCGGATGGGGACCGG - Exonic
1064004609 10:11690079-11690101 ATCTCCAGGCGGGTGAGGAAAGG - Intergenic
1065023439 10:21518971-21518993 CTCTGCTGGGGGGTGGGGTGGGG + Exonic
1067225818 10:44375075-44375097 CGCAGGAGGCGGGAGGGGACAGG + Intronic
1069551546 10:69367699-69367721 CTCTGCAGGCCTGCGGGGCCTGG + Intronic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1069818640 10:71214104-71214126 CTCCGGAGCCAGGTGGGGACGGG + Intronic
1069859802 10:71463362-71463384 CTTGGCAGCCGGGTGCGGACAGG - Intronic
1070064155 10:73017334-73017356 CTCTGGTGGGGGGTGGGGAGGGG - Intronic
1070866488 10:79710478-79710500 CTCTGCTCGCCGGTGGGGCCGGG - Exonic
1071633398 10:87232699-87232721 CTCTGCTCGCCGGTGGGGCCGGG - Exonic
1071646847 10:87364917-87364939 CTCTGCTCGCCGGTGGGGCCGGG - Exonic
1072537620 10:96375250-96375272 CACTGCATGTGGGTGGCGACAGG - Intronic
1072722382 10:97789015-97789037 CTCTGCAGGAGGGTGGGAGCAGG - Intergenic
1073694785 10:105852483-105852505 GTCTGTTGGGGGGTGGGGACTGG + Intergenic
1075646543 10:124100563-124100585 CTCTGAAGGCAGGAGGGGGCCGG + Intergenic
1075728938 10:124624974-124624996 CCCAGCAGATGGGTGGGGACTGG + Intronic
1076173357 10:128341862-128341884 CCAGGCATGCGGGTGGGGACAGG - Intergenic
1076424989 10:130361420-130361442 CTCTGCAGGAGGTTAGGGACAGG + Intergenic
1076433233 10:130422213-130422235 CTCTGCTGGGGGCTGGGGACAGG - Intergenic
1076686529 10:132200682-132200704 CTGTGCAGGGGAGCGGGGACTGG - Intronic
1076696154 10:132248373-132248395 CCCTGCAGTGGGGAGGGGACAGG + Intronic
1076781887 10:132729011-132729033 CTCAGCAGGCGTGGGGGGCCTGG + Intronic
1076781905 10:132729071-132729093 CTCAGCAGGCGTGGGGGGCCTGG + Intronic
1077063313 11:627021-627043 CACTGGGGGCGGGTGGGGCCCGG + Intronic
1077078725 11:713137-713159 CTCTCCAGCCAGGTGGGGGCCGG + Intronic
1077192006 11:1259504-1259526 ACCTGCAGGCTGCTGGGGACAGG + Intronic
1077540514 11:3144517-3144539 CTCTGCAGGGGAGTGCGGGCTGG + Intronic
1079158347 11:17969694-17969716 GTCTGCTGCCTGGTGGGGACAGG + Intronic
1081228012 11:40548853-40548875 CTTTGCAAGCAGGTGGGTACAGG - Intronic
1082081918 11:48018925-48018947 CTCTGCAGGCTGGTGGGGAGGGG + Intronic
1085326784 11:75612448-75612470 CTCTGAAGGGGAGTGAGGACTGG + Intronic
1085450528 11:76629552-76629574 CTCTGCCTGGGGCTGGGGACAGG - Intergenic
1087211977 11:95454011-95454033 CTCTCCTGACTGGTGGGGACAGG + Intergenic
1089252790 11:117177201-117177223 ATCTGCCGGGGGGTGGAGACAGG - Intergenic
1090355974 11:126140560-126140582 CTCTCCTGGCGGGTGGGGAATGG + Intergenic
1092089984 12:5796689-5796711 CACTGCAGCCGGGTGGAGGCAGG + Intronic
1092119048 12:6031138-6031160 CTCTAGAGTAGGGTGGGGACTGG - Intronic
1093110223 12:15143076-15143098 CTCTGCTGGAGGATGGGGGCTGG + Intronic
1095889669 12:47223685-47223707 CTTTGCAGGAGGGTGGGAAGCGG + Intronic
1095976196 12:47942501-47942523 CCCTGCAGGCGGGAGGGGTGTGG - Intronic
1097863903 12:64543457-64543479 GTGGGCAGGCGGGTGGGGAGCGG - Intergenic
1100044010 12:90356622-90356644 TTCTGGAGGCTGGTGGCGACAGG - Intergenic
1100330545 12:93577771-93577793 CTGTGCAGGTGGGCGGGGAGGGG + Intronic
1101874490 12:108589539-108589561 CCCTGCAGGTGGTTGAGGACTGG - Intergenic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1103960073 12:124603882-124603904 CTCTGGCAGCTGGTGGGGACTGG + Intergenic
1103986202 12:124769051-124769073 CACTGCTGGAGGTTGGGGACTGG - Intergenic
1104328931 12:127826158-127826180 CTCTGCAGGCAGCAGAGGACTGG - Intergenic
1104404810 12:128508532-128508554 CTCTGCACACAGCTGGGGACAGG - Intronic
1105239603 13:18598074-18598096 AGCTGCAGGAGGGTGGGAACCGG - Intergenic
1105271170 13:18875959-18875981 CACTGCAGGTGGGTGGGGGGCGG - Intergenic
1106561102 13:30846982-30847004 CTCTGCAGGAGGACGGGGAAGGG + Intergenic
1106815749 13:33405125-33405147 GTGTGCAGTGGGGTGGGGACAGG - Intergenic
1111232562 13:85363126-85363148 CTCTGCTGGCGGGGGGGGTGTGG + Intergenic
1112356127 13:98676093-98676115 GCCTGCAGGCGGGAGGGGTCGGG - Intergenic
1113649810 13:112027383-112027405 CCCAGGAGTCGGGTGGGGACAGG + Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1113906153 13:113820123-113820145 CTGTGCAGGAGGGTGGGGACGGG + Intergenic
1114645978 14:24256334-24256356 CTCTGCTGGAGGATGGGGGCAGG + Intronic
1117824595 14:59688299-59688321 CTCTGCATGGTGGTGGGGAGTGG - Intronic
1118820158 14:69339855-69339877 TTCTGCAGGCAGCTGTGGACAGG - Intronic
1119601474 14:75979807-75979829 CCCTCCAGGCCGGTGGGCACGGG - Intronic
1119622276 14:76139986-76140008 ATCTGCAGTCAGCTGGGGACTGG - Intergenic
1119756479 14:77123694-77123716 CTCTAAAGGAGGGTGAGGACTGG - Intronic
1120939823 14:89936963-89936985 CTCTGGAGGCGGGGTGGGAGGGG - Intronic
1121661317 14:95637304-95637326 CTCTGCAGTCTAGTGGGGAATGG + Intergenic
1121720933 14:96108263-96108285 CAGTGGAGGCAGGTGGGGACAGG - Intergenic
1122032886 14:98926473-98926495 CTCTGCAGGGGTCTGAGGACAGG + Intergenic
1122060879 14:99136058-99136080 CTCTGCAGGCGAGTGGTCCCTGG + Intergenic
1122158155 14:99763548-99763570 CTCTGAGGGCTGGTGGGGCCTGG - Intronic
1122400452 14:101464453-101464475 CCCTGCATGCAGGTGAGGACTGG + Intergenic
1122953845 14:105060883-105060905 CTCTGCCTGCGGCTGGGGCCCGG - Intronic
1122972053 14:105156333-105156355 GGCTGCAGGTGGGTGGGCACAGG - Intronic
1123038641 14:105481509-105481531 CTCTGCCTGGGGTTGGGGACTGG - Intergenic
1123707940 15:22964233-22964255 CTCTGCATGGGGGTGGGGTAGGG - Intronic
1123989154 15:25670409-25670431 CTCTGCAGGGGCTTGGGGAGAGG - Intergenic
1124965267 15:34428782-34428804 CTCTGCAGCAGGGTGGGGTCTGG - Intronic
1124981883 15:34574992-34575014 CTCTGCAGCAGGGTGGGGTCTGG - Intronic
1126088464 15:45030805-45030827 CTCTCCAGCCTGGTGAGGACAGG + Intronic
1126799145 15:52284431-52284453 CTCTGAGGGTGGGTGGGGCCAGG + Intronic
1130141764 15:81231847-81231869 CTATGCAGTGGGGTGAGGACAGG - Intronic
1131050312 15:89343323-89343345 CTCTGGAGGTTGGTGGGGTCTGG + Intergenic
1131150998 15:90047105-90047127 TTCTGGGGGTGGGTGGGGACAGG + Intronic
1132043805 15:98547827-98547849 CTCTGGAGGCGGGGTGGGGCCGG + Intergenic
1132252183 15:100342054-100342076 CTCGGAAGGCGGGAGGGGATTGG + Intergenic
1132503957 16:297580-297602 CTCTGCTGGAGGGAGTGGACTGG - Intronic
1132710199 16:1263014-1263036 CATTGCAGGAGGGTGGGGCCCGG - Intergenic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1133993204 16:10726769-10726791 CTCTGCAGGCTGGAGGTGTCTGG + Intergenic
1134223987 16:12377490-12377512 AACTGCAGGTGGGTGGGGAGGGG + Intronic
1134507900 16:14823022-14823044 CTCAGCAGGCTGGTGGCGGCAGG + Intronic
1134695601 16:16221785-16221807 CTCAGCAGGCTGGTGGCGGCAGG + Exonic
1134976228 16:18572901-18572923 CTCAGCAGGCTGGTGGCGGCAGG - Intergenic
1135132215 16:19862257-19862279 CTCTGCAGGCCGCGGGTGACAGG + Intronic
1136039765 16:27568952-27568974 CTCTTCAGGTGGGAGGGGAGTGG - Intronic
1137057336 16:35752013-35752035 GTGTGCAGGCGGGTGGGAAAGGG - Intergenic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1139422054 16:66854932-66854954 GTGTCCAGGCGGGAGGGGACAGG + Intronic
1140038547 16:71389973-71389995 CTCTGCAGGCAGGTGTGTGCAGG - Exonic
1140213633 16:72990154-72990176 AACTGCAGGAGGGTGGGGAAGGG + Intronic
1140244457 16:73235494-73235516 CTCTTCAGGCTGGTGTGCACAGG - Intergenic
1141592985 16:85081032-85081054 CGCTGCAGGCAGGAGGGCACTGG - Intronic
1141644575 16:85360358-85360380 CCCTGCGGCCGGGTGGGGGCAGG + Intergenic
1141665151 16:85462098-85462120 CTCTGCAGGGCTGTGGGCACCGG + Intergenic
1141717500 16:85735226-85735248 CTCTGCAGGCCTGTGGAGAGAGG + Exonic
1141828556 16:86497324-86497346 CTCGGCAGGCGGGCGAGCACGGG - Intergenic
1141964538 16:87432920-87432942 CTCTGCAGGCGGGAAGGGTGGGG - Intronic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1142129737 16:88427250-88427272 CTCTCCATGCGGGTGTGGCCGGG - Intergenic
1142343431 16:89538512-89538534 CTCCGCAGGCGGGGAGGGGCCGG + Intronic
1142638294 17:1271012-1271034 CCCTGCAGGCGGCGGGGGGCTGG - Exonic
1142805488 17:2369123-2369145 ATCAGCAGGCGGTTGGGGAGAGG + Intronic
1142811352 17:2397012-2397034 CTCTGCAGGAGGGCGGGGCTGGG - Intronic
1142920931 17:3184966-3184988 CCCTGCAGGCTGGTGTGGCCAGG - Intergenic
1143037362 17:4007093-4007115 CTCTGCAGGCCTGTGGGGGAGGG - Intronic
1143560015 17:7688181-7688203 CTCTGCAGGCGGCGGGGGGGCGG + Exonic
1143615060 17:8044808-8044830 CTCTGCAGGGGGTGGGGGACAGG - Exonic
1143789736 17:9285032-9285054 ATCTCCAGGGGGGTGGGGCCTGG - Intronic
1144544187 17:16177431-16177453 CTGAGCAGGAGGGTGGGGAATGG - Intronic
1144703449 17:17352850-17352872 GTCTGCAGGGGGGTTGGGAAGGG - Intergenic
1144732666 17:17537494-17537516 CCCTGCAGGCTGCTGGGCACGGG - Intronic
1144951912 17:18998930-18998952 CTCTGGAGGAGGGCTGGGACGGG - Intronic
1146845519 17:36179389-36179411 CTCTGCAGCAGGGTGGGGGTAGG - Intronic
1146873735 17:36391230-36391252 CTCTGCAGCAGGGTGGGGGTAGG - Intronic
1146881093 17:36442320-36442342 CTCTGCAGCAGGGTGGGGGTAGG - Intergenic
1147065654 17:37921641-37921663 CTCTGCAGCAGGGTGGGGGTAGG + Intergenic
1147115641 17:38297242-38297264 CTCGGCAGGTGGGTAGGGACGGG + Exonic
1147338104 17:39738991-39739013 CTCTGCAGTGCGGTGGGGCCTGG + Intronic
1147614565 17:41820485-41820507 CTGGGCAGGTGGGTGGGCACAGG + Intronic
1148414041 17:47492379-47492401 CTCGGCAGGTGGGTAGGGACGGG - Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148556032 17:48578925-48578947 CTCTGCAGCTGGATGGGGAAGGG + Exonic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1148993672 17:51688681-51688703 TTCTGCAGGCAGATGGGGAAAGG - Intronic
1151596113 17:75078836-75078858 CTCTGAAGGTTGGTGGGGGCGGG + Intergenic
1151718837 17:75844593-75844615 CTCTGTAGGAGGGTGGGGCGGGG - Exonic
1152042667 17:77914593-77914615 CTTAGCAGGCAAGTGGGGACTGG + Intergenic
1152073262 17:78144528-78144550 TGCTGAAGGCGGGTGGGGAAGGG - Intergenic
1152117842 17:78399575-78399597 CTCTGCAGGCTGGAGGGCAGTGG + Intronic
1152633460 17:81420904-81420926 CCATGCACGCGGGTGGGGACAGG + Intronic
1152686499 17:81696249-81696271 CTCTGCAGAAGGTTGGGCACAGG + Intronic
1154329492 18:13418106-13418128 CTCAGAGGGCGGGTGGGGAGCGG - Intronic
1157488531 18:48106822-48106844 TTCTGCAGCGGGGTGGGGAATGG + Intronic
1158202906 18:54959586-54959608 CTGTACAGGCGGGTGGGGGGAGG + Intergenic
1160228148 18:77027378-77027400 CTCAGCAGGCGTGTGCGGGCAGG - Intronic
1160432287 18:78819924-78819946 CTCTGCAGGAGGGGGAGGAGGGG + Intergenic
1160541784 18:79627917-79627939 CTCTCCAGGCTGTTGGAGACAGG - Intergenic
1160594053 18:79962208-79962230 CTCTGGAGGCGGGAGGAGATGGG - Intergenic
1160666803 19:334583-334605 CTCGGCAGGATGGTTGGGACAGG - Intronic
1160953442 19:1678802-1678824 CTCCTGAGGCGGGTGGGGAGGGG - Intergenic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1163255419 19:16153197-16153219 CCCTGCAGGCAGGTGAGGGCGGG + Exonic
1163628682 19:18405250-18405272 CTGTGCAGGTGGCTGGGGAAGGG - Intergenic
1165388251 19:35524328-35524350 ATTTGCAGGAGGGTTGGGACAGG + Intronic
1165920948 19:39297686-39297708 CTCTGGGGCGGGGTGGGGACGGG - Intronic
1166054131 19:40278642-40278664 CTCTGCAGGGCAGTGGGCACAGG - Intronic
1166361799 19:42255559-42255581 CTCTGCAGAGGGGCGGGGTCAGG + Intergenic
1166705023 19:44903761-44903783 CCCTGCAGGCGGCTGGGGGAAGG - Intergenic
1167292164 19:48630281-48630303 CTCTCCCCGCGGGTGGGGGCGGG + Exonic
1167420110 19:49397759-49397781 CTCGGCAGGCTGGAGGGGACAGG - Intronic
1167566967 19:50262685-50262707 CTCTGGAGGCGTGTTGGGATGGG + Intronic
1168554524 19:57326868-57326890 GTCTGAAGGCGGGTGGGGGGGGG - Intronic
925192764 2:1898825-1898847 CTCTGCAGGCGGGCGTGGTGGGG + Intronic
925730583 2:6917464-6917486 CTCGGCAGGCGGGAGGCGGCAGG + Exonic
925911103 2:8574140-8574162 CCCTGCACGCCGCTGGGGACCGG + Intergenic
926107683 2:10162681-10162703 CTCGGCAGGGGGGTGGGGGGCGG - Intronic
926161927 2:10495396-10495418 CGCTGCTGGCGGGTGTGGAGAGG - Intergenic
926621269 2:15049050-15049072 CTTTGCAGGCAGGTGGAGAGAGG + Intergenic
927036152 2:19178664-19178686 CTCTGCAGGAGGGTCTGGAAGGG - Intergenic
927151918 2:20201103-20201125 CTCTGCAGCCGGGTGGGAGGAGG + Exonic
927646024 2:24877425-24877447 TTCTTCAGGCGGGGGTGGACTGG - Intronic
928466824 2:31529945-31529967 CTTTGCAGAAGGGTGGGGAGGGG - Intronic
929565290 2:42979973-42979995 CCCTGCAAGTGGGTGGGGGCAGG + Intergenic
929790216 2:45016927-45016949 CTCTGTAGGTGTGTGTGGACTGG + Intergenic
932277224 2:70460673-70460695 CTCTGGGGGCTGGTGGGGAGAGG + Intronic
933252138 2:80040660-80040682 CTCTGCTGGCCTGTGGGGAATGG - Intronic
934857519 2:97738467-97738489 GTGTGCTGGCTGGTGGGGACTGG - Intronic
934943717 2:98520979-98521001 CTCCACAGGTGGCTGGGGACAGG + Intronic
935102797 2:100012601-100012623 CTCTGCAGGCTGGTGAGCACCGG - Intronic
935254752 2:101299902-101299924 CTATGAAGGCGGATGGGGAAGGG - Intronic
935666691 2:105518538-105518560 GTCTGCAGGCGGGGTGGGGCAGG + Intergenic
935925559 2:108065003-108065025 CTCTGCATGAGGCTAGGGACTGG + Intergenic
936361844 2:111811139-111811161 CTGAACAGGCTGGTGGGGACTGG - Intronic
936890065 2:117359295-117359317 CTTTGCAGGTGGATGGGGAGGGG + Intergenic
937869969 2:126779696-126779718 ATCTGCAGCTGGATGGGGACTGG + Intergenic
938496794 2:131801987-131802009 CGCTGCCGCCGGCTGGGGACTGG - Intergenic
940117301 2:150223173-150223195 CTCTAGAGATGGGTGGGGACTGG + Intergenic
943915533 2:193627583-193627605 CTCTGCTGTGGGGTGGGGAAGGG - Intergenic
946088744 2:217200453-217200475 CTCTGTAGGGGGTGGGGGACTGG - Intergenic
946305718 2:218855898-218855920 CTCTGCAGGAAGCTGGGGCCTGG + Intergenic
947618815 2:231575788-231575810 CTCTGCAGACGGGTGTGGGAGGG + Intergenic
948482228 2:238257406-238257428 TTCTGCAGGCCTGTGGGGAGGGG + Intronic
948525772 2:238570001-238570023 GGCTGCAGGCGTGTGGGGCCTGG + Intergenic
948755910 2:240159490-240159512 CTCTGCAGGGGTTTGGGGAAGGG - Intergenic
1170584301 20:17722879-17722901 GTCTGGAGGAGGATGGGGACAGG + Intronic
1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG + Intergenic
1171290902 20:23982338-23982360 CTTGGGAGTCGGGTGGGGACGGG - Intergenic
1173294747 20:41747080-41747102 CTCTGCATGGGGGTGGGGTGGGG + Intergenic
1173699028 20:45050169-45050191 CTCTGGGGGTGTGTGGGGACTGG + Intronic
1174148755 20:48471014-48471036 CTCTGCAGAAGGGAAGGGACTGG + Intergenic
1174152740 20:48497397-48497419 CTCTCCTGGTGGGTGGGCACAGG - Intergenic
1174369437 20:50076697-50076719 TTATGCAGCTGGGTGGGGACAGG - Intergenic
1174400849 20:50275072-50275094 GTCTGCAGCCGGGTGGACACGGG + Intergenic
1175285227 20:57833328-57833350 CTTTGCAGGTGGCTGGGGACTGG + Intergenic
1175518698 20:59585738-59585760 CTCTGCACGCGGGTGAGGAGAGG - Intronic
1175653181 20:60746627-60746649 AGCTGGAGGAGGGTGGGGACAGG + Intergenic
1175994457 20:62805809-62805831 CTGGGCAGGGGGGTGGGGTCTGG + Intronic
1176138042 20:63533622-63533644 CTCTGCAGGAAGCTGGGGTCCGG - Exonic
1176264732 20:64203230-64203252 CTGTGGAGGCCTGTGGGGACCGG - Intronic
1176268929 20:64225341-64225363 CGCTGCAGCCAGGTGCGGACAGG - Intronic
1177577802 21:22981827-22981849 CACTGCCGGGGCGTGGGGACAGG - Intergenic
1179907878 21:44433648-44433670 CTCTGTAGCTGGGTGGGGCCGGG + Intronic
1180168309 21:46041500-46041522 CTCTGCAGGCAGGTCTGGTCTGG + Intergenic
1181168563 22:20995865-20995887 CGCTCCAGGTGGGTGGGGGCTGG + Exonic
1181438126 22:22922101-22922123 CTCTGCAGGGAGGTGGGGTGGGG + Intergenic
1181465412 22:23108102-23108124 CTGTGCAGAAGGGTGGGGCCAGG + Intronic
1181703035 22:24631661-24631683 CTTGGGAGTCGGGTGGGGACGGG + Intergenic
1182300315 22:29333422-29333444 CTCAGAAGGCTGGTGGGGAGTGG - Intronic
1183414804 22:37676067-37676089 AGCTGCAGGGGGGAGGGGACAGG - Intronic
1183458194 22:37934040-37934062 CTCTGCAGGAGGCTGGGGCGTGG + Intronic
1183697021 22:39429222-39429244 CTCATCAGCTGGGTGGGGACGGG - Intronic
1183730056 22:39613389-39613411 CTCTGCCTGGGGGTGGGGTCTGG + Intronic
1184408504 22:44313490-44313512 CTCTGCTGCTGGGTGGGGACAGG - Intergenic
1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG + Intergenic
1184586945 22:45454352-45454374 CTCTGTGGGGAGGTGGGGACAGG - Intergenic
1184650673 22:45918216-45918238 CTCTGCAGGGGGACGGGGAGGGG + Intergenic
1185040116 22:48499589-48499611 CTCCGCAGGGGGGTGGCGCCGGG + Intronic
1185072700 22:48666020-48666042 GGCTCCAGGAGGGTGGGGACTGG + Intronic
1185309569 22:50146461-50146483 CAGTGCAGGGGGGTGGGGTCGGG + Intronic
950259029 3:11530608-11530630 CACTGCTGGAGGGTGGGGTCAGG - Intronic
950580249 3:13857424-13857446 CTTTGCTGGAGGGTGGGGACAGG - Intronic
950698234 3:14721177-14721199 CTCTGCAGATGGGTGGGAAGAGG - Intronic
951309441 3:21106230-21106252 CACTGCAAGCGGGTGTGGCCAGG + Intergenic
951927219 3:27921622-27921644 CTCTGCATGGGGGTGGGGGAAGG + Intergenic
952943540 3:38460648-38460670 CTCTGGAAGCGGGTGTGGAAAGG + Intronic
952946689 3:38482583-38482605 CTTTGCAGGGGGGTGGAGAAGGG + Intronic
952959073 3:38578544-38578566 CTGTGAAGGCATGTGGGGACAGG - Intronic
953064456 3:39456286-39456308 GTGTGCAGGCCGGTGGTGACAGG + Intergenic
954136051 3:48582676-48582698 CTGTGCAGGTGGGTGGGGACGGG + Intronic
954673428 3:52302816-52302838 CTCTTCAGGGGGATGGGCACTGG - Intergenic
956166715 3:66402878-66402900 CTGAGTAGGCGGGTGGGGAGGGG + Intronic
962270371 3:133973864-133973886 CTCTGTGGGTGGGTGAGGACAGG - Intronic
963051270 3:141146087-141146109 CTCTGGAAGAGGGTGGGGGCAGG - Intronic
967228724 3:187317852-187317874 CTCTGGAGGTGGGTAGGAACAGG + Intergenic
968512421 4:1001460-1001482 CTCTGCAGGTAGGTACGGACTGG + Exonic
968744805 4:2354072-2354094 CTCTGCAGGAGAGAGGGGCCAGG + Exonic
968890860 4:3367711-3367733 CTCTGCAGATGGGTGAGGAAAGG - Intronic
968904830 4:3446361-3446383 GTCCGCAAGCGGGTGGGGACAGG - Intronic
968936826 4:3615520-3615542 CTCGGCTGGCGCGTGGGTACTGG + Intergenic
969641623 4:8402189-8402211 CCCTGGGGCCGGGTGGGGACGGG + Intronic
970008180 4:11429486-11429508 CTCTGCAGCCGGACTGGGACCGG + Exonic
971328586 4:25664181-25664203 CTCTGCAGGGGGGTGGGATGGGG - Exonic
973199603 4:47485271-47485293 CTCTGCAGCCTGGCGGAGACGGG + Exonic
975668828 4:76759777-76759799 CTCTTGAGGCAGGTGGGGAAAGG + Intronic
978196458 4:105978148-105978170 CTCTGCAGGAGTGTGGGGTAAGG + Intronic
981401843 4:144322358-144322380 ATCTGCAGGCAGGTGTGCACTGG - Intergenic
981516863 4:145619314-145619336 GACTGCAGGCGCGTGGGGCCCGG - Exonic
985271269 4:188197010-188197032 CTCAGCAGGTGGGTGGGGAGGGG - Intergenic
985271287 4:188197070-188197092 CTCAGCAGGTGGGTGGGGAGTGG - Intergenic
985271321 4:188197190-188197212 CTCATCAGGTGGGTGGGGAGTGG - Intergenic
985271337 4:188197250-188197272 CTCAGCAGGTGGGTGGGGAGTGG - Intergenic
985271367 4:188197370-188197392 CTCATCAGGTGGGTGGGGAGTGG - Intergenic
985271383 4:188197430-188197452 CTCAGCAGGTGGGTGGGGAGTGG - Intergenic
985271428 4:188197610-188197632 CTCAGCAGGTGGGTGGGGAGGGG - Intergenic
986749670 5:10775873-10775895 CTCTGCTGGCAGGTGGAGAGTGG - Intergenic
988837590 5:35048268-35048290 CTCTGCAGGAGGGTGGTGCTGGG + Intergenic
989209520 5:38845802-38845824 CTTTGCGGGCGGGCGGGCACTGG - Intergenic
990012604 5:51018621-51018643 CTTTGTAGGCAGGTGGGTACAGG + Intergenic
991263519 5:64690957-64690979 CTCTGAGGGCGGGTGAGGGCAGG + Intronic
992716298 5:79514191-79514213 CTCTGCTCGCGGGAAGGGACGGG + Exonic
994824835 5:104699315-104699337 CTCTGCACGGGGGTGGTGAGGGG - Intergenic
995484402 5:112625377-112625399 TTCTGCAGTCAGGTTGGGACAGG + Intergenic
996308424 5:122077223-122077245 CACTGCAGGCGCGTGGGGGAGGG + Intronic
997892889 5:137690674-137690696 CTCTGCAGGCTCCTGGGGTCAGG + Intronic
998037666 5:138930666-138930688 CTGTGCAGCCTGGTGGGGCCGGG - Intronic
998151396 5:139759447-139759469 GTCTGCAGCCGGGAGGGGCCTGG + Intergenic
1001951327 5:175818610-175818632 TTTTGCAGGGAGGTGGGGACTGG - Intronic
1002321779 5:178380789-178380811 CTCAGCAGGACGCTGGGGACAGG - Intronic
1002839494 6:893777-893799 CTCTGGAGGCTAGTGGGGTCTGG + Intergenic
1002951869 6:1821361-1821383 CGCGGCTGGTGGGTGGGGACGGG + Intronic
1004478195 6:15993898-15993920 CCCTGGAGGCTGGTGGGGCCTGG + Intergenic
1004871268 6:19906887-19906909 CTGTGCAGTGGGGTGGGGATAGG - Intergenic
1004923863 6:20401524-20401546 CCCGGCGGGCGGGCGGGGACAGG + Intergenic
1006535726 6:34697068-34697090 CTCTCCTTGAGGGTGGGGACGGG - Intergenic
1010727867 6:79355759-79355781 CTCTGAAGGCAGGTGGTGCCTGG + Intergenic
1010997658 6:82551720-82551742 CGCTGCAGCCTGGTGGGGAGAGG - Intergenic
1011228733 6:85136372-85136394 CCCAGCAGGAGGGAGGGGACAGG + Intergenic
1012334740 6:98041273-98041295 CTCTGCAGGAGGGGAGGGAGAGG + Intergenic
1015628195 6:135204017-135204039 CTCTGCAGGTGGCTGGGTATTGG - Intronic
1016233489 6:141833437-141833459 CTTTGCAGGCGGGAGGAGCCTGG + Intergenic
1018389040 6:163329309-163329331 CACTGCAGGGGAGTGGGGATGGG - Intergenic
1019175915 6:170159492-170159514 CTCTGCAGCCTGGAGCGGACGGG - Intergenic
1019287795 7:232223-232245 CTCTCCAGGTGGATGGGGAGTGG - Intronic
1020257245 7:6509097-6509119 CTGGGCGGGCGGGTGGGGTCCGG + Exonic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1022857877 7:34333639-34333661 GTATGCAGGCGGCTGGAGACTGG - Intergenic
1023357231 7:39379455-39379477 TTCTGCAGGCAGGTGGGTGCAGG - Intronic
1026867526 7:73832712-73832734 CTGTGGAGGTGGGTGGGGAAGGG + Intergenic
1028561334 7:92179293-92179315 CGCTGCAGGCGGGTGGAGAACGG + Intronic
1029490315 7:100867068-100867090 CTCTGCAGAGGGGTGGAGATCGG + Intergenic
1029496474 7:100897544-100897566 CTGTGCATGGGGGAGGGGACAGG + Intergenic
1032096729 7:128942015-128942037 GTCTGCAGGTGGATGGGGACAGG - Intronic
1032785382 7:135196129-135196151 CACTGCAGGTGGGTTGGGCCTGG - Exonic
1032800026 7:135310421-135310443 CTCTCCAGGGGTGTGGGGAGGGG - Intergenic
1033718074 7:144023960-144023982 ATCTGCAGGGTGGAGGGGACAGG - Intergenic
1034118524 7:148606148-148606170 CTCTGCAGATAGGTAGGGACAGG + Intronic
1034418779 7:150978360-150978382 CGCGGCAGGCGGGAGGGGGCCGG - Intergenic
1034474883 7:151276380-151276402 CTCGGCAGGGGGGAGGTGACAGG + Intronic
1035019894 7:155794574-155794596 CTCAGGAGGGGGGTGGGGGCAGG + Intergenic
1035473922 7:159129068-159129090 CCCCCCAGGCGGGTGGTGACGGG - Intronic
1035690576 8:1557027-1557049 CTCAGCACGGGGGTGGGGGCTGG + Intronic
1035953048 8:4045126-4045148 CGCTGCAGGTGGGAGGGCACAGG - Intronic
1036212650 8:6854681-6854703 CTCTGCAGCCGGCTCTGGACTGG - Intergenic
1036794933 8:11748981-11749003 CTCTGGAGGCGAGATGGGACGGG + Exonic
1038657727 8:29469412-29469434 CGTTGCAGGAGGATGGGGACAGG + Intergenic
1038665336 8:29532529-29532551 CTCTGCAGCAGGGTGGGTACAGG + Intergenic
1040540272 8:48347600-48347622 CTCTGCAAGCAGGTGTGGCCAGG - Intergenic
1042155645 8:65841746-65841768 CGCTCCAGGCGAGGGGGGACGGG + Exonic
1044734800 8:95268746-95268768 CTCTGCGGGCGGGGCGGGGCGGG + Intronic
1048327333 8:133449795-133449817 CTCCCCAGGGGTGTGGGGACAGG - Intergenic
1048823393 8:138400013-138400035 CTCTGCAGGGGGCCTGGGACTGG - Intronic
1048948150 8:139469785-139469807 CATTGCAGGTGGGTGGGTACAGG - Intergenic
1049306784 8:141908197-141908219 CTCTGCAGGCTGTGGGGGAGGGG + Intergenic
1049308135 8:141918588-141918610 CTCTGCAGGGGGCTGGGCACGGG + Intergenic
1049415346 8:142492430-142492452 GTCTGGATGCGGGTGGGGAGGGG + Intronic
1049534349 8:143171302-143171324 CCCTGCAGGGAGCTGGGGACAGG + Intergenic
1049545879 8:143230288-143230310 GTCTGCAGGTGGGAGGGGAAGGG + Intergenic
1053312661 9:37029378-37029400 CCCTGGTGGGGGGTGGGGACGGG - Intronic
1054731274 9:68705033-68705055 CTCAGCCGGTGTGTGGGGACCGG - Intergenic
1057218553 9:93243297-93243319 CCCTGCAGGAGGGCGGGGGCAGG - Intronic
1057302733 9:93896091-93896113 CTCTGCAGGTGGGAGAAGACCGG + Intergenic
1057699688 9:97354816-97354838 CTCTGAAGGAGGAGGGGGACAGG - Intronic
1058798073 9:108517756-108517778 CTCTGCATCCGGAGGGGGACAGG + Intergenic
1060852020 9:126886126-126886148 CTCTGCAGGCGCGAGGGGCAGGG - Intergenic
1060981826 9:127797006-127797028 ATCTGCAGGTGCGTGTGGACAGG - Intronic
1061108872 9:128552772-128552794 CTCTTCAGGCGGGGCGGGGCCGG + Intronic
1061412770 9:130430263-130430285 ATCTGCAGACGGGTGGGGTCAGG - Exonic
1061584362 9:131556323-131556345 CTCTGGAGGGGGGTGGGAATTGG + Intergenic
1061618350 9:131794564-131794586 CTCTGCAGGGAGGAGGGGACGGG + Intergenic
1061863147 9:133478219-133478241 CTCTGGAGGAGGGTGGGTGCAGG - Intronic
1062461329 9:136663727-136663749 CTCTGCATGAGGCTGGGGAGAGG - Intronic
1062585498 9:137247623-137247645 CTCTGGAGGTGGCTGGGGCCAGG - Intronic
1062614588 9:137390639-137390661 CTCTGCTGGCAGGTGTGGAAGGG + Intronic
1189181790 X:39011608-39011630 GGCTGCAGCCGGGTTGGGACAGG + Intergenic
1189354118 X:40298623-40298645 CTCTGCAGGGGTGTCGGGGCTGG - Intergenic
1190326365 X:49209454-49209476 CCCTGCAGGCGGGTAGGGTGGGG + Intronic
1190745573 X:53320290-53320312 TTCTCCTGGCGGGTTGGGACAGG + Intronic
1192436216 X:71145272-71145294 CACTGCAGGGGAGGGGGGACTGG - Intronic
1195172899 X:102286286-102286308 CGCTGCAAGCGGGTGTGGCCAGG + Intergenic
1195185967 X:102400809-102400831 CGCTGCAAGCGGGTGTGGCCAGG - Intronic
1195687034 X:107596912-107596934 CTCTGAAAAGGGGTGGGGACAGG + Intronic
1198312034 X:135433597-135433619 CTCTGTAGGCAGGTGGGGGTCGG + Intergenic
1198387942 X:136147078-136147100 CACTGCAGGCGGCTGGGGCTGGG - Intergenic
1199700715 X:150373579-150373601 TTCTGCATACGGCTGGGGACAGG + Intronic
1200154724 X:153969421-153969443 CCCTGCAGGCGGCTGGGGGAGGG - Intronic