ID: 1142029646

View in Genome Browser
Species Human (GRCh38)
Location 16:87832134-87832156
Sequence CTCTGTTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029643_1142029646 6 Left 1142029643 16:87832105-87832127 CCTGGCCGCGGTGTGTCTGCCTT 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 226
1142029640_1142029646 18 Left 1142029640 16:87832093-87832115 CCCACATGGGTGCCTGGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 226
1142029644_1142029646 1 Left 1142029644 16:87832110-87832132 CCGCGGTGTGTCTGCCTTTCTTG 0: 1
1: 0
2: 1
3: 11
4: 199
Right 1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 226
1142029642_1142029646 17 Left 1142029642 16:87832094-87832116 CCACATGGGTGCCTGGCCGCGGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 226
1142029638_1142029646 30 Left 1142029638 16:87832081-87832103 CCAGGGTGGGCGCCCACATGGGT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029646 Original CRISPR CTCTGTTTCTAGAAGACTGA AGG Exonic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
903717385 1:25377896-25377918 CTCTGTTTCAAAAAGAAAGAAGG + Intronic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
905106178 1:35564871-35564893 CTCTGTGTCCAGAACCCTGAGGG + Intronic
905118716 1:35665064-35665086 CACAGTTTGTAGAATACTGATGG - Intergenic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
906651891 1:47518677-47518699 CTGTGGTACTAGAACACTGAAGG + Intergenic
906715059 1:47962459-47962481 CTCAGTTTCTAGATGGGTGAAGG - Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907151688 1:52294696-52294718 CTCTGGTCCAAGAAAACTGAAGG - Intronic
907379111 1:54070862-54070884 CTGTGTTTCTATTAGACTTAAGG - Intronic
908748508 1:67397954-67397976 CTCAGTTTCTAGAGCTCTGAGGG - Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909281901 1:73767381-73767403 CACTTTTTCTAAAATACTGATGG + Intergenic
909506871 1:76401880-76401902 CTCTGTTTCTGGAAGCATGTTGG - Intronic
910584850 1:88868285-88868307 CTCTGTTTCTAGAACACTAAAGG - Intronic
911311504 1:96297681-96297703 CTTTGTTTCTAGAAGATTTTAGG + Intergenic
911571908 1:99527757-99527779 ATCAGTTTCTAAAAGGCTGATGG + Intergenic
911727994 1:101262595-101262617 CTCAGTTTATAGAAGACAAAGGG + Intergenic
912166451 1:107047162-107047184 TTCTTTTTTTAGAAGCCTGAAGG + Intergenic
914672468 1:149881899-149881921 CTCTGCTTCCAGTAGAATGATGG - Intronic
916797798 1:168182664-168182686 CTCTATATTTAGAACACTGAAGG + Intronic
919944756 1:202310971-202310993 CTGTGTTTCTGGAAGAGTTAGGG + Intronic
920670092 1:207997417-207997439 CCCTTTTTCTTGAAGACAGATGG + Intergenic
922614564 1:226954220-226954242 TTCTGTTTCTTGAAGAATAATGG + Intronic
922831077 1:228554767-228554789 CTCTGTTATTGGAAGACTGGAGG + Intergenic
923760686 1:236841058-236841080 CTCAGGATCTAGAAGGCTGAAGG - Intronic
924303169 1:242660550-242660572 CTCTGTGTCTAGAAGAAGGTTGG - Intergenic
924931718 1:248738288-248738310 CGCTGTTTGAAGGAGACTGAGGG + Intronic
1063026722 10:2186156-2186178 CTGTTTTTCTGGAAGTCTGATGG + Intergenic
1063043506 10:2368338-2368360 CTGTGTTTTTATAAGACTGTGGG + Intergenic
1063308935 10:4934830-4934852 CTCAGTTTCTAGCTGGCTGATGG - Intronic
1063317815 10:5023270-5023292 CTCAGTTTCTAGCTGGCTGATGG + Intronic
1066259839 10:33718857-33718879 CTCAGTCTCTATAAGACTGTGGG + Intergenic
1066630625 10:37456150-37456172 ACCTGTTTTTAGAGGACTGAAGG - Intergenic
1069276991 10:66604702-66604724 CTTTGTTTCTGGAAGACTTTAGG - Intronic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1072284792 10:93904048-93904070 CTCAGGATCTAGAAGAATGAAGG - Intronic
1072693550 10:97587031-97587053 CCCTGTGGCTAGAAGCCTGAAGG - Intronic
1072785841 10:98281398-98281420 CTCTGCTTCCAGGAGTCTGATGG + Intergenic
1073140484 10:101243893-101243915 CTCTGTTTCTTGCAAACAGAAGG - Intergenic
1073592764 10:104772195-104772217 CTCTGCTTCTAGGGGACTGGTGG + Intronic
1074621463 10:115128311-115128333 TTTTATATCTAGAAGACTGAGGG + Intronic
1074995391 10:118753978-118754000 CTCTGGCTGCAGAAGACTGAAGG + Intronic
1077046837 11:550411-550433 CTCTGTCACTGGAAGTCTGACGG + Intronic
1077479172 11:2805174-2805196 CTTTGTCTCTAGAAGACGCAGGG + Intronic
1077558401 11:3239498-3239520 CTCTGGTTCAGGAAGACTCAAGG - Intergenic
1077765121 11:5150504-5150526 CTCTGATTCTTGAGGAATGATGG - Intergenic
1077985572 11:7347984-7348006 CTCTGTTCCTGGAGGAGTGAGGG + Intronic
1078902404 11:15653604-15653626 CTCTGCATCTATAATACTGAGGG - Intergenic
1079841824 11:25411946-25411968 ATCTGTTTCTATAAGATCGAAGG + Intergenic
1080344632 11:31310788-31310810 CTCTGTTTCTGGAAAGCTGAAGG - Intronic
1082738541 11:56884448-56884470 CTTTGTTCTTAAAAGACTGAGGG + Intergenic
1085108764 11:73868829-73868851 CTCTGTTTCTAGTGTACTTAAGG + Intergenic
1087060771 11:93974892-93974914 TTCTGTTTCTAGAACTTTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087938817 11:104068292-104068314 CTTTGTTTCTTGAATACTGCAGG + Intronic
1088767737 11:113000695-113000717 CCCTGTTCCTGGAAGGCTGATGG + Intronic
1092191032 12:6521039-6521061 CTCTGGGTCTATATGACTGAAGG - Exonic
1092600560 12:10058356-10058378 CTCTCTTTCTAGCAAAATGATGG - Intronic
1093224065 12:16459962-16459984 TTCTGTTTCTACAAGACAGAAGG - Intronic
1095096221 12:38150793-38150815 CTTGGCTTCTAGAAGATTGATGG + Intergenic
1096611425 12:52804521-52804543 CTCTGTTTCTAGAACAGTCCAGG - Intergenic
1097577018 12:61407428-61407450 CTATGTGTCTGGAACACTGAAGG + Intergenic
1099097092 12:78388282-78388304 CTCAGTTTGTAGAAGACTTCAGG - Intergenic
1100233098 12:92629936-92629958 TTCTTTCTCTAGAAGACTGGAGG + Intergenic
1100926770 12:99557898-99557920 CTTTGTTTCTGGAAGACTTTAGG + Intronic
1101775280 12:107787918-107787940 CTCTGTTGCTAGATGCCTCAGGG + Intergenic
1101910240 12:108856128-108856150 CTGTGTTTAGAGAAGACTGGAGG - Intronic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1102146618 12:110659392-110659414 CTCTGCTTCCAGAAGAGGGACGG + Intronic
1103140864 12:118547053-118547075 GTCTGTTAGTAGAAGACTGATGG + Intergenic
1105300774 13:19132829-19132851 CTCTGTTTCTTGCAGCCTTAAGG - Intergenic
1106138066 13:26989537-26989559 AACTGTTTCCAGAAGACAGAGGG + Intergenic
1106792817 13:33173060-33173082 CCCTGTTTCTAAAAGACTACGGG + Intronic
1110131229 13:72013763-72013785 CTCTGTTTCAAGAACTATGATGG - Intergenic
1110900172 13:80812323-80812345 CTGGGTTTCTAGTATACTGATGG + Intergenic
1111063940 13:83065255-83065277 TTCTGGTGCCAGAAGACTGATGG - Intergenic
1114923969 14:27369699-27369721 CACTGTTTATAGAAGACATAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117709657 14:58513153-58513175 CTATGTTTCTACAAGGCTGTTGG + Intronic
1117990604 14:61429354-61429376 TTCTGTTTCTCAAAGACAGATGG + Intronic
1119625721 14:76173469-76173491 CTATGTTTCTAGTACACTGAAGG - Intronic
1120837800 14:89056828-89056850 CTCTGTTTCCAGGAGACTCAGGG + Intergenic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1123878614 15:24652072-24652094 CTCTGTGGCTTGAAGACTAATGG + Intergenic
1123894269 15:24812861-24812883 CTCTGTGTCATGAAGACTGATGG + Intergenic
1124018082 15:25895226-25895248 CTCTATTCCTAGTATACTGAGGG + Intergenic
1126508609 15:49439153-49439175 CTCTGTTTCTATCAGGCTGTTGG + Intronic
1127446294 15:59066752-59066774 TTCTGTTTCAAGATGACTCAAGG + Exonic
1129079858 15:73029701-73029723 CACTGCATCTGGAAGACTGAAGG - Intergenic
1131432621 15:92398932-92398954 CTGTCTTTCTAAATGACTGATGG - Intronic
1132088413 15:98926973-98926995 ATCTGTTTCTAGGAGATGGAGGG - Intronic
1132428138 15:101737883-101737905 CTCTGTTTCTAGATGACTATTGG - Intronic
1132625217 16:888325-888347 CTCTGTTGCTAGAAAGCTGCGGG - Intronic
1132772431 16:1571494-1571516 CTCCTTTTCTCGGAGACTGAGGG - Exonic
1134840549 16:17398368-17398390 CTGTGTTTCTGCAAGACTAAAGG + Intronic
1137780458 16:51094019-51094041 CTCTGTTTCTGAATCACTGAAGG - Intergenic
1141585722 16:85032342-85032364 CTCTGTCTCAAGAAAACAGAAGG - Intronic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1145070159 17:19798518-19798540 TTCTGTTTTTAGAAGAATGATGG - Intronic
1145204480 17:20975409-20975431 CTCTGTCTCTACAAAACTGCAGG - Intergenic
1145795070 17:27650783-27650805 CTCTGCTGCTAGAAGAGGGAGGG + Intergenic
1151546062 17:74793874-74793896 CTCTGTTCCTAGGAGCCTGGGGG - Intronic
1152048087 17:77951741-77951763 CTCTATCCCTAGAAGACTCAGGG - Intergenic
1154498374 18:14979169-14979191 CTCTGCCTCTAGAAGGCTCAGGG - Intergenic
1155438690 18:25839150-25839172 CTCTGTTTTGAAAAGACAGAAGG - Intergenic
1155651545 18:28149774-28149796 CTTTCTTTCAAAAAGACTGAAGG + Intronic
1156227496 18:35123637-35123659 CTCTCTTTCTGGGAGGCTGATGG + Intronic
1156994821 18:43452577-43452599 CTGTGTTTCTACAAAACTGAGGG - Intergenic
1157112086 18:44830762-44830784 TTCTGTTGCACGAAGACTGAAGG + Intronic
1157965278 18:52201900-52201922 GGCTGTATCTAGAAGAATGATGG - Intergenic
1159878864 18:73839218-73839240 CTCTTTTCTTAGGAGACTGAAGG - Intergenic
1160205572 18:76828512-76828534 CACTGTTACCAGAAGCCTGAGGG - Intronic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1162262699 19:9545652-9545674 CTACCTTTCCAGAAGACTGAGGG - Intergenic
1162824740 19:13244582-13244604 CTCCTTTTCTGGAAGACTCAGGG - Intronic
1163559973 19:18013263-18013285 CTCTGTTTCTCCCAGACTGAAGG - Exonic
1163923418 19:20315102-20315124 GTCTCTTTTTAGAAGACAGATGG + Intergenic
1163973526 19:20825483-20825505 GTCTCTTTTTAGAAGACAGATGG + Intronic
926793738 2:16601364-16601386 CTCTGTTTTTGGAGGATTGAGGG - Intronic
926891804 2:17645105-17645127 CTCTATTTCCAGCAGACTAATGG + Intronic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
929558796 2:42942793-42942815 CTCTGATTCTAAAATCCTGAAGG - Intergenic
929837672 2:45421779-45421801 CTTTTGTTCTGGAAGACTGAAGG + Intronic
933347396 2:81106453-81106475 CCATGTTCCCAGAAGACTGAGGG - Intergenic
933479989 2:82844128-82844150 CTCTGTTTCTAAAAAACAGGGGG + Intergenic
933481211 2:82859149-82859171 CTTTCTTTCTAGAATTCTGAAGG - Intergenic
933634621 2:84693967-84693989 CTCTTTTTCCTGAAGTCTGAAGG - Intronic
936386097 2:112030669-112030691 TTCTGATTCTTGAAGACTGTGGG - Intergenic
937159735 2:119748723-119748745 CTGTATTTTTAAAAGACTGAAGG - Intergenic
937865675 2:126749752-126749774 CACTGTGTTTAGAACACTGATGG - Intergenic
939447162 2:142324862-142324884 CTCTGATTCTACAAGACTGGTGG - Intergenic
940068666 2:149658729-149658751 CTCTATTTCTGGAAGTTTGATGG + Intergenic
941424274 2:165322500-165322522 CTCTGTCTCAAGAAATCTGAGGG - Intronic
942503722 2:176619389-176619411 CTCTGTTTTCATTAGACTGATGG - Intergenic
944120071 2:196231175-196231197 CTCTGTTTCTAAAAGACACAGGG - Intronic
944956359 2:204814727-204814749 TTCTGTTTCTAGTATGCTGAGGG + Intronic
945027396 2:205632233-205632255 CTCTCTTTATAGAAGACTGTAGG - Intergenic
945752841 2:213809836-213809858 CTCTGTTTCTAGAAATCAGGTGG + Intronic
947207637 2:227676472-227676494 CTCAATTTCTAGAAAACAGAAGG + Intergenic
1168749720 20:273868-273890 CTCTGTCTCAAGAAGAAGGAAGG + Intronic
1168901880 20:1371681-1371703 CTGTGTTTCTAGAAGCTAGAGGG - Intronic
1169080151 20:2793450-2793472 CTGAGTTTCTATCAGACTGAAGG - Intergenic
1169486706 20:6040804-6040826 CTCTGTTCCCAGAAACCTGATGG - Exonic
1169745907 20:8942618-8942640 CTTGTTTTCTAAAAGACTGAAGG + Intronic
1169941754 20:10945451-10945473 CTCTGTTTTTAGAAAACCCATGG + Intergenic
1170464840 20:16613080-16613102 ATCTGGTGCTTGAAGACTGAAGG - Intergenic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1177073740 21:16545620-16545642 CTCTTTGCCTAGAAGAATGAGGG - Intergenic
1177461855 21:21422592-21422614 CTCTGTTTTTAGAACATTGGGGG + Intronic
1180945953 22:19693631-19693653 CCCTGTGTCTAGGAGAGTGAGGG + Intergenic
1182115769 22:27755416-27755438 CTCTGGTTCTTGGGGACTGATGG + Intronic
1182631194 22:31686854-31686876 CACTGTTTCTAGAATATAGAAGG - Intronic
1183659857 22:39212931-39212953 CTCTGTGTCAAGAAGCCTAAGGG + Intergenic
950199825 3:11034983-11035005 GTATGTTTCTAGAAGAGGGAGGG + Intronic
952452512 3:33445446-33445468 GTCTGTATCTACAAGACTGAAGG + Intergenic
955785959 3:62539168-62539190 CTCTGTTTTTAAAAAACTGTAGG + Intronic
957607535 3:82421969-82421991 TTCTGTTTCAAGAAGTGTGAAGG + Intergenic
957652210 3:83022552-83022574 CTGTGTATCCAAAAGACTGAAGG - Intergenic
957699002 3:83685408-83685430 CTCATTTTCTAGAATACTAAAGG + Intergenic
957839685 3:85652263-85652285 CCCTGCTTCTAGAAGGCTCATGG - Intronic
958758071 3:98274207-98274229 GTCTTTCTCTGGAAGACTGAGGG + Intergenic
959904706 3:111698620-111698642 CCCTGTCTCTAGAACACTAATGG - Intronic
963014908 3:140813773-140813795 CTCTGTTCCTAGTTTACTGAGGG - Intergenic
964903958 3:161694874-161694896 TTCTGTTCCTCAAAGACTGAGGG - Intergenic
965428787 3:168561211-168561233 CAACCTTTCTAGAAGACTGAGGG + Intergenic
967292713 3:187936721-187936743 CTCTGCTTCTCAATGACTGAAGG + Intergenic
969220875 4:5757628-5757650 CTCTGTGCTTGGAAGACTGAAGG + Intronic
970040298 4:11789263-11789285 ATGTGTTTCTAGAAGCCAGATGG + Intergenic
974713637 4:65636898-65636920 CCCAGTGCCTAGAAGACTGAGGG + Intronic
975019766 4:69471798-69471820 TTCTGTGTCAAGAAGACTGCAGG - Intergenic
975064754 4:70047239-70047261 CTCAGTTTCTACAAGACAGAAGG + Intergenic
978054610 4:104248661-104248683 CTTTGTTTCTGGAAGACTTCTGG + Intergenic
978373197 4:108049918-108049940 CTCTCTTTCCAAAAGCCTGAAGG - Intronic
978882263 4:113719953-113719975 CTCTGGTTATAGGAGCCTGAAGG - Intronic
981155317 4:141428038-141428060 CCCTGTTCCTAGATTACTGAAGG - Intergenic
982114798 4:152089431-152089453 CTCTGTTGAGAGAAGAGTGAAGG + Intergenic
984513647 4:180710927-180710949 CTCTATTTCTAGAGCACAGATGG + Intergenic
987017951 5:13839138-13839160 CTCTGCCTCTATAAGACTGAAGG + Intronic
987665972 5:20940248-20940270 CTCTTCCTCTAGAAAACTGAAGG - Intergenic
988229168 5:28451627-28451649 CTCTGTGTCTAAAAGAATGTTGG - Intergenic
990527857 5:56645866-56645888 CGCTGATTCTAGCAGACAGATGG - Intergenic
991645607 5:68797617-68797639 TTTTTTTTCTAGAAGACTAATGG - Intergenic
993441422 5:87961588-87961610 CTCTGTATCTAAAACACAGAAGG + Intergenic
993523366 5:88933578-88933600 CTATGTTTTTAGAAGATTAAAGG + Intergenic
994497594 5:100533866-100533888 CTCTGATCCTAGTAGACTGTGGG - Intergenic
995492720 5:112709422-112709444 CTCTGGTTCCAGAAAAGTGAAGG - Intronic
996182948 5:120442367-120442389 CTTTTTTTCTAGAAGACTTCTGG + Intergenic
999432069 5:151532969-151532991 CTCTGTCTCTAGAAAAATTATGG - Intronic
1000496635 5:161992225-161992247 CTCTGTTTCTCGAACACTTATGG - Intergenic
1000496654 5:161992479-161992501 CTCTGTTTCTCAAACACTTATGG - Intergenic
1001554207 5:172625172-172625194 CTCTCTTCCTGGAAGACTGTGGG - Intergenic
1003572231 6:7263242-7263264 CCCTGGGTATAGAAGACTGAGGG - Intergenic
1004472245 6:15939746-15939768 CTCTTTCTCTAGATGACTGTGGG + Intergenic
1006030043 6:31171616-31171638 GTCTGATTCTGGAAGACGGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1006961554 6:37936085-37936107 CTCTTGTTCTAGCATACTGAAGG + Intronic
1008182968 6:48356019-48356041 CTTTGTTTCTAGAAGATTTTAGG - Intergenic
1008487488 6:52051777-52051799 CTCAATTTCCAGAAGGCTGAGGG - Intronic
1009287808 6:61844097-61844119 TTCTGTTTCTAGAAGACTACTGG + Intronic
1011876577 6:91969856-91969878 ATCTGTTTCTATAGCACTGATGG + Intergenic
1013322778 6:109011024-109011046 CTCTGGTTCTAGAAGAGTTGAGG + Intronic
1013379237 6:109550545-109550567 CTCTGTTGGTAGAGGACTGGAGG - Intronic
1014690784 6:124560971-124560993 CTCTGGGTCTAGAAGATTGCTGG - Intronic
1014866537 6:126538205-126538227 CTATGTTTCAACAAAACTGAAGG + Intergenic
1015454016 6:133404605-133404627 CTCTATGACTAGAAGACTGTGGG - Intronic
1017154825 6:151313559-151313581 CTCTGTTTCTTTAAGGATGAAGG - Intronic
1017195615 6:151696984-151697006 CTATGTTTCTGTCAGACTGATGG - Intronic
1018283780 6:162216039-162216061 CTCTGTCACAAGAAAACTGAAGG + Intronic
1020623068 7:10541749-10541771 CTCTAATCCTAGAAGACAGAAGG - Intergenic
1020679051 7:11214464-11214486 CTCTGCTTCATGAAGACAGATGG + Intergenic
1020734893 7:11935804-11935826 CTCTGTTTTTATATGACTGGTGG + Intergenic
1021077312 7:16320919-16320941 TACTGTTTCTGGAAGAGTGATGG - Intronic
1023269956 7:38451685-38451707 CTCTGTTTACATGAGACTGAGGG - Intronic
1024555860 7:50603202-50603224 GTCTCTTTCTGGAAGACTGCTGG + Intronic
1028949672 7:96620340-96620362 CACTGATTCTAGGAGACAGAGGG - Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1032948056 7:136874153-136874175 CTCTTTTTCTATAAGATTGTTGG + Intronic
1036691045 8:10944960-10944982 CTCTGTTCCCAGAAGCCTCAGGG - Intronic
1037022832 8:13995203-13995225 CTTTATTTCTAGAAAATTGAAGG - Intergenic
1041775223 8:61515465-61515487 ATCTGTATTTAGAAGACGGAAGG - Intronic
1043627110 8:82274619-82274641 CTATGGTTCTTGAAGACTTATGG - Intergenic
1044243307 8:89912042-89912064 CTCTGTTTCTAGTATTCTTATGG + Intronic
1044277192 8:90315366-90315388 CTCTGATTTAAGAAGACTGTAGG + Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1044790350 8:95840751-95840773 CTCTGTTTCTAGGAAACTCTTGG + Intergenic
1045193599 8:99907654-99907676 CTCTCTCTCTAGAAGGCAGAGGG - Intergenic
1045409584 8:101903823-101903845 CTCAGCTTCTAAAAGACAGAAGG + Intronic
1046086188 8:109438312-109438334 CTCTTATTTTAGAAAACTGAGGG + Exonic
1046376556 8:113389750-113389772 CTCAGTTTATACAGGACTGAGGG + Intronic
1046596905 8:116272213-116272235 CTCTGTTTCTGGAAGACTTTAGG + Intergenic
1047264184 8:123290431-123290453 ATCTGTTACTGGCAGACTGAAGG + Intergenic
1047299169 8:123598036-123598058 CTAAGTTGCTGGAAGACTGATGG - Intergenic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1048826545 8:138432970-138432992 ATCTGTTCCCAGAGGACTGACGG + Intronic
1048880196 8:138866163-138866185 CGCAGTTACTGGAAGACTGAAGG - Intronic
1052327246 9:27228411-27228433 CTTTGTTTCTATAATACTTAGGG - Intronic
1058293956 9:103281347-103281369 CTCTGTTTCTAAAGGGCTCAAGG + Intergenic
1058767363 9:108194812-108194834 CTGGGTTTTCAGAAGACTGAGGG - Intergenic
1058971404 9:110086693-110086715 CTCTGTGTCCAGAAACCTGATGG - Intronic
1192012166 X:67286317-67286339 CTCTGGTTCTTGCAGACTCATGG + Intergenic
1195465321 X:105173120-105173142 CTCTGTTTTTAGAAGACTTGGGG - Intronic
1195532495 X:105972433-105972455 CTCTTTTTCTGGAACTCTGATGG + Intergenic
1198184945 X:134245357-134245379 CTCTGTTTCTTGAAAATTTAGGG - Exonic
1198492907 X:137161429-137161451 CTCTATTTCTACCAGACAGAAGG + Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1202371196 Y:24197187-24197209 CTCTGTTTCTAGATGGCTATTGG - Intergenic
1202499588 Y:25472930-25472952 CTCTGTTTCTAGATGGCTATTGG + Intergenic