ID: 1142029818

View in Genome Browser
Species Human (GRCh38)
Location 16:87832944-87832966
Sequence GGAGGCCGAGTGGCTGCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 300}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142029818_1142029823 -6 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029823 16:87832961-87832983 GCCTCCTGGCTATGTCTCCTGGG 0: 1
1: 0
2: 3
3: 35
4: 356
1142029818_1142029831 23 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029831 16:87832990-87833012 CCTGCATGAGCTTCTGACACAGG 0: 1
1: 0
2: 0
3: 17
4: 158
1142029818_1142029822 -7 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029822 16:87832960-87832982 GGCCTCCTGGCTATGTCTCCTGG 0: 1
1: 0
2: 3
3: 30
4: 232
1142029818_1142029832 27 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029832 16:87832994-87833016 CATGAGCTTCTGACACAGGACGG 0: 1
1: 0
2: 3
3: 16
4: 213
1142029818_1142029826 -4 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029826 16:87832963-87832985 CTCCTGGCTATGTCTCCTGGGGG 0: 1
1: 0
2: 3
3: 23
4: 256
1142029818_1142029825 -5 Left 1142029818 16:87832944-87832966 CCTCCGGCAGCCACTCGGCCTCC 0: 1
1: 0
2: 0
3: 26
4: 300
Right 1142029825 16:87832962-87832984 CCTCCTGGCTATGTCTCCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142029818 Original CRISPR GGAGGCCGAGTGGCTGCCGG AGG (reversed) Exonic